This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple t... See more...

Aliases for ADSS1 Gene

Aliases for ADSS1 Gene

  • Adenylosuccinate Synthase 1 2 3
  • Adenylosuccinate Synthase Like 1 2 3 5
  • Adenylosuccinate Synthetase, Muscle Isozyme 3 4
  • Adenylosuccinate Synthetase, Basic Isozyme 3 4
  • Adenylosuccinate Synthetase Isozyme 1 3 4
  • M-Type Adenylosuccinate Synthetase 3 4
  • IMP--Aspartate Ligase 1 3 4
  • EC 6.3.4.4 4 54
  • AMPSase 1 3 4
  • AdSS 1 3 4
  • ADSSL1 3 5
  • MPD5 3

External Ids for ADSS1 Gene

Previous HGNC Symbols for ADSS1 Gene

  • ADSSL1

Summaries for ADSS1 Gene

Entrez Gene Summary for ADSS1 Gene

  • This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

GeneCards Summary for ADSS1 Gene

ADSS1 (Adenylosuccinate Synthase 1) is a Protein Coding gene. Diseases associated with ADSS1 include Myopathy, Distal, 5 and Myopathy. Among its related pathways are Metabolism of nucleotides and purine nucleotides de novo biosynthesis. An important paralog of this gene is ADSS2.

UniProtKB/Swiss-Prot Summary for ADSS1 Gene

  • Component of the purine nucleotide cycle (PNC), which interconverts IMP and AMP to regulate the nucleotide levels in various tissues, and which contributes to glycolysis and ammoniagenesis. Catalyzes the first committed step in the biosynthesis of AMP from IMP.

Additional gene information for ADSS1 Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ADSS1 Gene

Genomics for ADSS1 Gene

GeneHancer (GH) Regulatory Elements for ADSS1 Gene

Promoters and enhancers for ADSS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J104721 Promoter/Enhancer 2 EPDnew ENCODE CraniofacialAtlas dbSUPER 750.6 -0.3 -310 4.6 PPP1R10 ZBTB40 CTCF RBPJ SMARCE1 POLR2A NR2F1 NR2F6 RAD21 BCL6B ADSS1 AKT1 MTA1 ENSG00000257270 INF2 NONHSAG016064.2
GH14J104728 Promoter/Enhancer 1.9 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 29.1 +9.2 9174 9.3 CTCF FOXA1 MLX RBPJ POLR2A NR2F1 NR2F6 ATF1 MIXL1 NFYC AKT1 ADSS1 SIVA1 MTA1 CEP170B IGHG4 C14orf180 piR-36531-006
GH14J104766 Promoter/Enhancer 1.6 Ensembl ENCODE CraniofacialAtlas dbSUPER 24.1 +43.8 43811 3.3 CTCF LCORL FOXA1 MLX RBPJ NR2F1 NR2F6 MIXL1 NFYC RAD21 ENSG00000258430 LOC102723342 ADSS1 AKT1 MTA1 IGHG4 lnc-AHNAK2-9 SIVA1
GH14J104696 Promoter/Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 18 -25.2 -25213 4.1 SMARCE1 RUNX1 L3MBTL2 TEAD4 ZNF148 CBFA2T2 SMARCA4 ZNF639 TRIM24 EGR1 ADSS1 SIVA1 INF2 AKT1 C14orf180 ENSG00000258858 NONHSAG016064.2
GH14J104825 Promoter/Enhancer 1.4 ENCODE CraniofacialAtlas 10.9 +102.8 102846 2.6 ZNF785 CTCF ZBTB6 RAD21 SP1 SP7 ZSCAN21 PRDM1 SP5 EGR1 LINC00638 ADSS1 CEP170B RPS26P49 lnc-AKT1-3 piR-61945-151
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ADSS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for ADSS1 Gene

Genomic Locations for ADSS1 Gene
chr14:104,724,186-104,747,325
(GRCh38/hg38)
Size:
23,140 bases
Orientation:
Plus strand
chr14:105,190,523-105,213,662
(GRCh37/hg19)
Size:
23,140 bases
Orientation:
Plus strand

Genomic View for ADSS1 Gene

Genes around ADSS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ADSS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ADSS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADSS1 Gene

Proteins for ADSS1 Gene

  • Protein details for ADSS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8N142-PURA1_HUMAN
    Recommended name:
    Adenylosuccinate synthetase isozyme 1
    Protein Accession:
    Q8N142
    Secondary Accessions:
    • Q86TT6
    • Q8N714

    Protein attributes for ADSS1 Gene

    Size:
    457 amino acids
    Molecular mass:
    50208 Da
    Cofactor:
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420;
    Quaternary structure:
    • Homodimer.
    SequenceCaution:
    • Sequence=AAH32039.1; Type=Frameshift; Positions=1; Evidence={ECO:0000305}; Sequence=CAD62614.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for ADSS1 Gene

    Alternative splice isoforms for ADSS1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ADSS1 Gene

Selected DME Specific Peptides for ADSS1 Gene

Q8N142:
  • TVGGVCTGLG
  • PMVRDGVYF
  • NGFTALALTKLDILD
  • YSSKAAR
  • RRCGWLD
  • GDEGKGK
  • QWGDEGK
  • ISDRAHL
  • YETLPGW
  • FIGNGVV
  • ERIRPMV
  • YPFVTSS
  • YEALHGPPKK
  • EYDFHLLPSGIIN
  • KAYTTRVG
  • NAGHTVV
  • HLPGLFEEAEKN
  • GGNNAGH
  • GTTKKGIGP
  • TGRKRRCGW

Post-translational modifications for ADSS1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Domains & Families for ADSS1 Gene

Gene Families for ADSS1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for ADSS1 Gene

GenScript: Design optimal peptide antigens:
  • IMP--aspartate ligase 1 (PURA1_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q8N142

UniProtKB/Swiss-Prot:

PURA1_HUMAN :
  • Belongs to the adenylosuccinate synthetase family.
Family:
  • Belongs to the adenylosuccinate synthetase family.
genes like me logo Genes that share domains with ADSS1: view

Function for ADSS1 Gene

Molecular function for ADSS1 Gene

UniProtKB/Swiss-Prot Function:
Component of the purine nucleotide cycle (PNC), which interconverts IMP and AMP to regulate the nucleotide levels in various tissues, and which contributes to glycolysis and ammoniagenesis. Catalyzes the first committed step in the biosynthesis of AMP from IMP.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=GTP + IMP + L-aspartate = GDP + 2 H(+) + N(6)-(1,2-dicarboxyethyl)-AMP + phosphate; Xref=Rhea:RHEA:15753, ChEBI:CHEBI:15378, ChEBI:CHEBI:29991, ChEBI:CHEBI:37565, ChEBI:CHEBI:43474, ChEBI:CHEBI:57567, ChEBI:CHEBI:58053, ChEBI:CHEBI:58189; EC=6.3.4.4; Evidence=. ;.

Enzyme Numbers (IUBMB) for ADSS1 Gene

Phenotypes From GWAS Catalog for ADSS1 Gene

Gene Ontology (GO) - Molecular Function for ADSS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000287 magnesium ion binding IEA --
GO:0003924 GTPase activity IEA --
GO:0004019 adenylosuccinate synthase activity IEA,IMP 26506222
GO:0005525 GTP binding NAS,IEA 15786719
GO:0016874 ligase activity IEA --
genes like me logo Genes that share ontologies with ADSS1: view
genes like me logo Genes that share phenotypes with ADSS1: view

Human Phenotype Ontology for ADSS1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for ADSS1

CRISPR Products

miRNA for ADSS1 Gene

miRTarBase miRNAs that target ADSS1

Clone Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for ADSS1 Gene

Localization for ADSS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ADSS1 Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ADSS1 gene
Compartment Confidence
cytosol 5
mitochondrion 3

Gene Ontology (GO) - Cellular Components for ADSS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IDA,IBA 15786719
GO:0005829 cytosol TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with ADSS1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ADSS1 Gene

Pathways & Interactions for ADSS1 Gene

genes like me logo Genes that share pathways with ADSS1: view

UniProtKB/Swiss-Prot Q8N142-PURA1_HUMAN

  • Pathway: Purine metabolism; AMP biosynthesis via de novo pathway; AMP from IMP: step 1/2.

Gene Ontology (GO) - Biological Process for ADSS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002376 immune system process NAS 15786719
GO:0006163 purine nucleotide metabolic process IEA --
GO:0006164 purine nucleotide biosynthetic process IEA --
GO:0006167 AMP biosynthetic process IDA 15786719
GO:0006531 aspartate metabolic process IEA --
genes like me logo Genes that share ontologies with ADSS1: view

No data available for SIGNOR curated interactions for ADSS1 Gene

Drugs & Compounds for ADSS1 Gene

(11) Drugs for ADSS1 Gene - From: DrugBank and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Aspartic acid Approved Nutra Target 171
Acyclovir Approved Pharma Enzyme, substrate 113
Magnesium Approved, Experimental, Investigational Pharma 0
Phosphoric acid Approved Pharma 0
Adenylsuccinic acid Experimental Pharma Target 0

(2) Additional Compounds for ADSS1 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
N(6)-(1,2-dicarboxyethyl)AMP
  • N6-(1,2-Dicarboxyethyl)AMP
  • Adenylosuccinate
  • Adenylosuccinic acid
Phosphate
  • [po(OH)3]
  • Acide phosphorique
  • Acidum phosphoricum
  • H3PO4
  • Orthophosphoric acid
14066-19-4, 14265-44-2
genes like me logo Genes that share compounds with ADSS1: view

Transcripts for ADSS1 Gene

mRNA/cDNA for ADSS1 Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ADSS1 Gene

No ASD Table

Relevant External Links for ADSS1 Gene

GeneLoc Exon Structure for
ADSS1
ECgene alternative splicing isoforms for
ADSS1

Expression for ADSS1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

NURSA nuclear receptor signaling pathways regulating expression of ADSS1 Gene:

ADSS1

SOURCE GeneReport for Unigene cluster for ADSS1 Gene:

Hs.592327

mRNA Expression by UniProt/SwissProt for ADSS1 Gene:

Q8N142-PURA1_HUMAN
Tissue specificity: Predominantly expressed in skeletal muscle and heart, as well as in several hematopoietic cell lines and solid tumors.

Evidence on tissue expression from TISSUES for ADSS1 Gene

  • Heart(4.6)
  • Liver(4.3)
  • Muscle(3.8)
genes like me logo Genes that share expression patterns with ADSS1: view

No data available for mRNA expression in normal human tissues , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for ADSS1 Gene

Orthologs for ADSS1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ADSS1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ADSSL1 33
  • 99 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ADSSL1 33
  • 92 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Adssl1 17 33 32
  • 89.28 (n)
rat
(Rattus norvegicus)
Mammalia Adssl1 32
  • 89.2 (n)
cow
(Bos Taurus)
Mammalia ADSSL1 33 32
  • 87.96 (n)
OneToOne
dog
(Canis familiaris)
Mammalia ADSSL1 33 32
  • 85.7 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia ADSSL1 33
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves ADSSL1 33 32
  • 79.08 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ADSSL1 33
  • 81 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia adssl1 32
  • 76.11 (n)
zebrafish
(Danio rerio)
Actinopterygii adssl1 33 32
  • 74.14 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG17273 33 32
  • 64.85 (n)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP003405 32
  • 63.01 (n)
worm
(Caenorhabditis elegans)
Secernentea C37H5.6 33 32
  • 55.68 (n)
OneToMany
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ABL186W 32
  • 57.66 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes ADE12 35 33 32
  • 55.69 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D19426g 32
  • 54.82 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons ADSS 32
  • 52.12 (n)
rice
(Oryza sativa)
Liliopsida Os03g0699300 32
  • 54.35 (n)
wheat
(Triticum aestivum)
Liliopsida Ta.121 32
corn
(Zea mays)
Liliopsida Zm.309 32
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes ade2 32
  • 57.29 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU09789 32
  • 56.25 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8281 33
  • 54 (a)
OneToMany
Cin.3790 32
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.3790 32
Species where no ortholog for ADSS1 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for ADSS1 Gene

ENSEMBL:
Gene Tree for ADSS1 (if available)
TreeFam:
Gene Tree for ADSS1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ADSS1: view image

Paralogs for ADSS1 Gene

Paralogs for ADSS1 Gene

genes like me logo Genes that share paralogs with ADSS1: view

Variants for ADSS1 Gene

Sequence variations from dbSNP and Humsavar for ADSS1 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs140614802 pathogenic-likely-pathogenic, Myopathy, distal, 5, Myopathy, distal, 5 (MPD5) [MIM:617030] 104,741,231(+) G/A coding_sequence_variant, missense_variant
rs559454746 pathogenic, Myopathy, distal, 5 104,741,973(+) A/ coding_sequence_variant, frameshift
rs781559734 uncertain-significance, Myopathy, distal, 5 104,724,301(+) CCCCCC/CCCCC/CCCCCCC coding_sequence_variant, frameshift, genic_upstream_transcript_variant
rs765056945 likely-benign, not specified 104,738,344(+) CTCTGTCTCTCATGCCTCTGTCTCTCATGC/CTCTGTCTCTCATGC/CTCTGTCTCTCATGCCTCTGTCTCTCATGCCTCTGTCTCTCATGC intron_variant
rs755536909 uncertain-significance, not provided 104,740,666(+) G/A/C/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for ADSS1 Gene

Variant ID Type Subtype PubMed ID
dgv265n27 CNV loss 19166990
dgv266n27 CNV loss 19166990
dgv3952n54 CNV loss 21841781
dgv3953n54 CNV gain 21841781
dgv3954n54 CNV loss 21841781
esv3635623 CNV gain 21293372
esv3635627 CNV gain 21293372
nsv1054574 CNV loss 25217958
nsv1437 CNV insertion 18451855
nsv456455 CNV loss 19166990
nsv470677 CNV loss 18288195
nsv470678 CNV gain 18288195
nsv517038 CNV loss 19592680
nsv566051 CNV gain+loss 21841781
nsv566057 CNV gain+loss 21841781
nsv566058 CNV gain 21841781
nsv566062 CNV gain+loss 21841781
nsv566069 CNV loss 21841781
nsv820230 CNV gain 19587683
nsv952271 CNV deletion 24416366

Variation tolerance for ADSS1 Gene

Residual Variation Intolerance Score: 16.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.14; 51.52% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ADSS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
ADSS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ADSS1 Gene

Disorders for ADSS1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for ADSS1 Gene - From: OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
myopathy, distal, 5
  • mpd5
myopathy
  • muscular diseases
- elite association - COSMIC cancer census association via MalaCards
Search ADSS1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

PURA1_HUMAN
  • Myopathy, distal, 5 (MPD5) [MIM:617030]: A form of distal myopathy, a group of muscular disorders characterized by progressive muscular weakness and muscle atrophy beginning in the hands, the legs or the feet. MPD5 is an autosomal recessive form, predominantly affecting the lower limbs. {ECO:0000269 PubMed:26506222}. Note=The disease is caused by mutations affecting the gene represented in this entry.
genes like me logo Genes that share disorders with ADSS1: view

No data available for Genatlas and External Links for ADSS1 Gene

Publications for ADSS1 Gene

  1. Molecular cloning and characterization of a novel muscle adenylosuccinate synthetase, AdSSL1, from human bone marrow stromal cells. (PMID: 15786719) Sun H … Cao X (Molecular and cellular biochemistry 2005) 2 3 4 23 56
  2. ADSSL1 mutation relevant to autosomal recessive adolescent onset distal myopathy. (PMID: 26506222) Park HJ … Choi BO (Annals of neurology 2016) 2 3 4 56
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56

Products for ADSS1 Gene

Sources for ADSS1 Gene