Aliases for AOAH Gene
Aliases for AOAH Gene
External Ids for AOAH Gene
- HGNC: 548
- Entrez Gene: 313
- Ensembl: ENSG00000136250
- OMIM: 102593
- UniProtKB: P28039
Previous GeneCards Identifiers for AOAH Gene
- GC07M036199
- GC07M036293
- GC07M036325
Summaries for AOAH Gene
-
This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Apr 2010]
GeneCards Summary for AOAH Gene
AOAH (Acyloxyacyl Hydrolase) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include hydrolase activity, acting on ester bonds and acyloxyacyl hydrolase activity.
UniProtKB/Swiss-Prot for AOAH Gene
-
Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).
Additional gene information for AOAH Gene
- Monarch Initiative
- Search for AOAH at DataMed
- Search for AOAH at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AOAH Gene
Genomics for AOAH Gene
GeneHancer (GH) Regulatory Elements for AOAH Gene
Promoters and enhancers for AOAH Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around AOAH on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the AOAH gene promoter:
Regulatory Element Products
Genomic Locations for AOAH Gene
Genomic Locations for AOAH Gene
- chr7:36,512,941-36,724,549
- (GRCh38/hg38)
- Size:
- 211,609 bases
- Orientation:
- Minus strand
- chr7:36,552,456-36,764,154
- (GRCh37/hg19)
Genomic View for AOAH Gene
Genes around AOAH on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 7p14.2 by Entrez Gene
- 7p14.2 by HGNC
- 7p14.2 by Ensembl
AOAH Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for AOAH Gene
Proteins for AOAH Gene
-
Protein details for AOAH Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P28039-AOAH_HUMAN
- Recommended name:
- Acyloxyacyl hydrolase
- Protein Accession:
- P28039
- A4D1Y5
- B7Z490
- Q53F13
Protein attributes for AOAH Gene
- Size:
- 575 amino acids
- Molecular mass:
- 65105 Da
- Quaternary structure:
-
- Heterodimer of the large and small subunits; disulfide-linked.
Protein Expression for AOAH Gene
Post-translational modifications for AOAH Gene
- The small subunit is N-glycosylated.
- Glycosylation at Asn466, Asn409, posLast=336336, Asn207, and Asn59
- Modification sites at PhosphoSitePlus
Other Protein References for AOAH Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for AOAH
- Invitrogen Antibodies for AOAH
- Search GeneTex for Antibodies for AOAH
Protein Products
-
OriGene Purified Proteins for AOAH
- Search Origene for MassSpec and Protein Over-expression Lysates for AOAH
- Origene Custom Protein Services for AOAH
- antibodies-online: Search results for 9 available AOAH Proteins ranked by validation data
- Compare Top AOAH Proteins
-
Quality Products:
- Search GeneTex for Proteins for AOAH
Assay Products
- antibodies-online: Search results for 8 available AOAH Elisa Kits ranked by validation data
- Compare Top AOAH Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for AOAH Gene
Domains & Families for AOAH Gene
Gene Families for AOAH Gene
- Human Protein Atlas (HPA):
-
- Enzymes
- Predicted secreted proteins
Protein Domains for AOAH Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for AOAH Gene
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for AOAH Gene
Function for AOAH Gene
Molecular function for AOAH Gene
- UniProtKB/Swiss-Prot Function:
- Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).
- UniProtKB/Swiss-Prot CatalyticActivity:
- 3-(acyloxy)acyl group of bacterial toxin = 3-hydroxyacyl group of bacterial toxin + a fatty acid.
- GENATLAS Biochemistry:
- acyloxyacyl hydrolase,two-subunit lipase expressed in phagocytic cells,specifically hydrolyzing the secondary acyl chains of the liposaccharide found in the walls of gram-negative bacteria
Enzyme Numbers (IUBMB) for AOAH Gene
Phenotypes From GWAS Catalog for AOAH Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003824 | catalytic activity | TAS | 1883828 |
| GO:0004465 | lipoprotein lipase activity | TAS | 1883828 |
| GO:0016787 | hydrolase activity | IEA | -- |
| GO:0016788 | hydrolase activity, acting on ester bonds | IEA | -- |
| GO:0050528 | acyloxyacyl hydrolase activity | IEA | -- |
Phenotypes for AOAH Gene
- MGI mutant phenotypes for AOAH:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for AOAH:
Animal Models for AOAH Gene
- MGI Knock Outs for AOAH:
-
- Aoah Aoah<tm1Rsm>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for AOAH
-
CRISPR Products
-
OriGene CRISPR knockouts for AOAH
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AOAH
- genomics-online: gRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- Applied Biological Materials CRISPR for AOAH
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for AOAH
- GenScript: Design CRISPR guide RNA sequences for AOAH
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for AOAH
- Browse OriGene Inhibitory RNA Products For AOAH
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AOAH
- genomics-online: shRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
Clone Products
-
OriGene ORF clones in human for AOAH
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for AOAH
- VectorBuilder custom plasmid, inducible vectors for AOAH
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AOAH
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AOAH
- Applied Biological Materials Clones for AOAH
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for AOAH
No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for AOAH Gene
Localization for AOAH Gene
Subcellular locations from UniProtKB/Swiss-Prot for AOAH Gene
- Secreted. Cytoplasmic vesicle. Note=Detected in urine. {ECO:0000250 UniProtKB:O35298}.
| Compartment | Confidence |
|---|---|
| extracellular | 4 |
| plasma membrane | 2 |
| lysosome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005576 | extracellular region | IEA | -- |
| GO:0031410 | cytoplasmic vesicle | IEA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for AOAH Gene
Pathways & Interactions for AOAH Gene
No Data Available
Interacting Proteins for AOAH Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006629 | lipid metabolic process | TAS | 1883828 |
| GO:0006954 | inflammatory response | TAS | 1883828 |
| GO:0008653 | lipopolysaccharide metabolic process | IEA | -- |
| GO:0050728 | negative regulation of inflammatory response | IEA | -- |
No data available for Pathways by source and SIGNOR curated interactions for AOAH Gene
Drugs & Compounds for AOAH Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Water | Approved | Pharma | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Transcripts for AOAH Gene
mRNA/cDNA for AOAH Gene
- (51) Selected AceView cDNA sequences:
- (6) Additional mRNA sequences :
- (16) REFSEQ mRNAs :
- (12) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000414637 551 bps (uc064cvu.1)
- ENST00000435386 678 bps (uc064cvt.1)
- ENST00000480201 591 bps (uc064cvr.1)
- ENST00000487014 543 bps (uc064cvp.1)
- ENST00000491444 647 bps (uc064cvo.1)
Unigene Clusters for AOAH Gene
- Acyloxyacyl hydrolase (neutrophil):
- Representative Sequences:
CRISPR Products
-
OriGene CRISPR knockouts for AOAH
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AOAH
- genomics-online: gRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- Applied Biological Materials CRISPR for AOAH
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for AOAH
- GenScript: Design CRISPR guide RNA sequences for AOAH
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for AOAH
- Browse OriGene Inhibitory RNA Products For AOAH
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AOAH
- genomics-online: shRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
Clone Products
-
OriGene ORF clones in human for AOAH
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for AOAH
- VectorBuilder custom plasmid, inducible vectors for AOAH
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AOAH
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AOAH
- Applied Biological Materials Clones for AOAH
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7 | ^ | 8 | ^ | 9 | ^ | 10 | ^ | 11 | ^ | 12 | ^ | 13 | ^ | 14 | ^ | 15 | ^ | 16 | ^ | 17 | ^ | 18 | ^ | 19 | ^ | 20 | ^ | 21 | ^ | 22 | ^ | 23a | · | 23b | ^ | 24a | · | 24b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP2: | |||||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: |
Expression for AOAH Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Blood (Hematopoietic System)
- Monocytes Peripheral Blood
- Natural Killer Cells Peripheral Blood
-
Spleen (Hematopoietic System)
mRNA differential expression in normal tissues according to GTEx for AOAH Gene
This gene is overexpressed in Whole Blood (x29.7) and Spleen (x7.1).
This gene is overexpressed in Spleen (31.7), Peripheral blood mononuclear cells (20.7), and Monocytes (13.9).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AOAH Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of AOAH Gene:
AOAHSOURCE GeneReport for Unigene cluster for AOAH Gene:
Hs.488007Evidence on tissue expression from TISSUES for AOAH Gene
- Blood(4.4)
- Pancreas(4.1)
- Spleen(2.3)
Primer Products
-
OriGene qPCR primer pairs and template standards for AOAH
-
OriGene qPCR primer pairs for AOAH
- genomics-online: primer clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
Gene Expression Assay Products
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for AOAH Gene
Orthologs for AOAH Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | AOAH 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | AOAH 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | AOAH 34 33 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Aoah 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Aoah 16 34 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | AOAH 34 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | AOAH 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | AOAH 34 33 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | AOAH 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | aoah 33 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToOne |
- Species where no ortholog for AOAH was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
- zebrafish (Danio rerio)
Evolution for AOAH Gene
- ENSEMBL:
- Gene Tree for AOAH (if available)
- TreeFam:
- Gene Tree for AOAH (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for AOAH: view image
Paralogs for AOAH Gene
No data available for Paralogs for AOAH Gene
Variants for AOAH Gene
| SNP ID | Clin | Chr 07 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1000006851 | -- | 36,619,449(-) | C/T | genic_upstream_transcript_variant, intron_variant | |
| rs1000011334 | -- | 36,640,194(-) | G/C | genic_upstream_transcript_variant, intron_variant | |
| rs1000018486 | -- | 36,601,755(-) | T/A | genic_upstream_transcript_variant, intron_variant | |
| rs1000070682 | -- | 36,558,973(-) | CTGCACCCACTGTCCTGCACCCACTGTC/CTGCACCCACTGTC | intron_variant | |
| rs1000086225 | -- | 36,720,006(-) | C/A/T | genic_upstream_transcript_variant, intron_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| esv2613811 | CNV | deletion | 19546169 |
| esv2676624 | CNV | deletion | 23128226 |
| esv33783 | CNV | gain | 17666407 |
| esv3576308 | CNV | gain | 25503493 |
| esv3612835 | CNV | loss | 21293372 |
| nsv1016732 | CNV | gain | 25217958 |
| nsv1032157 | CNV | gain | 25217958 |
| nsv1115738 | CNV | duplication | 24896259 |
| nsv1125426 | OTHER | inversion | 24896259 |
| nsv1137210 | CNV | deletion | 24896259 |
| nsv366801 | CNV | deletion | 16902084 |
| nsv464427 | CNV | loss | 19166990 |
| nsv470199 | CNV | loss | 18288195 |
| nsv473135 | CNV | novel sequence insertion | 20440878 |
| nsv477438 | CNV | novel sequence insertion | 20440878 |
| nsv5700 | CNV | insertion | 18451855 |
| nsv606618 | CNV | loss | 21841781 |
| nsv606619 | CNV | loss | 21841781 |
| nsv606620 | CNV | loss | 21841781 |
| nsv830957 | CNV | gain | 17160897 |
| nsv830958 | CNV | gain | 17160897 |
| nsv830960 | CNV | loss | 17160897 |
| nsv951630 | CNV | deletion | 24416366 |
| nsv957603 | CNV | deletion | 24416366 |
Residual Variation Intolerance Score:
91.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
5.92;
74.39% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for AOAH Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AOAH Gene
Disorders for AOAH Gene
Additional Disease Information for AOAH
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for AOAH Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for AOAH Gene
Publications for AOAH Gene
- Expression and characterization of recombinant human acyloxyacyl hydrolase, a leukocyte enzyme that deacylates bacterial lipopolysaccharides. (PMID: 1883828) Hagen FS … Munford RS (Biochemistry 1991) 2 3 4 22 58
- Polymorphisms in the novel gene acyloxyacyl hydroxylase (AOAH) are associated with asthma and associated phenotypes. (PMID: 16815140) Barnes KC … Mathias RA (The Journal of allergy and clinical immunology 2006) 3 22 44 58
- Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
- Host determinants of HIV-1 control in African Americans. (PMID: 20205591) Pelak K … National Institute of Allergy and Infectious Diseases Center for HIV/AIDS Vaccine Immunology (CHAVI) (The Journal of infectious diseases 2010) 3 44 58
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
Products for AOAH Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for AOAH
- Search Origene for MassSpec and Protein Over-expression Lysates for AOAH
- Origene Custom Protein Services for AOAH
- Origene shrna, sirna, and RNAi products in human, mouse, rat for AOAH
- Browse OriGene Inhibitory RNA Products For AOAH
- OriGene qPCR primer pairs and template standards for AOAH
- OriGene qPCR primer pairs for AOAH
- OriGene CRISPR knockouts for AOAH
- OriGene ORF clones in human for AOAH
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For AOAH
- GenScript: Next-day shipping of latest version cDNA ORF clones for AOAH in any vector
- GenScript Custom Purified and Recombinant Proteins Services for AOAH
- GenScript Custom Assay Services for AOAH
- GenScript Custom overexpressing Cell Line Services for AOAH
- GenScript: Design CRISPR guide RNA sequences for AOAH
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for AOAH
- Sino Biological Human cDNA Clone for AOAH
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for AOAH
- Novus Biologicals lysates and proteins for AOAH
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- VectorBuilder custom plasmid, inducible vectors for AOAH
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AOAH
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 28 available AOAH Antibodies ranked by validation data
- Compare Top AOAH Antibodies
- antibodies-online: Search results for 8 available AOAH Elisa Kits ranked by validation data
- Compare Top AOAH Elisa Kits
- Quality Products:
- antibodies-online: Search results for 9 available AOAH Proteins ranked by validation data
- Compare Top AOAH Proteins
- Quality Products:
- Search GeneTex for Antibodies for AOAH
- Search GeneTex for Proteins for AOAH
- Horizon Cell Lines for AOAH
- genomics-online: cdna clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- orf clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- genomics-online: gRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- genomics-online: primer clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- genomics-online: shRNA clones - Search results for 105 available AOAH gene related products
- Overview of 105 available AOAH gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AOAH
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AOAH
- GeneCopoeia miRNA 3'UTR Target clone products for AOAH
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AOAH
Sources for AOAH Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio