This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature ... See more...

Aliases for ALAS1 Gene

Aliases for ALAS1 Gene

  • 5'-Aminolevulinate Synthase 1 2 3 5
  • 5-Aminolevulinate Synthase, Nonspecific, Mitochondrial 3 4
  • Aminolevulinate, Delta-, Synthase 1 2 3
  • Delta-Aminolevulinate Synthase 1 3 4
  • 5-Aminolevulinic Acid Synthase 1 3 4
  • Delta-ALA Synthase 1 3 4
  • EC 2.3.1.37 4 54
  • ALAS-H 3 4
  • ALAS3 3 4
  • ALASH 3 4
  • Migration-Inducing Protein 4 3
  • EC 2.3.1 54
  • MIG4 3
  • ALAS 3

External Ids for ALAS1 Gene

Previous HGNC Symbols for ALAS1 Gene

  • ALAS3
  • ALAS

Previous GeneCards Identifiers for ALAS1 Gene

  • GC03P051324
  • GC03P051484
  • GC03P052088
  • GC03P052190
  • GC03P052207

Summaries for ALAS1 Gene

Entrez Gene Summary for ALAS1 Gene

  • This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]

GeneCards Summary for ALAS1 Gene

ALAS1 (5'-Aminolevulinate Synthase 1) is a Protein Coding gene. Diseases associated with ALAS1 include Acute Porphyria and Anemia, Sideroblastic, 1. Among its related pathways are Porphyrin and chlorophyll metabolism and Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha). Gene Ontology (GO) annotations related to this gene include pyridoxal phosphate binding and 5-aminolevulinate synthase activity. An important paralog of this gene is ALAS2.

Gene Wiki entry for ALAS1 Gene

Additional gene information for ALAS1 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ALAS1 Gene

Genomics for ALAS1 Gene

GeneHancer (GH) Regulatory Elements for ALAS1 Gene

Promoters and enhancers for ALAS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J052194 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 750.6 -1.2 -1224 5.5 SIN3A FOXA1 POLR2A NR2F1 NR2F6 RELA L3MBTL2 MAX MNT ZNF148 ALAS1 GLYCTK PBRM1 NT5DC2 ALDOAP1
GH03J052181 Enhancer 1.1 FANTOM5 Ensembl dbSUPER 7.1 -15.9 -15882 2.8 NR2F1 NR2F6 HLF SP1 CEBPG CBFA2T2 PPARG ZIC2 CEBPA RXRA POC1A GLYCTK WDR82 MIR135A1 GLYCTK-AS1 PBRM1 ALAS1 NT5DC2 ENSG00000286419 HQ262401
GH03J052175 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 5.2 -21.8 -21782 5 SREBF1 FOXA1 NR2F6 HLF RAD21 MNT AHR SP1 MAFK CEBPG PPM1M NT5DC2 POC1A ALAS1 GPR62 GLYCTK WDR82 ENSG00000286419 HQ262401
GH03J051962 Promoter/Enhancer 1.1 Ensembl ENCODE CraniofacialAtlas dbSUPER 4.1 -234.2 -234232 2.3 ZBTB17 POLR2A SIN3A GLIS1 ALAS1 ABHD14A GPR62 lnc-PCBP4-1 ENSG00000272762 PCBP4
GH03J052183 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 1.7 -10.0 -9982 8.6 SMARCE1 HLF TEAD4 SP1 CEBPG CBFA2T2 SMARCA4 IKZF1 CEBPA RXRA ENSG00000286419 lnc-POC1A-1 GLYCTK POC1A DUSP7 WDR82 MIR135A1 GLYCTK-AS1 PCBP4 GPR62
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ALAS1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ALAS1 gene promoter:
  • AP-1
  • ATF-2
  • c-Jun

Genomic Locations for ALAS1 Gene

Genomic Locations for ALAS1 Gene
chr3:52,198,083-52,214,327
(GRCh38/hg38)
Size:
16,245 bases
Orientation:
Plus strand
chr3:52,232,102-52,248,343
(GRCh37/hg19)
Size:
16,242 bases
Orientation:
Plus strand

Genomic View for ALAS1 Gene

Genes around ALAS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ALAS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ALAS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ALAS1 Gene

Proteins for ALAS1 Gene

  • Protein details for ALAS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P13196-HEM1_HUMAN
    Recommended name:
    5-aminolevulinate synthase, nonspecific, mitochondrial
    Protein Accession:
    P13196

    Protein attributes for ALAS1 Gene

    Size:
    640 amino acids
    Molecular mass:
    70581 Da
    Cofactor:
    Name=pyridoxal 5'-phosphate; Xref=ChEBI:CHEBI:597326;
    Quaternary structure:
    • Homodimer.
    Miscellaneous:
    • There are two delta-ALA synthases in vertebrates: an erythroid- specific form and one (housekeeping) which is expressed in all tissues.
    SequenceCaution:
    • Sequence=CAA68506.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};

    Alternative splice isoforms for ALAS1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ALAS1 Gene

Selected DME Specific Peptides for ALAS1 Gene

P13196:
  • FSSCFVAND
  • HLRELLQRSDP
  • DEVHAVGLYG
  • KDAALLF
  • SLLFYAQ
  • VWCSNDYL
  • VHSMDGA
  • VGLELKPHSSAEC
  • GCVGGYIA
  • LPKSVSTFQYD
  • PTPHHTP
  • GALESVR
  • RVADAAKNTE
  • VANDSTL
  • CNFCRRP
  • FFEKKIDEKK
  • IFRHNDV
  • PKIVAFE
  • PLHFEVM
  • GFIFTTSLPP
  • PGCEIYSD
  • DIISGTLGKA
  • IYVQAIN
  • YRVFKTVNR
  • LLRIAPTPHH
  • KQRPERVSHLLQD
  • CPSHIIP
  • GAGGTRNI

Post-translational modifications for ALAS1 Gene

  • Ubiquitination at Lys539
  • Modification sites at PhosphoSitePlus

Domains & Families for ALAS1 Gene

Gene Families for ALAS1 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for ALAS1 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ53856, highly similar to 5-aminolevulinate synthase, nonspecific, mitochondrial (EC 2.3.1.37) (B4DDG9_HUMAN)
  • Delta-aminolevulinate synthase 1 (HEM1_HUMAN)
  • cDNA, FLJ92941, Homo sapiens aminolevulinate, delta-, synthase 1 (ALAS1), nuclear gene encoding mitochondrial protein, mRNA (Q5JAM2_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P13196

UniProtKB/Swiss-Prot:

HEM1_HUMAN :
  • Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
Family:
  • Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
genes like me logo Genes that share domains with ALAS1: view

Function for ALAS1 Gene

Molecular function for ALAS1 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=glycine + H(+) + succinyl-CoA = 5-aminolevulinate + CO2 + CoA; Xref=Rhea:RHEA:12921, ChEBI:CHEBI:15378, ChEBI:CHEBI:16526, ChEBI:CHEBI:57287, ChEBI:CHEBI:57292, ChEBI:CHEBI:57305, ChEBI:CHEBI:356416; EC=2.3.1.37;.
GENATLAS Biochemistry:
aminolevulinate,delta-,synthase 1,housekeeping gene,liver,mitochondrial,pyridoxal dependent,catalyzing the first step of porphyrin biosynthesis

Enzyme Numbers (IUBMB) for ALAS1 Gene

Phenotypes From GWAS Catalog for ALAS1 Gene

Gene Ontology (GO) - Molecular Function for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003870 5-aminolevulinate synthase activity IEA --
GO:0005515 protein binding IPI 21516116
GO:0016740 transferase activity IEA --
GO:0016746 transferase activity, transferring acyl groups IEA --
GO:0030170 pyridoxal phosphate binding IEA --
genes like me logo Genes that share ontologies with ALAS1: view
genes like me logo Genes that share phenotypes with ALAS1: view

Animal Models for ALAS1 Gene

MGI Knock Outs for ALAS1:

Animal Model Products

CRISPR Products

miRNA for ALAS1 Gene

miRTarBase miRNAs that target ALAS1

Clone Products

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ALAS1 Gene

Localization for ALAS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ALAS1 Gene

Mitochondrion matrix.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ALAS1 gene
Compartment Confidence
mitochondrion 5
nucleus 4
cytosol 4

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (4)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IDA --
GO:0005739 mitochondrion IDA,IEA --
GO:0005759 mitochondrial matrix TAS --
GO:0005829 cytosol IDA --
genes like me logo Genes that share ontologies with ALAS1: view

Pathways & Interactions for ALAS1 Gene

genes like me logo Genes that share pathways with ALAS1: view

UniProtKB/Swiss-Prot P13196-HEM1_HUMAN

  • Pathway: Porphyrin-containing compound metabolism; protoporphyrin-IX biosynthesis; 5-aminolevulinate from glycine: step 1/1.

Gene Ontology (GO) - Biological Process for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006778 porphyrin-containing compound metabolic process IEA --
GO:0006782 protoporphyrinogen IX biosynthetic process IEA --
GO:0006783 heme biosynthetic process TAS --
GO:0007005 mitochondrion organization TAS --
GO:0009058 biosynthetic process IEA --
genes like me logo Genes that share ontologies with ALAS1: view

No data available for SIGNOR curated interactions for ALAS1 Gene

Drugs & Compounds for ALAS1 Gene

(16) Drugs for ALAS1 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Glycine Approved, Vet_approved Nutra Full agonist, Agonist, Target 368
Pyridoxal Phosphate Approved, Investigational Nutra Target, Target, cofactor 22
Aminolevulinic acid Approved Pharma 192
Carbon dioxide Approved, Investigational, Vet_approved Pharma 0
Succinyl-CoA Experimental Pharma 0

(10) Additional Compounds for ALAS1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
acetyl-coa
  • AcCoA
  • Acetyl coenzyme A
  • S-Acetyl-CoA
  • S-Acetyl-coenzyme A
  • Ac-CoA
72-89-9
Formyl-CoA
  • Formyl coenzyme A
  • Formyl-coenzyme A
13131-49-2
L-2-Amino-3-oxobutanoic acid
  • (S)-2-amino-3-Oxobutanoic acid
  • 2-amino-3-KETOBUTYRIC ACID
  • L-2-amino-3-Oxobutanoate
  • L-2-amino-Acetoacetate
  • (S)-2-amino-3-Oxobutanoate
genes like me logo Genes that share compounds with ALAS1: view

Transcripts for ALAS1 Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ALAS1 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b
SP1: -
SP2: - -
SP3: - - -
SP4: - -
SP5: - -
SP6: - -
SP7:

Relevant External Links for ALAS1 Gene

GeneLoc Exon Structure for
ALAS1
ECgene alternative splicing isoforms for
ALAS1

Expression for ALAS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ALAS1 Gene

mRNA differential expression in normal tissues according to GTEx for ALAS1 Gene

This gene is overexpressed in Adrenal Gland (x12.3) and Liver (x4.2).

Protein differential expression in normal tissues from HIPED for ALAS1 Gene

This gene is overexpressed in Fetal ovary (17.6), Fetal testis (17.5), Adrenal (16.8), and Liver (11.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ALAS1 Gene



Protein tissue co-expression partners for ALAS1 Gene

NURSA nuclear receptor signaling pathways regulating expression of ALAS1 Gene:

ALAS1

SOURCE GeneReport for Unigene cluster for ALAS1 Gene:

Hs.476308

Evidence on tissue expression from TISSUES for ALAS1 Gene

  • Liver(4.7)
  • Muscle(4.4)
  • Nervous system(4.4)
  • Blood(2.7)
  • Adrenal gland(2.5)
genes like me logo Genes that share expression patterns with ALAS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for ALAS1 Gene

Orthologs for ALAS1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for ALAS1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ALAS1 33 32
  • 99.58 (n)
OneToOne
dog
(Canis familiaris)
Mammalia ALAS1 33 32
  • 91.72 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia ALAS1 33
  • 89 (a)
OneToOne
cow
(Bos Taurus)
Mammalia ALAS1 33 32
  • 88.39 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ALAS1 33
  • 88 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Alas1 17 33 32
  • 87.5 (n)
rat
(Rattus norvegicus)
Mammalia Alas1 32
  • 87.4 (n)
chicken
(Gallus gallus)
Aves ALAS1 33 32
  • 76.57 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ALAS1 33
  • 85 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia alas1 32
  • 72.76 (n)
Str.5235 32
African clawed frog
(Xenopus laevis)
Amphibia MGC68700 32
zebrafish
(Danio rerio)
Actinopterygii alas1 33 32 32
  • 70.1 (n)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8381 32
fruit fly
(Drosophila melanogaster)
Insecta Alas 33 34
  • 53 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes HEM1 33
  • 36 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8623 33
  • 56 (a)
OneToMany
Cin.9850 32
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.9850 32
Species where no ortholog for ALAS1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ALAS1 Gene

ENSEMBL:
Gene Tree for ALAS1 (if available)
TreeFam:
Gene Tree for ALAS1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ALAS1: view image

Paralogs for ALAS1 Gene

Paralogs for ALAS1 Gene

(1) SIMAP similar genes for ALAS1 Gene using alignment to 4 proteins:

  • HEM1_HUMAN
  • H7C4H7_HUMAN
  • H7C5B0_HUMAN
  • Q5JAM2_HUMAN

Pseudogenes.org Pseudogenes for ALAS1 Gene

genes like me logo Genes that share paralogs with ALAS1: view

Variants for ALAS1 Gene

Sequence variations from dbSNP and Humsavar for ALAS1 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000023450 -- 52,209,986(+) G/A intron_variant
rs1000263455 -- 52,196,627(+) T/C upstream_transcript_variant
rs1000338998 -- 52,196,844(+) G/C upstream_transcript_variant
rs1000521004 -- 52,212,416(+) C/G coding_sequence_variant, missense_variant
rs1000544499 -- 52,203,479(+) TGCAATGAGTC/TGCAATGAGTCTGCAATGAGTC intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ALAS1 Gene

Variant ID Type Subtype PubMed ID
nsv460537 CNV loss 19166990
nsv470572 CNV loss 18288195
nsv508218 CNV deletion 20534489
nsv508926 CNV insertion 20534489
nsv519445 CNV gain+loss 19592680
nsv590301 CNV loss 21841781
nsv834694 CNV gain 17160897
nsv834695 CNV loss 17160897
nsv954858 CNV deletion 24416366

Variation tolerance for ALAS1 Gene

Residual Variation Intolerance Score: 29.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.71; 46.45% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ALAS1 Gene

Human Gene Mutation Database (HGMD)
ALAS1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ALAS1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ALAS1 Gene

Disorders for ALAS1 Gene

MalaCards: The human disease database

(7) MalaCards diseases for ALAS1 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
acute porphyria
  • hepatic porphyria
anemia, sideroblastic, 1
  • sidba1
porphyria, acute intermittent
  • aip
porphyria
  • disorder of porphyrin and hem metabolism
sideroblastic anemia
  • anemia sideroblastic
- elite association - COSMIC cancer census association via MalaCards
Search ALAS1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for ALAS1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ALAS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ALAS1 Gene

Publications for ALAS1 Gene

  1. Alternative splicing and tissue-specific transcription of human and rodent ubiquitous 5-aminolevulinate synthase (ALAS1) genes. (PMID: 11267664) Roberts AG … Elder GH (Biochimica et biophysica acta 2001) 2 3 23 56
  2. Assignment of the human housekeeping delta-aminolevulinate synthase gene (ALAS1) to chromosome band 3p21.1 by PCR analysis of somatic cell hybrids. (PMID: 7698013) Cotter PD … Bishop DF (Cytogenetics and cell genetics 1995) 2 3 23 56
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 43 56
  4. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 43 56
  5. Down-regulation of aminolevulinate synthase, the rate-limiting enzyme for heme biosynthesis in Alzheimer's disease. (PMID: 19477221) Dwyer BE … Zhu X (Neuroscience letters 2009) 3 23 56

Products for ALAS1 Gene

Sources for ALAS1 Gene