AOAH Gene (Protein Coding)

Acyloxyacyl Hydrolase

GC07M036519
GIFtS:
38
This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript va... See more...

Aliases for AOAH Gene

Aliases for AOAH Gene

  • Acyloxyacyl Hydrolase 2 3 4 5
  • Acyloxyacyl Hydrolase (Neutrophil) 2 3
  • EC 3.1.1.77 4

External Ids for AOAH Gene

Previous GeneCards Identifiers for AOAH Gene

  • GC07M036199
  • GC07M036293
  • GC07M036325

Summaries for AOAH Gene

Entrez Gene Summary for AOAH Gene

  • This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Apr 2010]

GeneCards Summary for AOAH Gene

AOAH (Acyloxyacyl Hydrolase) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include hydrolase activity, acting on ester bonds and acyloxyacyl hydrolase activity.

UniProtKB/Swiss-Prot Summary for AOAH Gene

  • Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145, PubMed:29343645). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).

Gene Wiki entry for AOAH Gene

Additional gene information for AOAH Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for AOAH Gene

Genomics for AOAH Gene

GeneHancer (GH) Regulatory Elements for AOAH Gene

Promoters and enhancers for AOAH Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH07J036721 Promoter/Enhancer 1.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 769.9 +0.9 869 8.2 MYC MAX SP1 MAFK ELF1 RUNX3 MAFG BCLAF1 GABPA POLR2A AOAH MIR1200 ELMO1 piR-30853-068
GH07J036745 Promoter/Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 18.1 -23.8 -23832 4.9 FOXA1 RAD21 SP1 MAFK IKZF1 ZIC2 CEBPA RXRA IKZF2 NFE2 AOAH MIR1200 ENSG00000229424 lnc-ANLN-7
GH07J036276 Promoter/Enhancer 1.9 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 13.6 +441.8 441834 12.6 ZNF24 MLX RBPJ POLR2A NR2F1 NR2F6 CREB1 MIXL1 MYC NFYC EEPD1 AOAH ENSG00000260070 SEPTIN7 HSALNG0057258 piR-33804-084
GH07J036650 Enhancer 1.5 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 15.2 +67.7 67726 12 HLF POU5F1 SP1 CEBPG PRDM1 ZNF644 PKNOX1 CEBPA CEBPB ZNF629 AOAH ELMO1 lnc-ELMO1-1 piR-31199-331
GH07J036690 Enhancer 0.8 Ensembl ENCODE dbSUPER 24.6 +32.3 32348 4.4 MYC MAX IKZF1 POLR2A EED RCOR1 CUX1 AOAH piR-30853-068 lnc-ELMO1-1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AOAH on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AOAH gene promoter:
  • COUP
  • COUP-TF
  • COUP-TF1
  • HNF-4alpha1
  • HNF-4alpha2
  • oct-B2
  • oct-B3
  • POU2F1
  • POU2F1a
  • POU2F2

Genomic Locations for AOAH Gene

Genomic Locations for AOAH Gene
chr7:36,512,941-36,724,549
(GRCh38/hg38)
Size:
211,609 bases
Orientation:
Minus strand
chr7:36,552,456-36,764,154
(GRCh37/hg19)
Size:
211,699 bases
Orientation:
Minus strand

Genomic View for AOAH Gene

Genes around AOAH on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AOAH Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AOAH Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for AOAH Gene

Proteins for AOAH Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for AOAH Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P28039-AOAH_HUMAN
    Recommended name:
    Acyloxyacyl hydrolase
    Protein Accession:
    P28039
    Secondary Accessions:
    • A4D1Y5
    • B7Z490
    • Q53F13

    Protein attributes for AOAH Gene

    Size:
    575 amino acids
    Molecular mass:
    65105 Da
    Cofactor:
    Name=Ca(2+); Xref=ChEBI:CHEBI:29108;
    Quaternary structure:
    • Heterodimer of the large and small subunits; disulfide-linked.

    Three dimensional structures from OCA and Proteopedia for AOAH Gene

    Alternative splice isoforms for AOAH Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AOAH Gene

Protein Expression for AOAH Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for AOAH Gene

Other Protein References for AOAH Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for AOAH Gene

Domains & Families for AOAH Gene

Gene Families for AOAH Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Predicted secreted proteins

Protein Domains for AOAH Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for AOAH Gene

GenScript: Design optimal peptide antigens:
  • Acyloxyacyl hydrolase (AOAH_HUMAN)
  • cDNA FLJ50796, highly similar to Acyloxyacyl hydrolase (EC 3.1.1.77) (B7Z490_HUMAN)
  • cDNA FLJ51934, highly similar to Acyloxyacyl hydrolase (EC 3.1.1.77) (B7Z598_HUMAN)
genes like me logo Genes that share domains with AOAH: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for AOAH Gene

Function for AOAH Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for AOAH Gene

UniProtKB/Swiss-Prot Function:
Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145, PubMed:29343645). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=a 3-(acyloxy)acyl derivative of bacterial toxin + H2O = 3-hydroxyacyl derivative of bacterial toxin + a fatty acid + H(+); Xref=Rhea:RHEA:12032, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:28868, ChEBI:CHEBI:136853, ChEBI:CHEBI:140675; EC=3.1.1.77; Evidence={ECO:0000269 PubMed:1883828, ECO:0000269 PubMed:29343645, ECO:0000269 PubMed:8089145};.
UniProtKB/Swiss-Prot EnzymeRegulation:
Inhibited by EDTA.
GENATLAS Biochemistry:
acyloxyacyl hydrolase,two-subunit lipase expressed in phagocytic cells,specifically hydrolyzing the secondary acyl chains of the liposaccharide found in the walls of gram-negative bacteria

Enzyme Numbers (IUBMB) for AOAH Gene

Phenotypes From GWAS Catalog for AOAH Gene

Gene Ontology (GO) - Molecular Function for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IDA 29343645
GO:0016787 hydrolase activity IEA --
GO:0016788 hydrolase activity, acting on ester bonds IEA --
GO:0046872 metal ion binding IEA --
GO:0050528 acyloxyacyl hydrolase activity IDA 1883828
genes like me logo Genes that share ontologies with AOAH: view
genes like me logo Genes that share phenotypes with AOAH: view

Animal Models for AOAH Gene

MGI Knock Outs for AOAH:

Animal Model Products

CRISPR Products

Clone Products

No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for AOAH Gene

Localization for AOAH Gene

Subcellular locations from UniProtKB/Swiss-Prot for AOAH Gene

Secreted. Cytoplasmic vesicle. Note=Detected in urine. {ECO:0000250 UniProtKB:O35298}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AOAH gene
Compartment Confidence
extracellular 4
plasma membrane 1
lysosome 1

Gene Ontology (GO) - Cellular Components for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0031410 cytoplasmic vesicle IEA --
genes like me logo Genes that share ontologies with AOAH: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for AOAH Gene

Pathways & Interactions for AOAH Gene

PathCards logo

SuperPathways for AOAH Gene

No Data Available

Interacting Proteins for AOAH Gene

STRING Interaction Network Preview (showing top 1 STRING interactants - click image to see details)
STRING Interaction Network
Selected Interacting proteins: ENSP00000479664 P28039-AOAH_HUMAN for AOAH Gene via STRING IID

GPS-Prot Interaction Network for AOAH

Gene Ontology (GO) - Biological Process for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0006631 fatty acid metabolic process IDA 1883828
GO:0008653 lipopolysaccharide metabolic process IEA --
GO:0009104 lipopolysaccharide catabolic process IDA 1883828
GO:0050728 negative regulation of inflammatory response IEA --
genes like me logo Genes that share ontologies with AOAH: view

No data available for Pathways by source and SIGNOR curated interactions for AOAH Gene

Drugs & Compounds for AOAH Gene

Products:

  1. Drug

(1) Drugs for AOAH Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Water Approved Pharma 0

(1) Additional Compounds for AOAH Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with AOAH: view

Transcripts for AOAH Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for AOAH Gene

(3) REFSEQ mRNAs :
(11) Additional mRNA sequences :
(51) Selected AceView cDNA sequences:
(12) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AOAH Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24a · 24b
SP1: - - - -
SP2:
SP3:

Relevant External Links for AOAH Gene

GeneLoc Exon Structure for
AOAH
ECgene alternative splicing isoforms for
AOAH

Expression for AOAH Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AOAH Gene

mRNA expression in normal human tissues for AOAH Gene
mRNA expression by GTEx for AOAH GenemRNA expression by BioGPS for AOAH Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for AOAH Gene

This gene is overexpressed in Whole Blood (x29.7) and Spleen (x7.1).

Protein differential expression in normal tissues from HIPED for AOAH Gene

This gene is overexpressed in Spleen (31.7), Peripheral blood mononuclear cells (20.7), and Monocytes (13.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AOAH Gene



Protein tissue co-expression partners for AOAH Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of AOAH Gene:

AOAH

SOURCE GeneReport for Unigene cluster for AOAH Gene:

Hs.488007

Evidence on tissue expression from TISSUES for AOAH Gene

  • Blood(4.4)
  • Pancreas(4.1)
  • Spleen(2.3)
genes like me logo Genes that share expression patterns with AOAH: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for AOAH Gene

Orthologs for AOAH Gene

This gene was present in the common ancestor of chordates.

Orthologs for AOAH Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia AOAH 33 32
  • 99.3 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia AOAH 33 32
  • 86.84 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia AOAH 33 32
  • 84.93 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Aoah 32
  • 82.42 (n)
mouse
(Mus musculus)
 Mammalia Aoah 17 33 32
  • 81.3 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia AOAH 33
  • 60 (a)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia AOAH 33
  • 57 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves AOAH 33 32
  • 68.09 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia AOAH 33
  • 62 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia aoah 32
  • 59.84 (n)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 33
  • 44 (a)
 OneToOne
Species where no ortholog for AOAH was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for AOAH Gene

ENSEMBL:
Gene Tree for AOAH (if available)
TreeFam:
Gene Tree for AOAH (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AOAH: view image

Paralogs for AOAH Gene

No data available for Paralogs for AOAH Gene

Variants for AOAH Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for AOAH Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000006851 -- 36,619,449(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000011334 -- 36,640,194(-) G/C genic_upstream_transcript_variant, intron_variant
rs1000018486 -- 36,601,755(-) T/A genic_upstream_transcript_variant, intron_variant
rs1000070682 -- 36,558,973(-) CTGCACCCACTGTCCTGCACCCACTGTC/CTGCACCCACTGTC intron_variant
rs1000086225 -- 36,720,006(-) C/A/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for AOAH Gene

Variant ID Type Subtype PubMed ID
esv2613811 CNV deletion 19546169
esv2676624 CNV deletion 23128226
esv33783 CNV gain 17666407
esv3576308 CNV gain 25503493
esv3612835 CNV loss 21293372
nsv1016732 CNV gain 25217958
nsv1032157 CNV gain 25217958
nsv1115738 CNV duplication 24896259
nsv1125426 OTHER inversion 24896259
nsv1137210 CNV deletion 24896259
nsv366801 CNV deletion 16902084
nsv464427 CNV loss 19166990
nsv470199 CNV loss 18288195
nsv473135 CNV novel sequence insertion 20440878
nsv477438 CNV novel sequence insertion 20440878
nsv5700 CNV insertion 18451855
nsv606618 CNV loss 21841781
nsv606619 CNV loss 21841781
nsv606620 CNV loss 21841781
nsv830957 CNV gain 17160897
nsv830958 CNV gain 17160897
nsv830960 CNV loss 17160897
nsv951630 CNV deletion 24416366
nsv957603 CNV deletion 24416366

Variation tolerance for AOAH Gene

Residual Variation Intolerance Score: 91.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.92; 74.39% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AOAH Gene

Human Gene Mutation Database (HGMD)
AOAH
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AOAH

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AOAH Gene

Disorders for AOAH Gene

Additional Disease Information for AOAH

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for AOAH Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for AOAH Gene

Publications for AOAH Gene

  1. Expression and characterization of recombinant human acyloxyacyl hydrolase, a leukocyte enzyme that deacylates bacterial lipopolysaccharides. (PMID: 1883828) Hagen FS … Munford RS (Biochemistry 1991) 2 3 4 23 56
  2. Polymorphisms in the novel gene acyloxyacyl hydroxylase (AOAH) are associated with asthma and associated phenotypes. (PMID: 16815140) Barnes KC … Mathias RA (The Journal of allergy and clinical immunology 2006) 3 23 43 56
  3. Crystal structure of the mammalian lipopolysaccharide detoxifier. (PMID: 29343645) Gorelik A … Nagar B (Proceedings of the National Academy of Sciences of the United States of America 2018) 3 4 56
  4. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 43 56
  5. Host determinants of HIV-1 control in African Americans. (PMID: 20205591) Pelak K … National Institute of Allergy and Infectious Diseases Center for HIV/AIDS Vaccine Immunology (CHAVI) (The Journal of infectious diseases 2010) 3 43 56

ExternalLinks

View latest publications for AOAH gene in Mastermind

Products for AOAH Gene

Sources for AOAH Gene