Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AFDN-DT Gene

Subcategory (RNA class) for AFDN-DT Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for AFDN-DT Gene

  • AFDN Divergent Transcript 2 3 5
  • MLLT4 Antisense RNA 1 (Non-Protein Coding) 2 3
  • MLLT4 Antisense RNA 1 (Head To Head) 2 3
  • AFDN Antisense RNA 1 (Head To Head) 2 3
  • Chromosome 6 Open Reading Frame 124 2
  • DJ431P23.3 3
  • MLLT4-AS1 3
  • AFDN-AS1 3
  • C6orf124 3
  • HGC6.4 3

External Ids for AFDN-DT Gene

Previous HGNC Symbols for AFDN-DT Gene

  • C6orf124
  • MLLT4-AS1
  • AFDN-AS1

Summaries for AFDN-DT Gene

GeneCards Summary for AFDN-DT Gene

AFDN-DT (AFDN Divergent Transcript) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for AFDN-DT Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AFDN-DT Gene

Genomics for AFDN-DT Gene

GeneHancer (GH) Regulatory Elements for AFDN-DT Gene

Promoters and enhancers for AFDN-DT Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06I167824 Enhancer 0.9 ENCODE dbSUPER 550.8 +1.8 1820 0.2 HDAC1 CEBPG CTBP1 ZNF316 ADNP VEZF1 ZSCAN29 NFE2 ATF7 RNF2 AFDN AFDN-DT LINC01558
GH06I167805 Enhancer 0.9 ENCODE 12 +20.4 20417 2.3 FOXA2 MLX ARID4B DMAP1 ZNF48 ETS1 SP5 MXD4 MIER2 PPARG AFDN AFDN-DT LINC01558
GH06I167782 Enhancer 0.7 ENCODE 11.2 +43.8 43775 1.2 ELF3 SOX13 TFAP4 SAP130 ARID4B ZNF48 ZNF7 TEAD3 FOSL1 ZNF366 AFDN AFDN-DT LINC02487 LOC100422263 LOC441179
GH06I167786 Enhancer 0.6 ENCODE 11.2 +39.8 39808 1 TFAP4 TFE3 RXRA RAD21 NR2F2 ZNF316 POLR2A HNF4A PRDM1 AFDN AFDN-DT LINC02487 LINC01558 LOC441179 LOC100422263
GH06I168659 Enhancer 0.6 dbSUPER 11 -833.2 -833152 1.1 ZNF473 ZNF571 ZNF621 MCM5 YBX1 MCM2 ZNF311 ZNF776 IKZF1 ZNF248 LINC02519 ENSG00000272848 AFDN-DT AFDN LOC105378142 GC06M168474 SMOC2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around AFDN-DT on UCSC Golden Path with GeneCards custom track

Genomic Locations for AFDN-DT Gene

Genomic Locations for AFDN-DT Gene
chr6:167,823,876-167,826,796
(GRCh38/hg38)
Size:
2,921 bases
Orientation:
Minus strand
chr6:168,224,556-168,227,476
(GRCh37/hg19)

Genomic View for AFDN-DT Gene

Genes around AFDN-DT on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AFDN-DT Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AFDN-DT Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AFDN-DT Gene

Proteins for AFDN-DT Gene

Post-translational modifications for AFDN-DT Gene

No Post-translational modifications

No data available for DME Specific Peptides for AFDN-DT Gene

Domains & Families for AFDN-DT Gene

Suggested Antigen Peptide Sequences for AFDN-DT Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains and UniProtKB/Swiss-Prot for AFDN-DT Gene

Function for AFDN-DT Gene

Gene Ontology (GO) - Molecular Function for AFDN-DT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with AFDN-DT: view

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for AFDN-DT Gene

Localization for AFDN-DT Gene

Gene Ontology (GO) - Cellular Components for AFDN-DT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
genes like me logo Genes that share ontologies with AFDN-DT: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Subcellular locations from the Human Protein Atlas (HPA) for AFDN-DT Gene

Pathways & Interactions for AFDN-DT Gene

SuperPathways for AFDN-DT Gene

No Data Available

Interacting Proteins for AFDN-DT Gene

Gene Ontology (GO) - Biological Process for AFDN-DT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with AFDN-DT: view

No data available for Pathways by source and SIGNOR curated interactions for AFDN-DT Gene

Drugs & Compounds for AFDN-DT Gene

No Compound Related Data Available

Transcripts for AFDN-DT Gene

mRNA/cDNA for AFDN-DT Gene

(1) REFSEQ mRNAs :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AFDN-DT Gene

No ASD Table

Relevant External Links for AFDN-DT Gene

GeneLoc Exon Structure for
AFDN-DT
ECgene alternative splicing isoforms for
AFDN-DT

Expression for AFDN-DT Gene

No Expression Related Data Available

Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for AFDN-DT Gene

Orthologs for AFDN-DT Gene

Evolution for AFDN-DT Gene

ENSEMBL:
Gene Tree for AFDN-DT (if available)
TreeFam:
Gene Tree for AFDN-DT (if available)

No data available for Orthologs for AFDN-DT Gene

Paralogs for AFDN-DT Gene

No data available for Paralogs for AFDN-DT Gene

Variants for AFDN-DT Gene

Sequence variations from dbSNP and Humsavar for AFDN-DT Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000173567 -- 167,828,154(-) T/C upstream_transcript_variant
rs1000225515 -- 167,826,853(-) GCGCACGGCGGCGGGCGGGGCGC/GCGC upstream_transcript_variant
rs1000315026 -- 167,828,756(-) T/C upstream_transcript_variant
rs1000456931 -- 167,828,432(-) A/C upstream_transcript_variant
rs1001709834 -- 167,826,640(-) G/A non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for AFDN-DT Gene

Variant ID Type Subtype PubMed ID
nsv949897 CNV deletion 24416366
nsv830864 CNV gain 17160897
nsv1074037 CNV deletion 25765185
nsv1027114 CNV gain 25217958
esv2761051 CNV gain 21179565
esv2422263 CNV duplication 17116639
dgv27e196 CNV duplication 17116639
dgv217e55 CNV gain 17911159

Additional Variant Information for AFDN-DT Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
AFDN-DT

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for AFDN-DT Gene

Disorders for AFDN-DT Gene

No disorders were found for AFDN-DT Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for AFDN-DT Gene

Publications for AFDN-DT Gene

  1. Complete DNA sequence and characterization of a 330-kb VNTR-rich region on chromosome 6q27 that is commonly deleted in ovarian cancer. (PMID: 10382971) Minaguchi T … Nakamura Y (DNA research : an international journal for rapid publication of reports on genes and genomes 1999) 2 3 58
  2. Decreased expression of the long non-coding RNA MLLT4 antisense RNA 1 is a potential biomarker and an indicator of a poor prognosis for gastric cancer. (PMID: 28927028) Lai Y … Wang J (Oncology letters 2017) 3 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for AFDN-DT Gene

Sources for AFDN-DT Gene

Content
Loading form....