Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AKAP1 Gene

Aliases for AKAP1 Gene

  • A-Kinase Anchoring Protein 1 2 3 5
  • Dual Specificity A-Kinase-Anchoring Protein 1 2 4
  • Protein Phosphatase 1, Regulatory Subunit 43 2 3
  • Spermatid A-Kinase Anchor Protein 84 3 4
  • A Kinase (PRKA) Anchor Protein 1 2 3
  • A-Kinase Anchor Protein 149 KDa 3 4
  • Tudor Domain Containing 17 2 3
  • AKAP 149 3 4
  • D-AKAP-1 3 4
  • AKAP149 3 4
  • PRKA1 3 4
  • Dual-Specificity A-Kinase Anchoring Protein 1 3
  • A-Kinase Anchor Protein 1, Mitochondrial 3
  • Protein Kinase A Anchoring Protein 1 3
  • Protein Kinase A-Anchoring Protein 1 4
  • Protein Kinase Anchoring Protein 1 2
  • Testicular Secretory Protein Li 5 3
  • Protein Kinase A1 3
  • S-AKAP84 4
  • AKAP121 3
  • D-AKAP1 3
  • PPP1R43 3
  • SAKAP84 3
  • AKAP84 3
  • TDRD17 3
  • AKAP 3

External Ids for AKAP1 Gene

Previous HGNC Symbols for AKAP1 Gene

  • PRKA1

Previous GeneCards Identifiers for AKAP1 Gene

  • GC17P054899
  • GC17P057644
  • GC17P055504
  • GC17P055637
  • GC17P052517
  • GC17P055162
  • GC17P050523

Summaries for AKAP1 Gene

Entrez Gene Summary for AKAP1 Gene

  • The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]

GeneCards Summary for AKAP1 Gene

AKAP1 (A-Kinase Anchoring Protein 1) is a Protein Coding gene. Diseases associated with AKAP1 include Long Qt Syndrome 1. Among its related pathways are Activation of cAMP-Dependent PKA and Ca, cAMP and Lipid Signaling. Gene Ontology (GO) annotations related to this gene include nucleic acid binding and RNA binding.

UniProtKB/Swiss-Prot for AKAP1 Gene

  • Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.

Gene Wiki entry for AKAP1 Gene

Additional gene information for AKAP1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AKAP1 Gene

Genomics for AKAP1 Gene

GeneHancer (GH) Regulatory Elements for AKAP1 Gene

Promoters and enhancers for AKAP1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J057084 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 659.3 +1.9 1863 5.5 CLOCK MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF213 ZNF143 ZNF263 SP3 ENSG00000263004 AKAP1 SRSF1 COIL ENSG00000262298 DGKE VEZF1 SCPEP1 ENSG00000263089
GH17J057105 Enhancer 1.3 Ensembl ENCODE dbSUPER 24.2 +23.4 23391 6.4 ARID4B YY1 GLIS2 ZNF213 ZNF143 FOS RXRA REST ATF4 GLIS1 AKAP1 ENSG00000264112 RNU7-134P CCDC182 SRSF1 ENSG00000263004 ENSG00000263089 GC17P057199
GH17J057053 Enhancer 1 Ensembl ENCODE 17.4 -30.6 -30617 1.2 HDAC1 PKNOX1 RAD21 YY1 TCF12 ATF7 RXRA CEBPB NCOA1 REST AKAP1 DGKE SRSF1 RNF126P1 GC17P057058 ENSG00000263004
GH17J057096 Enhancer 1.3 Ensembl ENCODE dbSUPER 12.5 +13.3 13264 4.5 FOXA2 NFIB ZSCAN4 FEZF1 THRB RAD21 RARA YY1 EGR1 RCOR1 ENSG00000263089 ENSG00000263004 SRSF1 ENSG00000262298 AKAP1 VEZF1 SCPEP1 GC17P057199
GH17J057832 Enhancer 1.3 Ensembl ENCODE dbSUPER 10.2 +748.2 748175 2.3 HDGF PKNOX1 CLOCK FOXA2 NEUROD1 SIN3A FEZF1 ZNF2 ZBTB7B ZNF207 ENSG00000265542 SRSF1 ENSG00000262298 CCDC182 MKS1 DYNLL2 AKAP1 CUEDC1 OR4D1 MSX2P1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AKAP1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AKAP1 gene promoter:
  • AP-1
  • c-Jun
  • ATF-2
  • deltaCREB
  • CREB
  • Sox9
  • CUTL1
  • USF1
  • GATA-2
  • USF-1

Genomic Locations for AKAP1 Gene

Genomic Locations for AKAP1 Gene
chr17:57,085,092-57,121,349
(GRCh38/hg38)
Size:
36,258 bases
Orientation:
Plus strand
chr17:55,162,453-55,198,710
(GRCh37/hg19)
Size:
36,258 bases
Orientation:
Plus strand

Genomic View for AKAP1 Gene

Genes around AKAP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AKAP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AKAP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AKAP1 Gene

Proteins for AKAP1 Gene

  • Protein details for AKAP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q92667-AKAP1_HUMAN
    Recommended name:
    A-kinase anchor protein 1, mitochondrial
    Protein Accession:
    Q92667
    Secondary Accessions:
    • A8K8Q1
    • D3DTZ0
    • Q13320
    • Q9BW14

    Protein attributes for AKAP1 Gene

    Size:
    903 amino acids
    Molecular mass:
    97342 Da
    Quaternary structure:
    • Interacts with SLC8A3.

    Alternative splice isoforms for AKAP1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AKAP1 Gene

Post-translational modifications for AKAP1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for AKAP1 Gene

Domains & Families for AKAP1 Gene

Gene Families for AKAP1 Gene

Suggested Antigen Peptide Sequences for AKAP1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q92667

UniProtKB/Swiss-Prot:

AKAP1_HUMAN :
  • RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
Domain:
  • RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
genes like me logo Genes that share domains with AKAP1: view

Function for AKAP1 Gene

Molecular function for AKAP1 Gene

UniProtKB/Swiss-Prot Function:
Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.
GENATLAS Biochemistry:
A kinase (PRKA regulatory subunit RIIA) anchor protein 1

Phenotypes From GWAS Catalog for AKAP1 Gene

Gene Ontology (GO) - Molecular Function for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA,TAS 22658674
GO:0005515 protein binding IPI 16642035
GO:0034237 protein kinase A regulatory subunit binding IPI 17911601
genes like me logo Genes that share ontologies with AKAP1: view
genes like me logo Genes that share phenotypes with AKAP1: view

Animal Models for AKAP1 Gene

MGI Knock Outs for AKAP1:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for AKAP1 Gene

Localization for AKAP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AKAP1 Gene

Mitochondrion outer membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AKAP1 gene
Compartment Confidence
mitochondrion 5
cytosol 5
plasma membrane 3
cytoskeleton 2
nucleus 2
endoplasmic reticulum 2
extracellular 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IDA --
GO:0005741 mitochondrial outer membrane IEA --
GO:0005829 cytosol TAS --
GO:0016020 membrane IEA,HDA 19946888
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with AKAP1: view

Pathways & Interactions for AKAP1 Gene

genes like me logo Genes that share pathways with AKAP1: view

Pathways by source for AKAP1 Gene

1 BioSystems pathway for AKAP1 Gene
1 PharmGKB pathway for AKAP1 Gene
1 Cell Signaling Technology pathway for AKAP1 Gene

Gene Ontology (GO) - Biological Process for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007596 blood coagulation TAS --
GO:0010738 regulation of protein kinase A signaling IEA --
genes like me logo Genes that share ontologies with AKAP1: view

No data available for SIGNOR curated interactions for AKAP1 Gene

Drugs & Compounds for AKAP1 Gene

(6) Drugs for AKAP1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for AKAP1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with AKAP1: view

Transcripts for AKAP1 Gene

Unigene Clusters for AKAP1 Gene

A kinase (PRKA) anchor protein 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AKAP1 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b · 5c · 5d ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16 ^ 17
SP1: - - - - - - - -
SP2: -
SP3: -
SP4:
SP5: -
SP6: - - - - -
SP7: - - - -

Relevant External Links for AKAP1 Gene

GeneLoc Exon Structure for
AKAP1
ECgene alternative splicing isoforms for
AKAP1

Expression for AKAP1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AKAP1 Gene

Protein differential expression in normal tissues from HIPED for AKAP1 Gene

This gene is overexpressed in Adrenal (29.4) and Lung (13.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for AKAP1 Gene



Protein tissue co-expression partners for AKAP1 Gene

NURSA nuclear receptor signaling pathways regulating expression of AKAP1 Gene:

AKAP1

SOURCE GeneReport for Unigene cluster for AKAP1 Gene:

Hs.463506

mRNA Expression by UniProt/SwissProt for AKAP1 Gene:

Q92667-AKAP1_HUMAN
Tissue specificity: Isoform 1 is detected in thymus, prostate, testis, ovary, colon and small intestine (PubMed:8769136). Isoform 2 is highly expressed in testis and detected at much lower levels in kidney, pancreas, liver, lung and brain (PubMed:7499250).

Evidence on tissue expression from TISSUES for AKAP1 Gene

  • Nervous system(4.8)
  • Intestine(4.5)
  • Liver(4.4)
  • Heart(3.4)
  • Muscle(3.4)
  • Kidney(3.1)
  • Stomach(2.9)
  • Gall bladder(2.6)
  • Lung(2.6)
  • Lymph node(2.6)
  • Pancreas(2.6)
  • Skin(2.6)
  • Spleen(2.6)
  • Thyroid gland(2.6)
  • Adrenal gland(2)
genes like me logo Genes that share expression patterns with AKAP1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for AKAP1 Gene

Orthologs for AKAP1 Gene

This gene was present in the common ancestor of animals.

Orthologs for AKAP1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AKAP1 34 33
  • 99.04 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia -- 34
  • 86 (a)
OneToMany
-- 34
  • 38 (a)
OneToMany
dog
(Canis familiaris)
Mammalia AKAP1 34 33
  • 80.36 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Akap1 33
  • 78.58 (n)
mouse
(Mus musculus)
Mammalia Akap1 16 34 33
  • 77.37 (n)
cow
(Bos Taurus)
Mammalia AKAP1 34 33
  • 76.72 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia AKAP1 34
  • 53 (a)
OneToOne
chicken
(Gallus gallus)
Aves AKAP1 34 33
  • 57.06 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia AKAP1 34
  • 73 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10032 33
zebrafish
(Danio rerio)
Actinopterygii akap1b 34
  • 40 (a)
OneToOne
akap1 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2949 33
fruit fly
(Drosophila melanogaster)
Insecta spoon 34
  • 24 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea C56G2.1b 35
  • 33 (a)
C56G2.1a 35
  • 33 (a)
akap-1 34
  • 20 (a)
OneToOne
Species where no ortholog for AKAP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for AKAP1 Gene

ENSEMBL:
Gene Tree for AKAP1 (if available)
TreeFam:
Gene Tree for AKAP1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AKAP1: view image

Paralogs for AKAP1 Gene

No data available for Paralogs for AKAP1 Gene

Variants for AKAP1 Gene

Sequence variations from dbSNP and Humsavar for AKAP1 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs148312142 uncertain-significance, Malignant tumor of prostate 57,105,703(+) A/G coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs746089021 uncertain-significance, Ductal breast carcinoma 57,106,390(+) GCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAG/GCTTGGATAGAAATGAGGAGGGCTTGGATAGAAATGAGGAG coding_sequence_variant, inframe_deletion, non_coding_transcript_variant
rs1000002807 -- 57,093,214(+) C/G genic_upstream_transcript_variant, intron_variant
rs1000043703 -- 57,118,523(+) C/A intron_variant
rs1000159539 -- 57,118,516(+) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for AKAP1 Gene

Variant ID Type Subtype PubMed ID
esv33941 CNV loss 17666407
esv3640867 CNV loss 21293372
nsv111740 CNV deletion 16902084

Variation tolerance for AKAP1 Gene

Residual Variation Intolerance Score: 60.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.39; 77.04% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AKAP1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
AKAP1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AKAP1 Gene

Disorders for AKAP1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for AKAP1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
long qt syndrome 1
  • lqt1
- elite association - COSMIC cancer census association via MalaCards
Search AKAP1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for AKAP1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with AKAP1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for AKAP1 Gene

Publications for AKAP1 Gene

  1. Molecular characterization of AKAP149, a novel A kinase anchor protein with a KH domain. (PMID: 8769136) Trendelenburg G … Hanski C (Biochemical and biophysical research communications 1996) 2 3 4 22 58
  2. Characterization of S-AKAP84, a novel developmentally regulated A kinase anchor protein of male germ cells. (PMID: 7499250) Lin RY … Rubin CS (The Journal of biological chemistry 1995) 2 3 4 22 58
  3. An approach based on a genome-wide association study reveals candidate loci for narcolepsy. (PMID: 20677014) Shimada M … Tokunaga K (Human genetics 2010) 3 44 58
  4. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
  5. Mutually exclusive binding of PP1 and RNA to AKAP149 affects the mitochondrial network. (PMID: 19074462) Rogne M … Küntziger T (Human molecular genetics 2009) 3 22 58

Products for AKAP1 Gene

Sources for AKAP1 Gene

Content
Loading form....