Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ANKRD11 Gene

Aliases for ANKRD11 Gene

  • Ankyrin Repeat Domain 11 2 3 5
  • Ankyrin Repeat-Containing Cofactor 1 3 4
  • ANCO1 3 4
  • Truncated Ankyrin Repeat Domain 11 Aberrant Transcript 1 3
  • Truncated Ankyrin Repeat Domain 11 Aberrant Transcript 2 3
  • Nasopharyngeal Carcinoma Susceptibility Protein 3
  • Ankyrin Repeat Domain-Containing Protein 11 3
  • ANCO-1 3
  • LZ16 3
  • T13 3

External Ids for ANKRD11 Gene

Previous GeneCards Identifiers for ANKRD11 Gene

  • GC16M089095
  • GC16M089077
  • GC16M087861
  • GC16M089334
  • GC16M075032

Summaries for ANKRD11 Gene

Entrez Gene Summary for ANKRD11 Gene

  • This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]

GeneCards Summary for ANKRD11 Gene

ANKRD11 (Ankyrin Repeat Domain 11) is a Protein Coding gene. Diseases associated with ANKRD11 include Kbg Syndrome and Astigmatism. An important paralog of this gene is ANKRD12.

UniProtKB/Swiss-Prot for ANKRD11 Gene

  • Chromatin regulator which modulates histone acetylation and gene expression in neural precursor cells (By similarity). May recruit histone deacetylases (HDACs) to the p160 coactivators/nuclear receptor complex to inhibit ligand-dependent transactivation (PubMed:15184363). Has a role in proliferation and development of cortical neural precursors (PubMed:25556659). May also regulate bone homeostasis (By similarity).

Additional gene information for ANKRD11 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ANKRD11 Gene

Genomics for ANKRD11 Gene

GeneHancer (GH) Regulatory Elements for ANKRD11 Gene

Promoters and enhancers for ANKRD11 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J089480 Promoter/Enhancer 2.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 677.7 +3.8 3820 12 CLOCK MLX FEZF1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 ZNF548 ANKRD11 ZC3H18 AFG3L1P SPG7 ZNF778 TCF25 MC1R ENSG00000259877 RPL13 RNU6-430P
GH16J089372 Promoter/Enhancer 0.7 EPDnew dbSUPER 650.1 +119.0 119024 0.1 PIR55522 ANKRD11 LINC00304 LOC100287036
GH16J089558 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 69.1 -72.1 -72052 7.9 CLOCK MLX DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC RPL13 SNORD68 GC16P089560 GC16P089561 PIR32702 ANKRD11 AFG3L1P TCF25 ENSG00000268218 ZC3H18
GH16J089993 Enhancer 1.5 Ensembl ENCODE dbSUPER 102.3 -504.7 -504673 3.5 HDGF PKNOX1 CLOCK FOXA2 ARNT ZFP64 ARID4B SIN3A ZNF2 ZBTB7B PIR44838 AFG3L1P ENSG00000259877 ANKRD11 MC1R ACSF3 TCF25 LOC101927863 ENSG00000268218 SNORD68
GH16J089920 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 53.1 -431.7 -431700 4.2 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 POLR2B FOS DEK PAF1 TUBB3 ENSG00000259006 ANKRD11 TCF25 LOC101927863 AFG3L1P SNORD68 ENSG00000268218 ACSF3 RPL13
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ANKRD11 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ANKRD11 gene promoter:
  • AP-1
  • ATF-2
  • c-Jun
  • NF-kappaB1
  • Pax-5
  • ARP-1

Genomic Locations for ANKRD11 Gene

Genomic Locations for ANKRD11 Gene
chr16:89,267,619-89,490,574
(GRCh38/hg38)
Size:
222,956 bases
Orientation:
Minus strand
chr16:89,334,035-89,556,969
(GRCh37/hg19)
Size:
222,935 bases
Orientation:
Minus strand

Genomic View for ANKRD11 Gene

Genes around ANKRD11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ANKRD11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ANKRD11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ANKRD11 Gene

Proteins for ANKRD11 Gene

  • Protein details for ANKRD11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6UB99-ANR11_HUMAN
    Recommended name:
    Ankyrin repeat domain-containing protein 11
    Protein Accession:
    Q6UB99
    Secondary Accessions:
    • Q6NTG1
    • Q6QMF8

    Protein attributes for ANKRD11 Gene

    Size:
    2663 amino acids
    Molecular mass:
    297913 Da
    Quaternary structure:
    • Interacts with the PAS region of the p160 coactivators.
    SequenceCaution:
    • Sequence=AAH69013.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

neXtProt entry for ANKRD11 Gene

Post-translational modifications for ANKRD11 Gene

  • Subject to proteasomal degradation which is probably essential to regulate its activity.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for ANKRD11 Gene

Domains & Families for ANKRD11 Gene

Gene Families for ANKRD11 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for ANKRD11 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ANKRD11: view

No data available for UniProtKB/Swiss-Prot for ANKRD11 Gene

Function for ANKRD11 Gene

Molecular function for ANKRD11 Gene

UniProtKB/Swiss-Prot Function:
Chromatin regulator which modulates histone acetylation and gene expression in neural precursor cells (By similarity). May recruit histone deacetylases (HDACs) to the p160 coactivators/nuclear receptor complex to inhibit ligand-dependent transactivation (PubMed:15184363). Has a role in proliferation and development of cortical neural precursors (PubMed:25556659). May also regulate bone homeostasis (By similarity).

Phenotypes From GWAS Catalog for ANKRD11 Gene

Gene Ontology (GO) - Molecular Function for ANKRD11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IEA --
genes like me logo Genes that share ontologies with ANKRD11: view
genes like me logo Genes that share phenotypes with ANKRD11: view

Human Phenotype Ontology for ANKRD11 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ANKRD11 Gene

MGI Knock Outs for ANKRD11:
  • Ankrd11 Ankrd11<tm1b(EUCOMM)Wtsi>

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ANKRD11 Gene

Localization for ANKRD11 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ANKRD11 Gene

Nucleus. Note=Localizes to chromatin during prometaphase. {ECO:0000269 PubMed:25413698}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ANKRD11 gene
Compartment Confidence
plasma membrane 5
nucleus 5
cytosol 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ANKRD11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 21782149
GO:0005654 nucleoplasm IDA --
GO:0005829 cytosol IDA --
GO:0005886 plasma membrane IDA --
genes like me logo Genes that share ontologies with ANKRD11: view

Pathways & Interactions for ANKRD11 Gene

SuperPathways for ANKRD11 Gene

No Data Available

Gene Ontology (GO) - Biological Process for ANKRD11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001701 in utero embryonic development IEA --
GO:0001894 tissue homeostasis IEA --
GO:0009653 anatomical structure morphogenesis IBA --
GO:0035264 multicellular organism growth IEA --
GO:0042475 odontogenesis of dentin-containing tooth IMP 21782149
genes like me logo Genes that share ontologies with ANKRD11: view

No data available for Pathways by source and SIGNOR curated interactions for ANKRD11 Gene

Drugs & Compounds for ANKRD11 Gene

No Compound Related Data Available

Transcripts for ANKRD11 Gene

Unigene Clusters for ANKRD11 Gene

Ankyrin repeat domain 11:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ANKRD11 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8a · 8b ^ 9a · 9b · 9c · 9d ^ 10a · 10b ^ 11 ^ 12 ^ 13a · 13b · 13c ^ 14a · 14b ^ 15a ·
SP1: - - - - - - - - - - - - - -
SP2: - - - - - - - - - - - - - -
SP3: - - - - - -
SP4: - - -
SP5: - - - - - - - -
SP6:
SP7: - - -
SP8: - -
SP9: - - - -
SP10:
SP11: - - -
SP12: - -
SP13:

ExUns: 15b ^ 16 ^ 17 ^ 18 ^ 19 ^ 20
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11:
SP12:
SP13:

Relevant External Links for ANKRD11 Gene

GeneLoc Exon Structure for
ANKRD11
ECgene alternative splicing isoforms for
ANKRD11

Expression for ANKRD11 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ANKRD11 Gene

Protein differential expression in normal tissues from HIPED for ANKRD11 Gene

This gene is overexpressed in Fetal gut (33.6) and Liver (29.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ANKRD11 Gene



NURSA nuclear receptor signaling pathways regulating expression of ANKRD11 Gene:

ANKRD11

SOURCE GeneReport for Unigene cluster for ANKRD11 Gene:

Hs.740440

Evidence on tissue expression from TISSUES for ANKRD11 Gene

  • Pancreas(4.2)
  • Lymph node(2.9)
  • Intestine(2.6)
  • Nervous system(2.6)
  • Lung(2.1)
  • Skin(2.1)
  • Thyroid gland(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ANKRD11 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • scalp
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • rib
  • rib cage
  • scapula
  • sternum
Pelvis:
  • pelvis
  • testicle
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • coagulation system
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • vertebrae
genes like me logo Genes that share expression patterns with ANKRD11: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for ANKRD11 Gene

Orthologs for ANKRD11 Gene

This gene was present in the common ancestor of animals.

Orthologs for ANKRD11 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ANKRD11 34
  • 99 (a)
OneToOne
dog
(Canis familiaris)
Mammalia ANKRD11 34 33
  • 81.11 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Ankrd11 16 34 33
  • 79.9 (n)
cow
(Bos Taurus)
Mammalia ANKRD11 34 33
  • 79.72 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Ankrd11 33
  • 79.54 (n)
oppossum
(Monodelphis domestica)
Mammalia ANKRD11 34
  • 73 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ANKRD11 34
  • 72 (a)
OneToOne
chicken
(Gallus gallus)
Aves ANKRD11 34 33
  • 73.45 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ANKRD11 34
  • 67 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ankrd11 33
  • 63.84 (n)
Str.20224 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.23820 33
zebrafish
(Danio rerio)
Actinopterygii ankrd11 34 33
  • 59.35 (n)
OneToOne
wufi04c06 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.5161 33
fruit fly
(Drosophila melanogaster)
Insecta CG10984 34
  • 30 (a)
OneToMany
Species where no ortholog for ANKRD11 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ANKRD11 Gene

ENSEMBL:
Gene Tree for ANKRD11 (if available)
TreeFam:
Gene Tree for ANKRD11 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ANKRD11: view image

Paralogs for ANKRD11 Gene

Paralogs for ANKRD11 Gene

(6) SIMAP similar genes for ANKRD11 Gene using alignment to 9 proteins:

  • ANR11_HUMAN
  • H0Y2U4_HUMAN
  • H0Y3E3_HUMAN
  • H3BNU4_HUMAN
  • H3BVB8_HUMAN
  • L0R6C4_HUMAN
  • Q6PEL2_HUMAN
  • Q7Z5E5_HUMAN
  • Q8IVY9_HUMAN

Pseudogenes.org Pseudogenes for ANKRD11 Gene

genes like me logo Genes that share paralogs with ANKRD11: view

Variants for ANKRD11 Gene

Sequence variations from dbSNP and Humsavar for ANKRD11 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1057518663 pathogenic, KBG syndrome 89,283,420(-) G/T coding_sequence_variant, genic_downstream_transcript_variant, stop_gained
rs1057518987 likely-pathogenic, Moderate intellectual deficiency 89,280,324(-) GG/G coding_sequence_variant, frameshift, genic_downstream_transcript_variant
rs1057519399 pathogenic, KBG syndrome 89,281,038(-) A/ coding_sequence_variant, frameshift, genic_downstream_transcript_variant
rs1064795497 likely-pathogenic, pathogenic, not provided 89,279,188(-) G/A/C coding_sequence_variant, genic_downstream_transcript_variant, missense_variant
rs534329317 uncertain-significance, Seizures 89,282,044(-) GCTCGTCCCTGTGATGCCGCAGGAGCTCGTCCCTGTGATGCCGCAG/GCTCGTCCCTGTGATGCCGCAG/GCTCGTCCCTGTGATGCCGCAGGAGCTCGTCCCTGTGATGCCGCAGGAGCTCGTCCCTGTGATGCCGCAG coding_sequence_variant, genic_downstream_transcript_variant, inframe_deletion, inframe_insertion

Structural Variations from Database of Genomic Variants (DGV) for ANKRD11 Gene

Variant ID Type Subtype PubMed ID
esv2763149 CNV gain 21179565
esv3639574 CNV gain 21293372
esv3639575 CNV loss 21293372
esv3639576 CNV gain 21293372
esv3639577 CNV loss 21293372
esv3639579 CNV gain 21293372
esv3639581 CNV loss 21293372
esv2758670 CNV gain 17122850
esv2743301 CNV deletion 23290073
esv2715165 CNV deletion 23290073
esv2715164 CNV deletion 23290073
esv2715162 CNV deletion 23290073
esv2715161 CNV deletion 23290073
esv2715160 CNV deletion 23290073
esv2715159 CNV deletion 23290073
esv2715158 CNV deletion 23290073
esv2715157 CNV deletion 23290073
esv2715156 CNV deletion 23290073
esv2715155 CNV deletion 23290073
esv2715154 CNV deletion 23290073
esv2715153 CNV deletion 23290073
esv2715151 CNV deletion 23290073
esv2715150 CNV deletion 23290073
esv2715148 CNV deletion 23290073
esv2715146 CNV deletion 23290073
esv2715145 CNV deletion 23290073
esv2715144 CNV deletion 23290073
esv2715143 CNV deletion 23290073
esv2715142 CNV deletion 23290073
esv2665887 CNV deletion 23128226
esv2662057 CNV deletion 23128226
esv2657359 CNV deletion 23128226
esv2631884 CNV deletion 19546169
esv26174 CNV gain 19812545
esv2499318 CNV deletion 19546169
esv2283815 CNV deletion 18987734
esv1771804 CNV deletion 17803354
esv1752819 CNV insertion 17803354
esv1743971 CNV insertion 17803354
esv1728025 CNV insertion 17803354
esv1704981 CNV insertion 17803354
esv1506985 CNV deletion 17803354
esv1451902 CNV deletion 17803354
esv1067384 CNV insertion 17803354
esv1011253 CNV deletion 20482838
dgv555e214 CNV loss 21293372
dgv5322n54 CNV loss 21841781
dgv508n67 CNV gain 20364138
dgv384e201 CNV deletion 23290073
dgv3066n100 CNV gain 25217958
dgv1665e59 CNV duplication 20981092
dgv1385n106 CNV deletion 24896259
nsv952074 CNV deletion 24416366
nsv952073 CNV deletion 24416366
nsv9476 CNV loss 18304495
nsv827843 CNV gain 20364138
nsv573735 CNV loss 21841781
nsv573734 CNV loss 21841781
nsv573674 CNV gain 21841781
nsv512455 CNV loss 21212237
nsv509638 CNV insertion 20534489
nsv482951 CNV loss 15286789
nsv471118 CNV gain 18288195
nsv469681 CNV loss 16826518
nsv457622 CNV loss 19166990
nsv428331 CNV gain+loss 18775914
nsv1150658 CNV deletion 26484159
nsv1138486 CNV deletion 24896259
nsv1138485 CNV deletion 24896259
nsv1138484 CNV deletion 24896259
nsv1121519 CNV deletion 24896259
nsv1116174 CNV deletion 24896259
nsv1109037 CNV deletion 24896259
nsv1071314 CNV deletion 25765185
nsv1064089 CNV loss 25217958
nsv1063483 CNV gain 25217958
nsv103540 CNV deletion 16902084
nsv103332 CNV deletion 16902084
esv998083 CNV deletion 20482838
esv994831 CNV deletion 20482838
esv992694 CNV insertion 20482838
esv3892940 CNV loss 25118596
esv3639583 CNV loss 21293372
esv3639582 CNV loss 21293372

Variation tolerance for ANKRD11 Gene

Residual Variation Intolerance Score: 0.62% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.49; 77.55% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ANKRD11 Gene

Human Gene Mutation Database (HGMD)
ANKRD11
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ANKRD11

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ANKRD11 Gene

Disorders for ANKRD11 Gene

MalaCards: The human disease database

(14) MalaCards diseases for ANKRD11 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
kbg syndrome
  • kbgs
astigmatism
esotropia
  • convergence in manifest squint
epicanthus
cryptorchidism, unilateral or bilateral
  • undescended testis
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

ANR11_HUMAN
  • KBG syndrome (KBGS) [MIM:148050]: A syndrome characterized by macrodontia of the upper central incisors, distinctive craniofacial findings, short stature, skeletal anomalies, and neurologic involvement that includes global developmental delay, seizures, and intellectual disability. {ECO:0000269 PubMed:21782149, ECO:0000269 PubMed:25413698}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ANKRD11

genes like me logo Genes that share disorders with ANKRD11: view

No data available for Genatlas for ANKRD11 Gene

Publications for ANKRD11 Gene

  1. Characterization of ANKRD11 mutations in humans and mice related to KBG syndrome. (PMID: 25413698) Walz K … Tekin M (Human genetics 2015) 3 4 58
  2. Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia. (PMID: 21782149) Sirmaci A … Tekin M (American journal of human genetics 2011) 3 4 58
  3. Identification of ANKRD11 as a p53 coactivator. (PMID: 18840648) Neilsen PM … Callen DF (Journal of cell science 2008) 3 22 58
  4. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PMID: 17081983) Olsen JV … Mann M (Cell 2006) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for ANKRD11 Gene

Sources for ANKRD11 Gene

Content
Loading form....