AGL Gene (Protein Coding)

Amylo-Alpha-1, 6-Glucosidase, 4-Alpha-Glucanotransferase

GC01P099850
GIFtS:
46
This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinica... See more...

Aliases for AGL Gene

Aliases for AGL Gene

  • Amylo-Alpha-1, 6-Glucosidase, 4-Alpha-Glucanotransferase 2 3 5
  • Glycogen Debranching Enzyme 2 3 4
  • Amylo-1, 6-Glucosidase, 4-Alpha-Glucanotransferase 2 3
  • Glycogen Debrancher 3 4
  • GDE 3 4
  • Amylo-Alpha-1, 6-Glucosidase, 4-Alpha-Glucanotransferaseprovided 3
  • Glycogen Storage Disease Type III 2
  • Glycogen Debranching Protein 3

External Ids for AGL Gene

Previous GeneCards Identifiers for AGL Gene

  • GC01P101113
  • GC01P099441
  • GC01P099606
  • GC01P099778
  • GC01P100027
  • GC01P100088
  • GC01P100315
  • GC01P098438

Summaries for AGL Gene

Entrez Gene Summary for AGL Gene

  • This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

GeneCards Summary for AGL Gene

AGL (Amylo-Alpha-1, 6-Glucosidase, 4-Alpha-Glucanotransferase) is a Protein Coding gene. Diseases associated with AGL include Glycogen Storage Disease Iii and Glycogen Storage Disease. Among its related pathways are Glucose metabolism and Innate Immune System. Gene Ontology (GO) annotations related to this gene include carbohydrate binding and polysaccharide binding.

UniProtKB/Swiss-Prot Summary for AGL Gene

  • Multifunctional enzyme acting as 1,4-alpha-D-glucan:1,4-alpha-D-glucan 4-alpha-D-glycosyltransferase and amylo-1,6-glucosidase in glycogen degradation.

Tocris Summary for AGL Gene

  • Glycosylases are a group of enzymes that includes glucosidases, mannosidases and heparanases. There are two glucosidase subtypes, both found in the gut. They hydrolyze terminal (1,4)alpha-glucosidic linkages and (1,6)beta-glucosidic linkages, liberating alpha-glucose and beta-glucose.

Gene Wiki entry for AGL Gene

Additional gene information for AGL Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for AGL Gene

Genomics for AGL Gene

GeneHancer (GH) Regulatory Elements for AGL Gene

Promoters and enhancers for AGL Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH01J099848 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas 756.6 +0.8 822 5 ZNF785 ZBTB40 ZBTB6 MLX RBPJ SMARCE1 POLR2A MIXL1 ELF1 HLF AGL SASS6 piR-56451-005
GH01J100035 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 10.4 +188.3 188324 5.2 ZNF785 ZBTB40 SREBF1 MLX POLR2A CREB1 MIXL1 MYC ETV6 ELF1 MFSD14A SASS6 LRRC39 TRMT13 HNRNPA1P68 ENSG00000235795 RTCA AGL ENSG00000241073 ENSG00000283761
GH01J099765 Promoter/Enhancer 1.8 Ensembl ENCODE CraniofacialAtlas 9.8 -84.4 -84376 3.4 ZBTB40 ZBTB6 RBPJ SMARCE1 POLR2A ELF1 RELA L3MBTL2 RAD21 TEAD4 FRRS1 lnc-FRRS1-3 AGL DBT lnc-SASS6-4
GH01J099819 Enhancer 0.5 Ensembl 15.4 -28.7 -28677 2.4 PRDM1 ZNF512 PKNOX1 RUNX3 ZNF366 piR-55648-004 AGL LRRC39 FRRS1 lnc-AGL-1
GH01J099962 Enhancer 0.4 Ensembl 14.4 +113.2 113224 1.4 JUND FOS JUN LRRC39 AGL MFSD14A lnc-SLC35A3-3 NONHSAG002197.2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AGL on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AGL gene promoter:
  • STAT3

Genomic Locations for AGL Gene

Genomic Locations for AGL Gene
chr1:99,850,077-99,924,023
(GRCh38/hg38)
Size:
73,947 bases
Orientation:
Plus strand
chr1:100,315,640-100,389,579
(GRCh37/hg19)
Size:
73,940 bases
Orientation:
Plus strand

Genomic View for AGL Gene

Genes around AGL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AGL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AGL Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for AGL Gene

Proteins for AGL Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for AGL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P35573-GDE_HUMAN
    Recommended name:
    Glycogen debranching enzyme
    Protein Accession:
    P35573
    Secondary Accessions:
    • A6NCX7
    • A6NEK2
    • D3DT51
    • P78354
    • P78544
    • Q59H92
    • Q6AZ90
    • Q9UF08

    Protein attributes for AGL Gene

    Size:
    1532 amino acids
    Molecular mass:
    174764 Da
    Quaternary structure:
    • Monomer. Interacts with NHLRC1/malin.
    SequenceCaution:
    • Sequence=BAD92104.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for AGL Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AGL Gene

Protein Expression for AGL Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for AGL Gene

Other Protein References for AGL Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for AGL Gene

Domains & Families for AGL Gene

Gene Families for AGL Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted membrane proteins

Protein Domains for AGL Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for AGL Gene

GenScript: Design optimal peptide antigens:
  • Glycogen debrancher (GDE_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P35573

UniProtKB/Swiss-Prot:

GDE_HUMAN :
  • Belongs to the glycogen debranching enzyme family.
Family:
  • Belongs to the glycogen debranching enzyme family.
genes like me logo Genes that share domains with AGL: view

Function for AGL Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for AGL Gene

UniProtKB/Swiss-Prot Function:
Multifunctional enzyme acting as 1,4-alpha-D-glucan:1,4-alpha-D-glucan 4-alpha-D-glycosyltransferase and amylo-1,6-glucosidase in glycogen degradation.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=Transfers a segment of a (1->4)-alpha-D-glucan to a new position in an acceptor, which may be glucose or a (1->4)-alpha-D-glucan.; EC=2.4.1.25;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=Hydrolysis of (1->6)-alpha-D-glucosidic branch linkages in glycogen phosphorylase limit dextrin.; EC=3.2.1.33;.
GENATLAS Biochemistry:
amylo-1,6-glucosidase (4-alpha-glucantransferase),debranching enzyme,160kDa,glycogen catabolism) with liver,muscle specific and four further minor alternatively spliced isoforms

Phenotypes From GWAS Catalog for AGL Gene

Gene Ontology (GO) - Molecular Function for AGL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004133 glycogen debranching enzyme activity TAS 1374391
GO:0004134 4-alpha-glucanotransferase activity EXP,IBA 21873635
GO:0004135 amylo-alpha-1,6-glucosidase activity EXP,IBA 21873635
GO:0005515 protein binding IPI 17908927
GO:0016740 transferase activity IEA --
genes like me logo Genes that share ontologies with AGL: view
genes like me logo Genes that share phenotypes with AGL: view

Human Phenotype Ontology for AGL Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for AGL Gene

MGI Knock Outs for AGL:
  • Agl Agl<tm1Geno>
  • Agl Agl<tm1b(EUCOMM)Wtsi>
  • Agl Agl<tm1a(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for AGL Gene

Localization for AGL Gene

Subcellular locations from UniProtKB/Swiss-Prot for AGL Gene

Cytoplasm. Note=Under glycogenolytic conditions localizes to the nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AGL gene
Compartment Confidence
extracellular 4
cytosol 4
nucleus 3
endoplasmic reticulum 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for AGL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005634 nucleus IEA --
GO:0005737 cytoplasm IEA,IDA 17908927
GO:0005829 cytosol TAS --
GO:0016234 inclusion body IEA --
genes like me logo Genes that share ontologies with AGL: view

Pathways & Interactions for AGL Gene

genes like me logo Genes that share pathways with AGL: view

Pathways by source for AGL Gene

1 BioSystems pathway for AGL Gene
2 KEGG pathways for AGL Gene
1 GeneGo (Thomson Reuters) pathway for AGL Gene

Gene Ontology (GO) - Biological Process for AGL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005977 glycogen metabolic process IEA --
GO:0005978 glycogen biosynthetic process IEA --
GO:0005980 glycogen catabolic process TAS --
GO:0007584 response to nutrient IEA --
GO:0008152 metabolic process IEA --
genes like me logo Genes that share ontologies with AGL: view

No data available for SIGNOR curated interactions for AGL Gene

Drugs & Compounds for AGL Gene

Products:

  1. Drug

(10) Drugs for AGL Gene - From: HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
D-glucose Approved, Investigational, Vet_approved Pharma 0
Water Approved Pharma 0
Acarbose Approved, Investigational Pharma Alpha-glucosidase inhibitor, Glucosidase alpha inhibitor (intestinal) 97
maltose Experimental, Investigational Pharma 0
Castanospermine Experimental Pharma Glucosidases alpha and beta inhibitor 0

(8) Additional Compounds for AGL Gene - From: HMDB, Novoseek, and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Glycogen
  • Animal starch
  • Liver starch
  • Lyoglycogen
  • Phytoglycogen
 9005-79-2
Alpha-D-Glucose
  • alpha-D-GLC
  • alpha-Dextrose
  • a-D-GLC
  • α-D-GLC
  • a-D-Glucose
 492-62-6
Dextrin
  • British gum
  • Caloreen
  • Corn dextrin
  • Crystal gum
  • Dextrid
 9004-53-9
Miglustat hydrochloride
210110-90-0

(5) Tocris Compounds for AGL Gene

Compound Action Cas Number
1-Deoxymannojirimycin hydrochloride alpha-Mannosidase I inhibitor 73465-43-7
1-Deoxynojirimycin Glucosidase I and II inhibitor 19130-96-2
Acarbose Glucosidase alpha inhibitor (intestinal) 56180-94-0
Castanospermine Glucosidases alpha and beta inhibitor 79831-76-8
Miglustat hydrochloride alpha-glucosidase I and II inhibitor. Also inhibits ceramide-specific glycosyltransferases 210110-90-0
genes like me logo Genes that share compounds with AGL: view

Transcripts for AGL Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for AGL Gene

(6) REFSEQ mRNAs :
(13) Additional mRNA sequences :
(170) Selected AceView cDNA sequences:
(8) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AGL Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15a · 15b ^ 16a · 16b ^ 17a · 17b · 17c ^ 18 ^ 19 ^
SP1:
SP2: -
SP3:
SP4:
SP5: - -
SP6:
SP7: -
SP8:

ExUns: 20 ^ 21 ^ 22
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:

Relevant External Links for AGL Gene

GeneLoc Exon Structure for
AGL
ECgene alternative splicing isoforms for
AGL

Expression for AGL Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AGL Gene

mRNA expression in normal human tissues for AGL Gene
mRNA expression by BioGPS for AGL GenemRNA expression by GTEx for AGL Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for AGL Gene

This gene is overexpressed in Muscle - Skeletal (x10.5).

Protein differential expression in normal tissues from HIPED for AGL Gene

This gene is overexpressed in Retina (28.0) and Liver, secretome (12.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AGL Gene



Protein tissue co-expression partners for AGL Gene

NURSA nuclear receptor signaling pathways regulating expression of AGL Gene:

AGL

SOURCE GeneReport for Unigene cluster for AGL Gene:

Hs.904

mRNA Expression by UniProt/SwissProt for AGL Gene:

P35573-GDE_HUMAN
Tissue specificity: Liver, kidney and lymphoblastoid cells express predominantly isoform 1; whereas muscle and heart express not only isoform 1, but also muscle-specific isoform mRNAs (isoforms 2, 3 and 4). Isoforms 5 and 6 are present in both liver and muscle.

Evidence on tissue expression from TISSUES for AGL Gene

  • Liver(4.9)
  • Muscle(4.7)
  • Nervous system(4.5)
  • Eye(4.3)
  • Heart(4)
  • Blood(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for AGL Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cheek
  • ear
  • eye
  • face
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • nose
  • skull
Thorax:
  • heart
  • heart valve
Abdomen:
  • adrenal gland
  • duodenum
  • intestine
  • liver
  • pancreas
  • small intestine
Limb:
  • hand
  • lower limb
  • upper limb
General:
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • skin
  • sweat gland
genes like me logo Genes that share expression patterns with AGL: view

Orthologs for AGL Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for AGL Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia AGL 33 32
  • 99.7 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia AGL 33 32
  • 93.06 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia AGL 33 32
  • 91.73 (n)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia AGL 33
  • 88 (a)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Agl 32
  • 87.25 (n)
mouse
(Mus musculus)
 Mammalia Agl 17 33 32
  • 86.16 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia AGL 33
  • 83 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves AGL 33
  • 82 (a)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia AGL 33
  • 81 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia agl 32
  • 70.36 (n)
African clawed frog
(Xenopus laevis)
 Amphibia Xl.22218 32
zebrafish
(Danio rerio)
 Actinopterygii aglb 33
  • 72 (a)
 OneToMany
agla 33 32
  • 68.8 (n)
 OneToMany
CABZ01041804.1 33
  • 63 (a)
 OneToMany
rainbow trout
(Oncorhynchus mykiss)
 Actinopterygii Omy.5559 32
fruit fly
(Drosophila melanogaster)
 Insecta CG9485 33 34 32
  • 52.02 (n)
 OneToOne
African malaria mosquito
(Anopheles gambiae)
 Insecta AgaP_AGAP001200 32
  • 50.59 (n)
worm
(Caenorhabditis elegans)
 Secernentea agl-1 33 32
  • 50.93 (n)
 OneToOne
R06A4.8 34
  • 43 (a)
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes GDB1 35 35 35 33 32
  • 51.61 (n)
A. gosspyii yeast
(Ashbya gossypii)
 Saccharomycetes AGOS_AEL276C 32
  • 47.42 (n)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 33
  • 51 (a)
 OneToOne
Cin.4153 32
bread mold
(Neurospora crassa)
 Ascomycetes NCU00743 32
  • 46.88 (n)
sea squirt
(Ciona intestinalis)
 Ascidiacea Cin.4153 32
Species where no ortholog for AGL was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for AGL Gene

ENSEMBL:
Gene Tree for AGL (if available)
TreeFam:
Gene Tree for AGL (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AGL: view image

Paralogs for AGL Gene

No data available for Paralogs for AGL Gene

Variants for AGL Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for AGL Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1026785989 likely-benign, Glycogen storage disease type III 99,916,741(+) C/G intron_variant
rs1049817296 likely-benign, Glycogen storage disease type III 99,916,663(+) G/A coding_sequence_variant, synonymous_variant
rs1057516254 likely-pathogenic, Glycogen storage disease type III 99,884,627(+) C/T coding_sequence_variant, stop_gained
rs1057516306 likely-pathogenic, Glycogen storage disease type III 99,891,665(+) CCC/CC coding_sequence_variant, frameshift
rs1057516308 likely-pathogenic, Glycogen storage disease type III 99,862,307(+) TTGGTGCTGATAATCATGTGCTACCCTTGG/TTGG coding_sequence_variant, frameshift, genic_upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for AGL Gene

Variant ID Type Subtype PubMed ID
esv2655277 CNV deletion 19546169
esv2758952 CNV loss 17122850
esv3304048 CNV mobile element insertion 20981092
esv3357668 CNV insertion 20981092
nsv1002853 CNV gain 25217958
nsv1003259 CNV loss 25217958
nsv1132827 CNV insertion 24896259
nsv428146 CNV gain 18775914
nsv523220 CNV loss 19592680
nsv526047 CNV gain 19592680
nsv947436 CNV duplication 23825009

Variation tolerance for AGL Gene

Residual Variation Intolerance Score: 41% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.67; 91.44% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AGL Gene

Human Gene Mutation Database (HGMD)
AGL
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AGL

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AGL Gene

Disorders for AGL Gene

MalaCards: The human disease database

(9) MalaCards diseases for AGL Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
glycogen storage disease iii
  • gsd3
glycogen storage disease
  • gsd
macular telangiectasia type 2
  • idiopathic juxtafoveal retinal telangiectasia
finger agnosia
hypoglycemia
  • hypoglycaemia
- elite association - COSMIC cancer census association via MalaCards
Search AGL in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

GDE_HUMAN
  • Glycogen storage disease 3 (GSD3) [MIM:232400]: A metabolic disorder associated with an accumulation of abnormal glycogen with short outer chains. It is clinically characterized by hepatomegaly, hypoglycemia, short stature, and variable myopathy. Glycogen storage disease type 3 includes different forms: GSD type 3A patients lack glycogen debrancher enzyme activity in both liver and muscle, while GSD type 3B patients are enzyme-deficient in liver only. In rare cases, selective loss of only 1 of the 2 debranching activities, glucosidase or transferase, results in GSD type 3C or type 3D, respectively. {ECO:0000269 PubMed:10571954, ECO:0000269 PubMed:17908927}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for AGL

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with AGL: view

No data available for Genatlas for AGL Gene

Publications for AGL Gene

  1. Molecular genetic basis and prevalence of glycogen storage disease type IIIA in the Faroe Islands. (PMID: 11378828) Santer R … Schaub J (European journal of human genetics : EJHG 2001) 3 23 43 56
  2. Heterogeneous mutations in the glycogen-debranching enzyme gene are responsible for glycogen storage disease type IIIa in Japan. (PMID: 10982190) Okubo M … Murase T (Human genetics 2000) 3 4 23 56
  3. Isolation and nucleotide sequence of human liver glycogen debranching enzyme mRNA: identification of multiple tissue-specific isoforms. (PMID: 9332391) Bao Y … Chen YT (Gene 1997) 3 4 23 56
  4. A nonsense mutation due to a single base insertion in the 3'-coding region of glycogen debranching enzyme gene associated with a severe phenotype in a patient with glycogen storage disease type IIIa. (PMID: 8990006) Shen J … Chen YT (Human mutation 1997) 3 23 43 56
  5. A novel donor splice site mutation in the glycogen debranching enzyme gene is associated with glycogen storage disease type III. (PMID: 8702417) Okubo M … Murase T (Biochemical and biophysical research communications 1996) 3 23 43 56

ExternalLinks

View latest publications for AGL gene in Mastermind

Products for AGL Gene

Sources for AGL Gene