Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ANKRD34B Gene

Aliases for ANKRD34B Gene

  • Ankyrin Repeat Domain 34B 2 3 5
  • Ankyrin Repeat Domain-Containing Protein 34B 3
  • Dendritic Phosphoprotein 58 KDa 3
  • Cytosolic Phosphoprotein DP58 3
  • DP58 3

External Ids for ANKRD34B Gene

Previous GeneCards Identifiers for ANKRD34B Gene

  • GC05M079888
  • GC05M075060

Summaries for ANKRD34B Gene

GeneCards Summary for ANKRD34B Gene

ANKRD34B (Ankyrin Repeat Domain 34B) is a Protein Coding gene. An important paralog of this gene is ANKRD34C.

Additional gene information for ANKRD34B Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ANKRD34B Gene

Genomics for ANKRD34B Gene

GeneHancer (GH) Regulatory Elements for ANKRD34B Gene

Promoters and enhancers for ANKRD34B Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J080573 Enhancer 0.2 FANTOM5 650.7 -0.7 -652 0.1 ANKRD34B SPZ1 DBIP2
GH05J080607 Enhancer 0.8 ENCODE 11.9 -35.3 -35298 0.3 ELF3 SOX13 IRF2 FOXA2 SAP130 ARID4B BATF ZNF644 IRF4 RARA DHFR ANKRD34B DBIP2 GC05M080611
GH05J080606 Enhancer 0.2 FANTOM5 11.2 -34.0 -33993 0 ANKRD34B DBIP2 GC05M080611
GH05J080568 Enhancer 0.2 FANTOM5 7.6 +4.5 4542 0.1 ANKRD34B RPL7P24
GH05J080569 Enhancer 0.8 ENCODE 0.7 +2.5 2498 0.7 ZNF335 GLIS2 SP3 ZEB2 ZFP69B GLIS1 ZNF341 MXD3 ZBTB26 SP7 DHFR ANKRD34B RPL7P24
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ANKRD34B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ANKRD34B gene promoter:
  • MyoD
  • HSF2
  • AML1a
  • ATF6
  • NF-kappaB1
  • NF-kappaB
  • E47
  • Hand1
  • YY1
  • Pax-4a

Genomic Locations for ANKRD34B Gene

Genomic Locations for ANKRD34B Gene
15,999 bases
Minus strand
13,734 bases
Minus strand

Genomic View for ANKRD34B Gene

Genes around ANKRD34B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ANKRD34B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ANKRD34B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ANKRD34B Gene

Proteins for ANKRD34B Gene

  • Protein details for ANKRD34B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Ankyrin repeat domain-containing protein 34B
    Protein Accession:
    Secondary Accessions:
    • B2RPH1
    • Q68D79

    Protein attributes for ANKRD34B Gene

    514 amino acids
    Molecular mass:
    56414 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ANKRD34B Gene

Post-translational modifications for ANKRD34B Gene

Other Protein References for ANKRD34B Gene

No data available for DME Specific Peptides for ANKRD34B Gene

Domains & Families for ANKRD34B Gene

Gene Families for ANKRD34B Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for ANKRD34B Gene

Suggested Antigen Peptide Sequences for ANKRD34B Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the ANKRD34 family.
  • Belongs to the ANKRD34 family.
genes like me logo Genes that share domains with ANKRD34B: view

Function for ANKRD34B Gene

genes like me logo Genes that share phenotypes with ANKRD34B: view

Animal Model Products

CRISPR Products

miRNA for ANKRD34B Gene

miRTarBase miRNAs that target ANKRD34B

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ANKRD34B

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for ANKRD34B Gene

Localization for ANKRD34B Gene

Subcellular locations from UniProtKB/Swiss-Prot for ANKRD34B Gene

Cytoplasm. Nucleus.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ANKRD34B gene
Compartment Confidence
nucleus 4
cytosol 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Mitochondria (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ANKRD34B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with ANKRD34B: view

Pathways & Interactions for ANKRD34B Gene

SuperPathways for ANKRD34B Gene

No Data Available

Interacting Proteins for ANKRD34B Gene

Selected Interacting proteins: A5PLL1-AN34B_HUMAN for ANKRD34B Gene via IID

Symbol External ID(s) Details

Gene Ontology (GO) - Biological Process for ANKRD34B Gene


No data available for Pathways by source and SIGNOR curated interactions for ANKRD34B Gene

Drugs & Compounds for ANKRD34B Gene

No Compound Related Data Available

Transcripts for ANKRD34B Gene

mRNA/cDNA for ANKRD34B Gene

(4) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(5) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ANKRD34B Gene

Ankyrin repeat domain 34B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ANKRD34B

Alternative Splicing Database (ASD) splice patterns (SP) for ANKRD34B Gene

No ASD Table

Relevant External Links for ANKRD34B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ANKRD34B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ANKRD34B Gene

mRNA differential expression in normal tissues according to GTEx for ANKRD34B Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x14.9), Brain - Putamen (basal ganglia) (x12.8), and Brain - Caudate (basal ganglia) (x12.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ANKRD34B Gene

Protein tissue co-expression partners for ANKRD34B Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ANKRD34B Gene:


SOURCE GeneReport for Unigene cluster for ANKRD34B Gene:


Evidence on tissue expression from TISSUES for ANKRD34B Gene

  • Nervous system(4.1)
genes like me logo Genes that share expression patterns with ANKRD34B: view

No data available for Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for ANKRD34B Gene

Orthologs for ANKRD34B Gene

This gene was present in the common ancestor of chordates.

Orthologs for ANKRD34B Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ANKRD34B 34 33
  • 99.61 (n)
(Bos Taurus)
Mammalia ANKRD34B 34 33
  • 88.87 (n)
(Canis familiaris)
Mammalia ANKRD34B 34 33
  • 88.07 (n)
(Mus musculus)
Mammalia Ankrd34b 16 34 33
  • 81.76 (n)
(Rattus norvegicus)
Mammalia Ankrd34b 33
  • 81.5 (n)
(Ornithorhynchus anatinus)
Mammalia ANKRD34B 34
  • 72 (a)
(Gallus gallus)
Aves ANKRD34B 34
  • 63 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 67 (a)
-- 34
  • 67 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ankrd34b 33
  • 66.27 (n)
(Danio rerio)
Actinopterygii ankrd34bb 34 33
  • 56.91 (n)
ankrd34ba 34
  • 44 (a)
Species where no ortholog for ANKRD34B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ANKRD34B Gene

Gene Tree for ANKRD34B (if available)
Gene Tree for ANKRD34B (if available)
Evolutionary constrained regions (ECRs) for ANKRD34B: view image

Paralogs for ANKRD34B Gene

Paralogs for ANKRD34B Gene

(2) SIMAP similar genes for ANKRD34B Gene using alignment to 2 proteins:

  • D6RH12_HUMAN
genes like me logo Genes that share paralogs with ANKRD34B: view

Variants for ANKRD34B Gene

Sequence variations from dbSNP and Humsavar for ANKRD34B Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1000029159 -- 80,568,293(-) C/A genic_upstream_transcript_variant, intron_variant
rs1000089828 -- 80,565,024(-) G/A/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000093866 -- 80,562,004(-) A/G intron_variant
rs1000097416 -- 80,570,535(-) CGCTTCGGCCACCGCGCTTCGGCCAC/CGCTTCGGCCAC upstream_transcript_variant
rs1000339345 -- 80,570,085(-) T/C genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ANKRD34B Gene

Variant ID Type Subtype PubMed ID
dgv5705n100 CNV gain 25217958
dgv5706n100 CNV gain 25217958
dgv5707n100 CNV gain 25217958
esv3575860 CNV gain 25503493
esv3575862 CNV gain 25503493
esv3605573 CNV loss 21293372
esv3605576 CNV loss 21293372
esv3605577 CNV gain 21293372
nsv483112 CNV loss 15286789

Variation tolerance for ANKRD34B Gene

Residual Variation Intolerance Score: 56.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.37; 42.03% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ANKRD34B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ANKRD34B Gene

Disorders for ANKRD34B Gene

Additional Disease Information for ANKRD34B

No disorders were found for ANKRD34B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ANKRD34B Gene

Publications for ANKRD34B Gene

  1. A novel phosphoprotein is induced during bone marrow commitment to dendritic cells. (PMID: 15358210) Al-Shaibi N … Ghosh SK (Biochemical and biophysical research communications 2004) 3 22 58
  2. The full-ORF clone resource of the German cDNA Consortium. (PMID: 17974005) Bechtel S … Schupp I (BMC genomics 2007) 4 58
  3. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PMID: 17903299) Kathiresan S … Cupples LA (BMC medical genetics 2007) 44 58
  4. The DNA sequence and comparative analysis of human chromosome 5. (PMID: 15372022) Schmutz J … Rubin EM (Nature 2004) 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58

Products for ANKRD34B Gene

Sources for ANKRD34B Gene

Loading form....