AIRE Gene (Protein Coding)

Autoimmune Regulator

GC21P044285
GIFtS:
46
This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoi... See more...

Aliases for AIRE Gene

Aliases for AIRE Gene

  • Autoimmune Regulator 2 3 4 5
  • Autoimmune Polyendocrinopathy Candidiasis Ectodermal Dystrophy Protein 3 4
  • APECED 3 4
  • Autoimmune Regulator (Autoimmune Polyendocrinopathy Candidiasis Ectodermal Dystrophy) 2
  • Autoimmune Polyendocrinopathy Candidiasis Ectodermal Dystrophy 2
  • APECED Protein 4
  • AIRE1 3
  • APS1 3
  • APSI 3
  • PGA1 3

External Ids for AIRE Gene

Previous HGNC Symbols for AIRE Gene

  • APECED

Previous GeneCards Identifiers for AIRE Gene

  • GC21P042215
  • GC21P044563
  • GC21P044561
  • GC21P044530
  • GC21P045705
  • GC21P031076

Summaries for AIRE Gene

Entrez Gene Summary for AIRE Gene

  • This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

GeneCards Summary for AIRE Gene

AIRE (Autoimmune Regulator) is a Protein Coding gene. Diseases associated with AIRE include Autoimmune Polyendocrine Syndrome, Type I, With Or Without Reversible Metaphyseal Dysplasia and Hypoparathyroidism, Familial Isolated. Among its related pathways are Ubiquitin mediated proteolysis and Primary immunodeficiency. Gene Ontology (GO) annotations related to this gene include identical protein binding and transcription regulatory region DNA binding. An important paralog of this gene is ZMYND8.

UniProtKB/Swiss-Prot Summary for AIRE Gene

  • Transcription factor playing an essential role to promote self-tolerance in the thymus by regulating the expression of a wide array of self-antigens that have the commonality of being tissue-restricted in their expression pattern in the periphery, called tissue restricted antigens (TRA) (PubMed:26084028). Binds to G-doublets in an A/T-rich environment; the preferred motif is a tandem repeat of 5'-ATTGGTTA-3' combined with a 5'-TTATTA-3' box. Binds to nucleosomes (By similarity). Binds to chromatin and interacts selectively with histone H3 that is not methylated at 'Lys-4', not phosphorylated at 'Thr-3' and not methylated at 'Arg-2'. Functions as a sensor of histone H3 modifications that are important for the epigenetic regulation of gene expression. Mainly expressed by medullary thymic epithelial cells (mTECs), induces the expression of thousands of tissue-restricted proteins, which are presented on major histocompatibility complex class I (MHC-I) and MHC-II molecules to developing T-cells percolating through the thymic medulla (PubMed:26084028). Also induces self-tolerance through other mechanisms such as the regulation of the mTEC differentiation program. Controls the medullary accumulation of thymic dendritic cells and the development of regulatory T-cell through the regulation of XCL1 expression. Regulates the production of CCR4 and CCR7 ligands in medullary thymic epithelial cells and alters the coordinated maturation and migration of thymocytes. In thimic B-cells, allows the presentation of licensing-dependent endogenous self-anitgen for negative selection. In secondary lymphoid organs, induces functional inactivation of CD4(+) T-cells. Expressed by a distinct bone marrow-derived population, induces self-tolerance through a mechanism that does not require regulatory T-cells and is resitant to innate inflammatory stimuli (By similarity).

Gene Wiki entry for AIRE Gene

Additional gene information for AIRE Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for AIRE Gene

Genomics for AIRE Gene

GeneHancer (GH) Regulatory Elements for AIRE Gene

Promoters and enhancers for AIRE Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH21J044285 Promoter 0.7 EPDnew Ensembl 750.6 0.0 -37 0.4 AIRE TRPM2-AS piR-52261-169
GH21J044192 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 6.7 -90.6 -90638 6.4 ZNF24 ZBTB40 SP1 SMARCE1 MYC CC2D1A ETV6 ELF1 L3MBTL2 CEBPB ENSG00000285413 LOC105377139 UBE2G2 ICOSLG DNMT3L PWP2 RRP1B AIRE ENSG00000184441 TRAPPC10
GH21J044205 Promoter/Enhancer 1.4 Ensembl ENCODE dbSUPER 7.1 -78.7 -78732 3.4 ZNF24 SP1 ZBTB40 SMARCE1 ZNF217 MYC ETV6 RELA L3MBTL2 MAX ENSG00000232124 LOC105372832 LOC102725065 NONHSAG033019.2-002 RRP1B PWP2 GATD3A TRAPPC10 ICOSLG AIRE
GH21J044202 Promoter/Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 6.3 -82.6 -82619 2.9 ZBTB40 SMARCE1 ETV6 HLF L3MBTL2 MAX MNT ZKSCAN8 ZFX CEBPG lnc-PWP2-2 lnc-PWP2-3 ICOSLG AIRE TRPM2 TRAPPC10 ENSG00000232124 LOC105372832 GATD3A
GH21J044210 Enhancer 1.2 Ensembl ENCODE dbSUPER 6.5 -71.6 -71637 4.8 ZNF24 ETV6 RELA MLLT1 BACH1 ZNF687 PRDM1 CREM ZNF639 EGR1 HSALNG0133508 piR-35674-328 UBE2G2 RRP1B ICOSLG PWP2 DNMT3L GATD3A SSR4P1 PTTG1IP
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AIRE on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AIRE gene promoter:
  • AP-1
  • ATF-2

Genomic Locations for AIRE Gene

Genomic Locations for AIRE Gene
chr21:44,285,838-44,298,648
(GRCh38/hg38)
Size:
12,811 bases
Orientation:
Plus strand
chr21:45,705,721-45,718,531
(GRCh37/hg19)
Size:
12,811 bases
Orientation:
Plus strand

Genomic View for AIRE Gene

Genes around AIRE on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AIRE Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AIRE Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for AIRE Gene

Proteins for AIRE Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for AIRE Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O43918-AIRE_HUMAN
    Recommended name:
    Autoimmune regulator
    Protein Accession:
    O43918
    Secondary Accessions:
    • B2RP50
    • O43922
    • O43932
    • O75745

    Protein attributes for AIRE Gene

    Size:
    545 amino acids
    Molecular mass:
    57727 Da
    Quaternary structure:
    • Homodimer and homotetramer. Interacts with CREBBP. Interacts preferentially with histone H3 that is not methylated at 'Lys-4'. Binds with lower affinity to histone H3 that is monomethylated at 'Lys-4'. Trimethylation of histone H3 at 'Lys-4' or phosphorylation at 'Thr-3' abolish the interaction. Binds with lower affinity to histone H3 that is acetylated at 'Lys-4', or that is acetylated at 'Lys-9' or trimethylated at 'Lys-9'. Binds histone H3 that is dimethylated at 'Arg-2' with very low affinity.

    Three dimensional structures from OCA and Proteopedia for AIRE Gene

    Alternative splice isoforms for AIRE Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AIRE Gene

Protein Expression for AIRE Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for AIRE Gene

  • Phosphorylated. Phosphorylation could trigger oligomerization.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for AIRE Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for AIRE
  • Santa Cruz Biotechnology (SCBT) Antibodies for AIRE

No data available for DME Specific Peptides for AIRE Gene

Domains & Families for AIRE Gene

Gene Families for AIRE Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for AIRE Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for AIRE Gene

GenScript: Design optimal peptide antigens:
  • Autoimmune regulator (A5A8N0_HUMAN)
  • Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein (AIRE_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O43918

UniProtKB/Swiss-Prot:

AIRE_HUMAN :
  • The L-X-X-L-L repeats may be implicated in binding to nuclear receptors.
Domain:
  • The L-X-X-L-L repeats may be implicated in binding to nuclear receptors.
  • The HSR domain is required for localization on tubular structures (N-terminal part) and for homodimerization.
  • Interacts via the first PHD domain with the N-terminus of histone H3 that is not methylated at 'Lys-4'. Disruption of the first PHD domain has been shown to lead to reduced transcriptional activity and to localization of the protein mainly in the cytoplasm in small granules. While the PHD zinc fingers are necessary for the transactivation capacity of the protein, other regions also modulate this function.
genes like me logo Genes that share domains with AIRE: view

Function for AIRE Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for AIRE Gene

UniProtKB/Swiss-Prot Function:
Transcription factor playing an essential role to promote self-tolerance in the thymus by regulating the expression of a wide array of self-antigens that have the commonality of being tissue-restricted in their expression pattern in the periphery, called tissue restricted antigens (TRA) (PubMed:26084028). Binds to G-doublets in an A/T-rich environment; the preferred motif is a tandem repeat of 5'-ATTGGTTA-3' combined with a 5'-TTATTA-3' box. Binds to nucleosomes (By similarity). Binds to chromatin and interacts selectively with histone H3 that is not methylated at 'Lys-4', not phosphorylated at 'Thr-3' and not methylated at 'Arg-2'. Functions as a sensor of histone H3 modifications that are important for the epigenetic regulation of gene expression. Mainly expressed by medullary thymic epithelial cells (mTECs), induces the expression of thousands of tissue-restricted proteins, which are presented on major histocompatibility complex class I (MHC-I) and MHC-II molecules to developing T-cells percolating through the thymic medulla (PubMed:26084028). Also induces self-tolerance through other mechanisms such as the regulation of the mTEC differentiation program. Controls the medullary accumulation of thymic dendritic cells and the development of regulatory T-cell through the regulation of XCL1 expression. Regulates the production of CCR4 and CCR7 ligands in medullary thymic epithelial cells and alters the coordinated maturation and migration of thymocytes. In thimic B-cells, allows the presentation of licensing-dependent endogenous self-anitgen for negative selection. In secondary lymphoid organs, induces functional inactivation of CD4(+) T-cells. Expressed by a distinct bone marrow-derived population, induces self-tolerance through a mechanism that does not require regulatory T-cells and is resitant to innate inflammatory stimuli (By similarity).
GENATLAS Biochemistry:
autoimmune regulator gene with three alternatively spliced isoforms,expressed in immunological tissues,also expressed in the cytoplasm,located in nuclear bodies separated from the PML bodies and colocalizing with cytoskeletal filaments,may be involved in the regulation of gene expression

Phenotypes From GWAS Catalog for AIRE Gene

Gene Ontology (GO) - Molecular Function for AIRE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000977 RNA polymerase II regulatory region sequence-specific DNA binding IDA 11533054
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific NAS 19274049
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific IC --
GO:0003677 DNA binding IEA --
GO:0003682 chromatin binding IDA,IBA 18292755
genes like me logo Genes that share ontologies with AIRE: view
genes like me logo Genes that share phenotypes with AIRE: view

Human Phenotype Ontology for AIRE Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for AIRE Gene

MGI Knock Outs for AIRE:
  • Aire Aire<tm1.1Doi>
  • Aire Aire<tm1Mmat>
  • Aire Aire<tm1.1(NCOM)Mfgc>
  • Aire Aire<tm1Ptsn>
  • Aire Aire<tm1Pltn>
  • Aire Aire<tm2Mmat>

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for AIRE Gene

Localization for AIRE Gene

Subcellular locations from UniProtKB/Swiss-Prot for AIRE Gene

Nucleus. Cytoplasm. Note=Predominantly nuclear but also cytoplasmic (PubMed:11274163, PubMed:14974083). Found in nuclear body-like structures (dots) and in a filamentous vimentin-like pattern (PubMed:11274163, PubMed:14974083, PubMed:26084028). Associated with tubular structures (PubMed:11274163, PubMed:14974083). {ECO:0000269 PubMed:11274163, ECO:0000269 PubMed:14974083, ECO:0000269 PubMed:26084028}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AIRE gene
Compartment Confidence
nucleus 5
extracellular 2
plasma membrane 1
cytoskeleton 1
mitochondrion 1
peroxisome 1
cytosol 1

Gene Ontology (GO) - Cellular Components for AIRE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS,TAS 9398840
GO:0005737 cytoplasm IEA --
GO:0016604 nuclear body IEA,ISS --
genes like me logo Genes that share ontologies with AIRE: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for AIRE Gene

Pathways & Interactions for AIRE Gene

genes like me logo Genes that share pathways with AIRE: view

Pathways by source for AIRE Gene

SIGNOR curated interactions for AIRE Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for AIRE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002458 peripheral T cell tolerance induction ISS,IBA --
GO:0002509 central tolerance induction to self antigen IMP 26084028
GO:0006355 regulation of transcription, DNA-templated IDA 18292755
GO:0006417 regulation of translation IEA --
GO:0006955 immune response TAS 9398840
genes like me logo Genes that share ontologies with AIRE: view

Drugs & Compounds for AIRE Gene

Products:

  1. Drug

(4) Drugs for AIRE Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(1) Additional Compounds for AIRE Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with AIRE: view

Transcripts for AIRE Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for AIRE Gene

(3) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(13) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AIRE Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15
SP1: - -
SP2:
SP3:
SP4:
SP5:

Relevant External Links for AIRE Gene

GeneLoc Exon Structure for
AIRE
ECgene alternative splicing isoforms for
AIRE

Expression for AIRE Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AIRE Gene

mRNA expression in normal human tissues for AIRE Gene
mRNA expression by BioGPS for AIRE GenemRNA expression by GTEx for AIRE Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for AIRE Gene

This gene is overexpressed in Brain - Hypothalamus (x10.5) and Brain - Anterior cingulate cortex (BA24) (x4.2).

Protein differential expression in normal tissues from HIPED for AIRE Gene

This gene is overexpressed in Peripheral blood mononuclear cells (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AIRE Gene



Protein tissue co-expression partners for AIRE Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of AIRE Gene:

AIRE

SOURCE GeneReport for Unigene cluster for AIRE Gene:

Hs.129829

mRNA Expression by UniProt/SwissProt for AIRE Gene:

O43918-AIRE_HUMAN
Tissue specificity: Widely expressed. Expressed at higher level in thymus (medullary epithelial cells and monocyte-dendritic cells), pancreas, adrenal cortex and testis. Expressed at lower level in the spleen, fetal liver and lymph nodes. In secondary lymphoid organs, expressed in a discrete population of bone marrow-derived toleregenic antigen presenting cells (APCs) called extrathymic AIRE expressing cells (eTAC)(at protein level) (PubMed:23993652). Isoform 2 and isoform 3 seem to be less frequently expressed than isoform 1, if at all.

Evidence on tissue expression from TISSUES for AIRE Gene

  • Blood(2.3)
  • Kidney(2.2)
  • Thyroid gland(2.1)
  • Spleen(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for AIRE Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • eyelid
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • heart
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • adrenal gland
  • biliary tract
  • gallbladder
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • spleen
  • stomach
Pelvis:
  • ovary
  • pelvis
  • uterus
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with AIRE: view

Orthologs for AIRE Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for AIRE Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia AIRE 33 32
  • 98.23 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia AIRE 33 32
  • 82.98 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia AIRE 33 32
  • 79.57 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Aire 17 33 32
  • 76.74 (n)
rat
(Rattus norvegicus)
 Mammalia Aire 32
  • 74.82 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia AIRE 33
  • 54 (a)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia AIRE 33
  • 51 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves AIRE 33
  • 43 (a)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia AIRE 33
  • 71 (a)
 OneToOne
zebrafish
(Danio rerio)
 Actinopterygii aire 33 32
  • 50.69 (n)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta bon 33
  • 8 (a)
 OneToOne
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes RCO1 35
sea squirt
(Ciona savignyi)
 Ascidiacea -- 33
  • 7 (a)
 OneToOne
Species where no ortholog for AIRE was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for AIRE Gene

ENSEMBL:
Gene Tree for AIRE (if available)
TreeFam:
Gene Tree for AIRE (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AIRE: view image

Paralogs for AIRE Gene

Paralogs for AIRE Gene

(22) SIMAP similar genes for AIRE Gene using alignment to 4 proteins:

  • AIRE_HUMAN
  • A5A8N0_HUMAN
  • C9JFR1_HUMAN
  • C9JL37_HUMAN
genes like me logo Genes that share paralogs with AIRE: view

Variants for AIRE Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for AIRE Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1016179869 uncertain-significance, Polyglandular autoimmune syndrome, type 1 44,285,350(+) CC/CCC/CCCCC upstream_transcript_variant
rs1022025101 likely-pathogenic, Polyglandular autoimmune syndrome, type 1 44,292,402(+) G/A splice_donor_variant
rs1032171597 likely-pathogenic, Polyglandular autoimmune syndrome, type 1 44,287,515(+) A/G/T splice_acceptor_variant
rs1037154559 uncertain-significance, Polyglandular autoimmune syndrome, type 1 44,292,404(+) ATGGCCACGCCCCCTCCTAGCCGGGCCACCCCTCCTGTCCACATGGCCACGCCCCCTCCTAG/ATGGCCACGCCCCCTCCTAG/ATGGCCACGCCCCCTCCTAGCCGGGCCACCCCTCCTGTCCACATGGCCACGCCCCCTCCTAGCCGGGCCACCCCTCCTGTCCACATGGCCACGCCCCCTCCTAG intron_variant
rs1057516225 likely-pathogenic, Polyglandular autoimmune syndrome, type 1 44,286,679(+) C/A coding_sequence_variant, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for AIRE Gene

Variant ID Type Subtype PubMed ID
dgv7886n54 CNV loss 21841781
esv2723638 CNV deletion 23290073
esv33817 CNV loss 17666407
nsv509800 CNV insertion 20534489
nsv526673 CNV loss 19592680
nsv587740 CNV loss 21841781
nsv587774 CNV loss 21841781
nsv587775 CNV loss 21841781
nsv953646 CNV deletion 24416366

Variation tolerance for AIRE Gene

Residual Variation Intolerance Score: 96.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.18; 51.89% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AIRE Gene

Human Gene Mutation Database (HGMD)
AIRE
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AIRE

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AIRE Gene

Disorders for AIRE Gene

MalaCards: The human disease database

(51) MalaCards diseases for AIRE Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search AIRE in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

AIRE_HUMAN
  • Autoimmune polyendocrine syndrome 1, with or without reversible metaphyseal dysplasia (APS1) [MIM:240300]: A rare disease characterized by the combination of chronic mucocutaneous candidiasis, hypoparathyroidism and Addison disease. Symptoms of mucocutaneous candidiasis manifest first, followed by hypotension or fatigue occurring as a result of Addison disease. APS1 is associated with other autoimmune disorders including diabetes mellitus, vitiligo, alopecia, hepatitis, pernicious anemia and primary hypothyroidism. {ECO:0000269 PubMed:10677297, ECO:0000269 PubMed:11274163, ECO:0000269 PubMed:11275943, ECO:0000269 PubMed:11524731, ECO:0000269 PubMed:11524733, ECO:0000269 PubMed:11600535, ECO:0000269 PubMed:11836330, ECO:0000269 PubMed:12050215, ECO:0000269 PubMed:12173302, ECO:0000269 PubMed:12625412, ECO:0000269 PubMed:14974083, ECO:0000269 PubMed:15649886, ECO:0000269 PubMed:15712268, ECO:0000269 PubMed:16114041, ECO:0000269 PubMed:18292755, ECO:0000269 PubMed:19446523, ECO:0000269 PubMed:26084028, ECO:0000269 PubMed:27426947, ECO:0000269 PubMed:9398839, ECO:0000269 PubMed:9888391}. Note=The disease is caused by mutations affecting the gene represented in this entry. Most of the mutations alter the nucleus-cytoplasm distribution of AIRE and disturb its association with nuclear dots and cytoplasmic filaments. Most of the mutations also decrease transactivation of the protein. The HSR domain is responsible for the homomultimerization activity of AIRE. All the missense mutations of the HSR and the SAND domains decrease this activity, but those in other domains do not. The AIRE protein is present in soluble high-molecular-weight complexes. Mutations in the HSR domain and deletion of PHD zinc fingers disturb the formation of these complexes (PubMed:14974083). Heterozygous mutations within the PHD1 domain have dominant-negatif effects and cause organ-specific autoimmune diseases (PubMed:26084028). Patients harbor extremely high-affinity, neutralizing autoantibodies, particularly against specific cytokines such as type I interferons which could protect them from some types of autoimmune diseases, like type I diabetes (PubMed:27426947). {ECO:0000269 PubMed:14974083, ECO:0000269 PubMed:26084028, ECO:0000269 PubMed:27426947}.

Additional Disease Information for AIRE

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with AIRE: view

No data available for Genatlas for AIRE Gene

Publications for AIRE Gene

  1. Structure and site-specific recognition of histone H3 by the PHD finger of human autoimmune regulator. (PMID: 19446523) Chakravarty S … Zhou MM (Structure (London, England : 1993) 2009) 3 4 23 56
  2. AIRE gene analysis in children with autoimmune hepatitis type I or II. (PMID: 19322061) Lankisch TO … Jacquemin E (Journal of pediatric gastroenterology and nutrition 2009) 3 23 43 56
  3. Evaluation of the autoimmune regulator (AIRE) gene mutations in a cohort of Italian patients with autoimmune-polyendocrinopathy-candidiasis-ectodermal-dystrophy (APECED) and in their relatives. (PMID: 18616706) Cervato S … Betterle C (Clinical endocrinology 2009) 3 23 43 56
  4. The autoimmune regulator PHD finger binds to non-methylated histone H3K4 to activate gene expression. (PMID: 18292755) Org T … Peterson P (EMBO reports 2008) 3 4 23 56
  5. Genetic analysis of autoimmune regulator haplotypes in alopecia areata. (PMID: 18194361) Wengraf DA … Tazi-Ahnini R (Tissue antigens 2008) 3 23 43 56

ExternalLinks

View latest publications for AIRE gene in Mastermind

Products for AIRE Gene

Sources for AIRE Gene