Free for academic non-profit institutions. Other users need a Commercial license
The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors t... See more...
Aliases for AKAP1 Gene
Aliases for AKAP1 Gene
- A-Kinase Anchoring Protein 1 2 3 5
- Dual Specificity A-Kinase-Anchoring Protein 1 2 4
- Protein Phosphatase 1, Regulatory Subunit 43 2 3
- A-Kinase Anchor Protein 1, Mitochondrial 3 4
- Spermatid A-Kinase Anchor Protein 84 3 4
- A Kinase (PRKA) Anchor Protein 1 2 3
- A-Kinase Anchor Protein 149 KDa 3 4
- Tudor Domain Containing 17 2 3
- AKAP 149 3 4
- D-AKAP-1 3 4
- AKAP149 3 4
- PRKA1 3 4
- Dual-Specificity A-Kinase Anchoring Protein 1 3
External Ids for AKAP1 Gene
- HGNC: 367
- Entrez Gene: 8165
- Ensembl: ENSG00000121057
- OMIM: 602449
- UniProtKB: Q92667
Previous HGNC Symbols for AKAP1 Gene
- PRKA1
Previous GeneCards Identifiers for AKAP1 Gene
- GC17P054899
- GC17P057644
- GC17P055504
- GC17P055637
- GC17P052517
- GC17P055162
- GC17P050523
Summaries for AKAP1 Gene
-
The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]
GeneCards Summary for AKAP1 Gene
AKAP1 (A-Kinase Anchoring Protein 1) is a Protein Coding gene. Diseases associated with AKAP1 include Long Qt Syndrome 1. Among its related pathways are Activation of cAMP-Dependent PKA and Factors involved in megakaryocyte development and platelet production. Gene Ontology (GO) annotations related to this gene include nucleic acid binding and RNA binding.
UniProtKB/Swiss-Prot Summary for AKAP1 Gene
-
Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for AKAP1 Gene
Genomics for AKAP1 Gene
GeneHancer (GH) Regulatory Elements for AKAP1 Gene
Promoters and enhancers for AKAP1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around AKAP1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the AKAP1 gene promoter:
-
- AP-1
- ATF-2
- c-Jun
- CREB
- CUTL1
- deltaCREB
- GATA-2
- Sox9
- USF-1
- USF1
Genomic Locations for AKAP1 Gene
Genomic Locations for AKAP1 Gene
- chr17:57,085,092-57,121,349
- (GRCh38/hg38)
- Size:
- 36,258 bases
- Orientation:
- Plus strand
- chr17:55,162,453-55,198,710
- (GRCh37/hg19)
- Size:
- 36,258 bases
- Orientation:
- Plus strand
Genomic View for AKAP1 Gene
Genes around AKAP1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 17q22 by HGNC
- 17q22 by Entrez Gene
- 17q22 by Ensembl
AKAP1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for AKAP1 Gene
Proteins for AKAP1 Gene
-
Protein details for AKAP1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q92667-AKAP1_HUMAN
- Recommended name:
- A-kinase anchor protein 1, mitochondrial
- Protein Accession:
- Q92667
- A8K8Q1
- D3DTZ0
- Q13320
- Q9BW14
Protein attributes for AKAP1 Gene
- Size:
- 903 amino acids
- Molecular mass:
- 97342 Da
- Quaternary structure:
-
- Interacts with SLC8A3.
Protein Expression for AKAP1 Gene
Post-translational modifications for AKAP1 Gene
Other Protein References for AKAP1 Gene
- ENSEMBL proteins:
-
- ENSP00000458164
- ENSP00000337736
- ENSP00000461418
- ENSP00000459808
- ENSP00000314075
- ENSP00000461854
- ENSP00000433212
- ENSP00000458982
- ENSP00000459521
- ENSP00000460514
- ENSP00000460762
- ENSP00000443139
- ENSP00000458370
- ENSP00000458378
- ENSP00000459895
- ENSP00000460209
- ENSP00000478212
- ENSP00000459968
- ENSP00000460557
- REFSEQ proteins:
Antibody Products
- G Biosciences Immunotag™ AKAP1 Antibody
- Atlas Antibodies Anti-AKAP1 Antibody (HPA008691) and Anti-AKAP1 Antibody (HPA008620)
- Creative Biolabs Hi-Affi™ Recombinant Rabbit Anti-AKAP1 Monoclonal Antibody (DS120AB)
-
Custom Antibody ServicesOriGene Antibodies for AKAP1
- Novus Biologicals Antibodies for AKAP1
-
Abcam antibodies for AKAP1
- Invitrogen Antibodies for AKAP1 (AFLGC-AKAP1)
-
Boster Bio Antibodies for AKAP1
-
Santa Cruz Biotechnology (SCBT) Antibodies for AKAP1
Protein Products
- Atlas Antibodies PrEST Antigen AKAP1
- Creative Biomart Recombinant Human AKAP1 293 Cell Lysate
-
OriGene Purified Proteins for AKAP1
- Search Origene for MassSpec and Protein Over-expression Lysates for AKAP1
- Origene Custom Protein Services for AKAP1
-
Abcam proteins for AKAP1
Assay Products
- Novus Biologicals ELISA Kits for AKAP1
- antibodies-online: Show 26 available AKAP1 Elisa Kits ranked by validation data
- Compare Top AKAP1 Elisa Kits
-
Quality Products:
-
Boster Bio ELISA Kits for AKAP1
No data available for DME Specific Peptides for AKAP1 Gene
Domains & Families for AKAP1 Gene
Gene Families for AKAP1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
- Predicted membrane proteins
Protein Domains for AKAP1 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for AKAP1 Gene
- GenScript: Design optimal peptide antigens:
-
- Spermatid A-kinase anchor protein 84 (AKAP1_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q92667UniProtKB/Swiss-Prot:
AKAP1_HUMAN :- RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
- Domain:
-
- RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
Function for AKAP1 Gene
Molecular function for AKAP1 Gene
- UniProtKB/Swiss-Prot Function:
- Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.
- GENATLAS Biochemistry:
- A kinase (PRKA regulatory subunit RIIA) anchor protein 1
Phenotypes From GWAS Catalog for AKAP1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003723 | RNA binding | TAS,HDA | 22658674 |
| GO:0005515 | protein binding | IPI | 16642035 |
| GO:0034237 | protein kinase A regulatory subunit binding | IPI | 17911601 |
Phenotypes for AKAP1 Gene
- MGI mutant phenotypes for AKAP1:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for AKAP1:
Animal Models for AKAP1 Gene
- MGI Knock Outs for AKAP1:
-
- Akap1 Akap1<tm1Gsm>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for AKAP1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AKAP1
- genomics-online: gRNA clones - Search for available AKAP1 gRNA products
- Overview of 106 available AKAP1 gene related products
- Applied Biological Materials (abm): CRISPR Clones for AKAP1 - Select products 50% OFF >
- * AKAP1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * AKAP1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for AKAP1
miRNA for AKAP1 Gene
- miRTarBase miRNAs that target AKAP1
-
- hsa-mir-204-5p (MIRT005814)
- hsa-mir-877-5p (MIRT037317)
- hsa-mir-224-3p (MIRT078134)
- hsa-mir-524-5p (MIRT078135)
- hsa-mir-520d-5p (MIRT078136)
- hsa-mir-522-3p (MIRT078137)
- hsa-mir-507 (MIRT078138)
- hsa-mir-557 (MIRT078139)
- hsa-mir-3121-3p (MIRT078141)
- hsa-mir-4719 (MIRT078143)
- hsa-mir-4797-5p (MIRT288386)
- hsa-mir-4474-3p (MIRT446594)
- hsa-mir-6842-3p (MIRT446595)
- hsa-mir-526b-5p (MIRT446596)
- hsa-mir-5787 (MIRT446597)
- hsa-mir-4505 (MIRT446598)
- hsa-mir-4430 (MIRT446599)
- hsa-mir-3652 (MIRT446600)
- hsa-mir-6077 (MIRT446601)
- hsa-mir-7-5p (MIRT446603)
- hsa-mir-4699-3p (MIRT549403)
- hsa-mir-409-5p (MIRT549404)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AKAP1
- Browse OriGene Inhibitory RNA Products For AKAP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AKAP1
- genomics-online: shRNA clones - Search for available AKAP1 shRNA products
- Overview of 106 available AKAP1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for AKAP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AKAP1
- genomics-online: cdna clones - Search for available AKAP1 CDNA products
- Overview of 106 available AKAP1 gene related products
- orf clones - Search for available AKAP1 ORF products
- Overview of 106 available AKAP1 gene related products
- Applied Biological Materials (abm): Clones for AKAP1 - Select products 50% OFF >
- * AKAP1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * AKAP1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for AKAP1
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for AKAP1 Gene
Localization for AKAP1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for AKAP1 Gene
- Mitochondrion outer membrane.
| Compartment | Confidence |
|---|---|
| mitochondrion | 5 |
| cytosol | 4 |
| plasma membrane | 2 |
| nucleus | 2 |
| extracellular | 1 |
| cytoskeleton | 1 |
| peroxisome | 1 |
| endoplasmic reticulum | 1 |
- Mitochondria (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005739 | mitochondrion | IDA | -- |
| GO:0005741 | mitochondrial outer membrane | IEA | -- |
| GO:0005829 | cytosol | TAS | -- |
| GO:0016020 | membrane | IEA,HDA | 19946888 |
| GO:0016021 | integral component of membrane | IEA | -- |
Pathways & Interactions for AKAP1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Activation of cAMP-Dependent PKA |
Activation of cAMP-Dependent PKA
.77
cAMP Pathway
.77
|
Activation of PKA through GPCR
.71
PKA Signaling
.56
|
| 2 | Ca, cAMP and Lipid Signaling | ||
| 3 | Proton Pump Inhibitor Pathway, Pharmacodynamics | ||
| 4 | Factors involved in megakaryocyte development and platelet production | ||
| 5 | Response to elevated platelet cytosolic Ca2+ |
.44
|
|
Pathways by source for AKAP1 Gene
1 BioSystems pathway for AKAP1 Gene
2 Reactome pathways for AKAP1 Gene
1 PharmGKB pathway for AKAP1 Gene
4 Qiagen pathways for AKAP1 Gene
- Activation of cAMP-Dependent PKA
- Activation of PKA through GPCR
- cAMP Pathway
- PKA Signaling
1 Cell Signaling Technology pathway for AKAP1 Gene
Interacting Proteins for AKAP1 Gene
Selected Interacting proteins:
Q92667-AKAP1_HUMAN
ENSP00000478212
for AKAP1 Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for AKAP1
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007596 | blood coagulation | TAS | -- |
| GO:0010738 | regulation of protein kinase A signaling | IEA | -- |
No data available for SIGNOR curated interactions for AKAP1 Gene
Drugs & Compounds for AKAP1 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Drug Products
- Atlas Antibodies PrEST Antigen AKAP1
- Creative Biomart Recombinant Human AKAP1 293 Cell Lysate
Transcripts for AKAP1 Gene
mRNA/cDNA for AKAP1 Gene
- (9) REFSEQ mRNAs :
- (13) Additional mRNA sequences :
- (335) Selected AceView cDNA sequences:
- (19) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000575322 650 bps (ENST00000575322.1)
- ENST00000337714 3909 bps (ENST00000337714.7)
- ENST00000571629 3105 bps (ENST00000571629.5)
- ENST00000570423 568 bps (ENST00000570423.5)
- ENST00000575186 578 bps (ENST00000575186.5)
CRISPR Products
-
OriGene CRISPR knockouts for AKAP1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AKAP1
- genomics-online: gRNA clones - Search for available AKAP1 gRNA products
- Overview of 106 available AKAP1 gene related products
- Applied Biological Materials (abm): CRISPR Clones for AKAP1 - Select products 50% OFF >
- * AKAP1 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * AKAP1 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for AKAP1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AKAP1
- Browse OriGene Inhibitory RNA Products For AKAP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AKAP1
- genomics-online: shRNA clones - Search for available AKAP1 shRNA products
- Overview of 106 available AKAP1 gene related products
Clone Products
- Sino Biological Human cDNA Clone for AKAP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AKAP1
- genomics-online: cdna clones - Search for available AKAP1 CDNA products
- Overview of 106 available AKAP1 gene related products
- orf clones - Search for available AKAP1 ORF products
- Overview of 106 available AKAP1 gene related products
- Applied Biological Materials (abm): Clones for AKAP1 - Select products 50% OFF >
- * AKAP1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * AKAP1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
| ExUns: | 1 | ^ | 2a | · | 2b | · | 2c | ^ | 3a | · | 3b | · | 3c | ^ | 4 | ^ | 5a | · | 5b | · | 5c | · | 5d | ^ | 6 | ^ | 7 | ^ | 8 | ^ | 9 | ^ | 10a | · | 10b | ^ | 11 | ^ | 12a | · | 12b | ^ | 13 | ^ | 14 | ^ | 15 | ^ | 16 | ^ | 17 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||
| SP2: | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | |||||||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP6: | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||
| SP7: | - | - | - | - |
Expression for AKAP1 Gene
This gene is overexpressed in Adrenal (29.4) and Lung (13.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for AKAP1 Gene
NURSA nuclear receptor signaling pathways regulating expression of AKAP1 Gene:
AKAP1SOURCE GeneReport for Unigene cluster for AKAP1 Gene:
Hs.463506mRNA Expression by UniProt/SwissProt for AKAP1 Gene:
Q92667-AKAP1_HUMAN
Tissue specificity:
Isoform 1 is detected in thymus, prostate, testis, ovary, colon and small intestine (PubMed:8769136). Isoform 2 is highly expressed in testis and detected at much lower levels in kidney, pancreas, liver, lung and brain (PubMed:7499250).
Evidence on tissue expression from TISSUES for AKAP1 Gene
- Nervous system(4.8)
- Intestine(4.5)
- Liver(4.4)
- Heart(3.4)
- Muscle(3.4)
- Kidney(3.1)
- Stomach(2.9)
- Gall bladder(2.6)
- Lung(2.6)
- Lymph node(2.6)
- Pancreas(2.6)
- Skin(2.6)
- Spleen(2.6)
- Thyroid gland(2.6)
- Adrenal gland(2)
Primer Products
-
OriGene qPCR primer pairs for AKAP1
-
OriGene qPCR primer pairs and template standards for AKAP1
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for AKAP1 Gene
Orthologs for AKAP1 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | AKAP1 33 32 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | -- 33 |
|
OneToMany | |
| -- 33 |
|
OneToMany | |||
| dog (Canis familiaris) |
Mammalia | AKAP1 33 32 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Akap1 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Akap1 17 33 32 |
|
||
| cow (Bos Taurus) |
Mammalia | AKAP1 33 32 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | AKAP1 33 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | AKAP1 33 32 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | AKAP1 33 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | Str.10032 32 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | akap1b 33 |
|
OneToOne | |
| akap1 32 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.2949 32 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | spoon 33 |
|
OneToOne | |
| worm (Caenorhabditis elegans) |
Secernentea | C56G2.1b 34 |
|
|
|
| C56G2.1a 34 |
|
|
|||
| akap-1 33 |
|
OneToOne |
- Species where no ortholog for AKAP1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for AKAP1 Gene
- ENSEMBL:
- Gene Tree for AKAP1 (if available)
- TreeFam:
- Gene Tree for AKAP1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for AKAP1: view image
Paralogs for AKAP1 Gene
No data available for Paralogs for AKAP1 Gene
Variants for AKAP1 Gene
| SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs148312142 | uncertain-significance, Malignant tumor of prostate | 57,105,703(+) | A/G | coding_sequence_variant, missense_variant, non_coding_transcript_variant | |
| rs746089021 | uncertain-significance, Ductal breast carcinoma | 57,106,390(+) | GCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAG/GCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAG/GCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAG | coding_sequence_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant | |
| rs1000002807 | -- | 57,093,214(+) | C/G | genic_upstream_transcript_variant, intron_variant | |
| rs1000043703 | -- | 57,118,523(+) | C/A | intron_variant | |
| rs1000159539 | -- | 57,118,516(+) | A/G | intron_variant |
Residual Variation Intolerance Score:
60.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
6.39;
77.04% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for AKAP1 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- AKAP1
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AKAP1 Gene
Disorders for AKAP1 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| long qt syndrome 1 |
|
|
Search AKAP1 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for AKAP1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for AKAP1 Gene
Publications for AKAP1 Gene
- Molecular characterization of AKAP149, a novel A kinase anchor protein with a KH domain. (PMID: 8769136) Trendelenburg G … Hanski C (Biochemical and biophysical research communications 1996) 2 3 4 23 56
- Characterization of S-AKAP84, a novel developmentally regulated A kinase anchor protein of male germ cells. (PMID: 7499250) Lin RY … Rubin CS (The Journal of biological chemistry 1995) 2 3 4 23 56
- Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 43 56
- An approach based on a genome-wide association study reveals candidate loci for narcolepsy. (PMID: 20677014) Shimada M … Tokunaga K (Human genetics 2010) 3 43 56
- Mutually exclusive binding of PP1 and RNA to AKAP149 affects the mitochondrial network. (PMID: 19074462) Rogne M … Küntziger T (Human molecular genetics 2009) 3 23 56
ExternalLinks
Products for AKAP1 Gene
- Custom Antibody ServicesOriGene Antibodies for AKAP1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for AKAP1
- Search Origene for MassSpec and Protein Over-expression Lysates for AKAP1
- Origene Custom Protein Services for AKAP1
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AKAP1
- Browse OriGene Inhibitory RNA Products For AKAP1
- OriGene qPCR primer pairs for AKAP1
- OriGene qPCR primer pairs and template standards for AKAP1
- OriGene CRISPR knockouts for AKAP1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For AKAP1
- Sino Biological Human cDNA Clone for AKAP1
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for AKAP1
- Novus Biologicals proteins and lysates for AKAP1
- Novus Biologicals ELISA Kits for AKAP1
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for AKAP1
- Abcam proteins for AKAP1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for AKAP1 (AFLGC-AKAP1)
- antibodies-online: Show 13 available AKAP1 Antibodies ranked by validation data
- Compare Top AKAP1 Antibodies
- antibodies-online: Show 26 available AKAP1 Elisa Kits ranked by validation data
- Compare Top AKAP1 Elisa Kits
- Quality Products:
- antibodies-online: Show 3 available AKAP1 Proteins ranked by validation data
- Compare Top AKAP1 Proteins
- Santa Cruz Biotechnology (SCBT) Antibodies for AKAP1
- Search Santa Cruz Biotechnology (SCBT) for AKAP1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for AKAP1
- Horizon Cell Lines for AKAP1
- genomics-online: cdna clones - Search for available AKAP1 CDNA products
- Overview of 106 available AKAP1 gene related products
- orf clones - Search for available AKAP1 ORF products
- Overview of 106 available AKAP1 gene related products
- genomics-online: gRNA clones - Search for available AKAP1 gRNA products
- Overview of 106 available AKAP1 gene related products
- genomics-online: primer clones - Search for available AKAP1 Primer products
- Overview of 106 available AKAP1 gene related products
- genomics-online: shRNA clones - Search for available AKAP1 shRNA products
- Overview of 106 available AKAP1 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AKAP1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AKAP1
- Search GeneCopoeia for miRNA 3'UTR Target clone products for AKAP1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AKAP1
Sources for AKAP1 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource