Aliases for ADGRA2 Gene

Aliases for ADGRA2 Gene

  • Adhesion G Protein-Coupled Receptor A2 2 3 4 5
  • Tumor Endothelial Marker 5 2 3 4
  • G-Protein Coupled Receptor 124 3 4
  • GPR124 3 4
  • TEM5 3 4
  • G Protein-Coupled Receptor 124 2
  • KIAA1531 4

External Ids for ADGRA2 Gene

Previous HGNC Symbols for ADGRA2 Gene

  • GPR124

Summaries for ADGRA2 Gene

GeneCards Summary for ADGRA2 Gene

ADGRA2 (Adhesion G Protein-Coupled Receptor A2) is a Protein Coding gene. Among its related pathways are Integrins in angiogenesis. Gene Ontology (GO) annotations related to this gene include G protein-coupled receptor activity and transmembrane signaling receptor activity. An important paralog of this gene is ADGRA3.

UniProtKB/Swiss-Prot Summary for ADGRA2 Gene

  • Endothelial receptor which functions together with RECK to enable brain endothelial cells to selectively respond to Wnt7 signals (WNT7A or WNT7B) (PubMed:28289266, PubMed:30026314). Plays a key role in Wnt7-specific responses, such as endothelial cell sprouting and migration in the forebrain and neural tube, and establishment of the blood-brain barrier (By similarity). Acts as a Wnt7-specific coactivator of canonical Wnt signaling: required to deliver RECK-bound Wnt7 to frizzled by assembling a higher-order RECK-ADGRA2-Fzd-LRP5-LRP6 complex (PubMed:30026314). ADGRA2-tethering function does not rely on its G-protein coupled receptor (GPCR) structure but instead on its combined capacity to interact with RECK extracellularly and recruit the Dishevelled scaffolding protein intracellularly (PubMed:30026314). Binds to the glycosaminoglycans heparin, heparin sulfate, chondroitin sulfate and dermatan sulfate (PubMed:16982628).

Gene Wiki entry for ADGRA2 Gene

Additional gene information for ADGRA2 Gene

No data available for Entrez Gene Summary , CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ADGRA2 Gene

Genomics for ADGRA2 Gene

GeneHancer (GH) Regulatory Elements for ADGRA2 Gene

Promoters and enhancers for ADGRA2 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ADGRA2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for ADGRA2 Gene

Genomic Locations for ADGRA2 Gene
chr8:37,784,191-37,844,896
(GRCh38/hg38)
Size:
60,706 bases
Orientation:
Plus strand
chr8:37,641,709-37,702,414
(GRCh37/hg19)
Size:
60,706 bases
Orientation:
Plus strand

Genomic View for ADGRA2 Gene

Genes around ADGRA2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ADGRA2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ADGRA2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADGRA2 Gene

Proteins for ADGRA2 Gene

  • Protein details for ADGRA2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96PE1-AGRA2_HUMAN
    Recommended name:
    Adhesion G protein-coupled receptor A2
    Protein Accession:
    Q96PE1
    Secondary Accessions:
    • A6H8W3
    • D3DSW4
    • Q8N3R1
    • Q8TEM3
    • Q96KB2
    • Q9P1Z7
    • Q9UFY4

    Protein attributes for ADGRA2 Gene

    Size:
    1338 amino acids
    Molecular mass:
    142647 Da
    Quaternary structure:
    • Interacts with RECK; the interaction is direct (By similarity). Interacts (via PDZ-binding motif) with DLG1 (via PDZ domains) (PubMed:15021905). The cleaved extracellular subunit interacts with the integrin heterodimer ITGAV:ITGB3 (PubMed:16982628).
    SequenceCaution:
    • Sequence=AAI46775.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=AAL11992.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=AAO27354.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAA96055.2; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Alternative splice isoforms for ADGRA2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ADGRA2 Gene

Post-translational modifications for ADGRA2 Gene

  • Glycosylated.
  • Proteolytically cleaved into two subunits, an extracellular subunit and a seven-transmembrane subunit (PubMed:22013897, PubMed:16982628). Cleaved by thrombin (F2) and MMP1 (PubMed:22013897). Also cleaved by MMP9, with lower efficiency (PubMed:22013897, PubMed:16982628). Presence of the protein disulfide-isomerase P4HB at the cell surface is additionally required for shedding of the extracellular subunit, suggesting that the subunits are linked by disulfide bonds (PubMed:22013897). Shedding is enhanced by the growth factor FGF2 and may promote cell survival during angiogenesis (PubMed:16982628).
  • Glycosylation at Asn84, Asn101, Asn162, Asn207, Asn275, Asn602, and Asn690
  • Modification sites at PhosphoSitePlus

Other Protein References for ADGRA2 Gene

No data available for DME Specific Peptides for ADGRA2 Gene

Domains & Families for ADGRA2 Gene

Gene Families for ADGRA2 Gene

HGNC:
Human Protein Atlas (HPA):
  • G-protein coupled receptors
  • Predicted intracellular proteins
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for ADGRA2 Gene

GenScript: Design optimal peptide antigens:
  • G protein-coupled receptor 124, isoform CRA_a (D3DSW5_HUMAN)
  • Tumor endothelial marker 5 (GP124_HUMAN)
  • Tumor endothelial marker 5 (Q6YN44_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96PE1

UniProtKB/Swiss-Prot:

AGRA2_HUMAN :
  • The leucine-rich repeats (LRRs) are important for potentiation of Wnt7 signaling.
  • Belongs to the G-protein coupled receptor 2 family. Adhesion G-protein coupled receptor (ADGR) subfamily.
Domain:
  • The leucine-rich repeats (LRRs) are important for potentiation of Wnt7 signaling.
  • The RGD motif is involved in integrin ITGAV:ITGB3 binding.
Family:
  • Belongs to the G-protein coupled receptor 2 family. Adhesion G-protein coupled receptor (ADGR) subfamily.
genes like me logo Genes that share domains with ADGRA2: view

Function for ADGRA2 Gene

Molecular function for ADGRA2 Gene

UniProtKB/Swiss-Prot Function:
Endothelial receptor which functions together with RECK to enable brain endothelial cells to selectively respond to Wnt7 signals (WNT7A or WNT7B) (PubMed:28289266, PubMed:30026314). Plays a key role in Wnt7-specific responses, such as endothelial cell sprouting and migration in the forebrain and neural tube, and establishment of the blood-brain barrier (By similarity). Acts as a Wnt7-specific coactivator of canonical Wnt signaling: required to deliver RECK-bound Wnt7 to frizzled by assembling a higher-order RECK-ADGRA2-Fzd-LRP5-LRP6 complex (PubMed:30026314). ADGRA2-tethering function does not rely on its G-protein coupled receptor (GPCR) structure but instead on its combined capacity to interact with RECK extracellularly and recruit the Dishevelled scaffolding protein intracellularly (PubMed:30026314). Binds to the glycosaminoglycans heparin, heparin sulfate, chondroitin sulfate and dermatan sulfate (PubMed:16982628).

Phenotypes From GWAS Catalog for ADGRA2 Gene

Gene Ontology (GO) - Molecular Function for ADGRA2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004888 transmembrane signaling receptor activity IEA --
GO:0004930 G protein-coupled receptor activity TAS,IEA --
GO:0005515 protein binding IPI 15021905
genes like me logo Genes that share ontologies with ADGRA2: view
genes like me logo Genes that share phenotypes with ADGRA2: view

Animal Models for ADGRA2 Gene

MGI Knock Outs for ADGRA2:

Animal Model Products

  • Taconic Biosciences Mouse Models for ADGRA2

CRISPR Products

miRNA for ADGRA2 Gene

miRTarBase miRNAs that target ADGRA2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ADGRA2 Gene

Localization for ADGRA2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ADGRA2 Gene

Cell membrane; Multi-pass membrane protein. Cell projection, filopodium. Note=Enriched at lateral cell borders and also at sites of cell-ECM (extracellular matrix) contact. {ECO:0000269 PubMed:21421844}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ADGRA2 gene
Compartment Confidence
plasma membrane 5
extracellular 1

Gene Ontology (GO) - Cellular Components for ADGRA2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane ISS --
GO:0009986 cell surface IEA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA,TAS --
GO:0030175 filopodium IEA --
genes like me logo Genes that share ontologies with ADGRA2: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ADGRA2 Gene

Pathways & Interactions for ADGRA2 Gene

PathCards logo

SuperPathways for ADGRA2 Gene

SuperPathway Contained pathways
1 Integrins in angiogenesis
genes like me logo Genes that share pathways with ADGRA2: view

Pathways by source for ADGRA2 Gene

1 BioSystems pathway for ADGRA2 Gene

Gene Ontology (GO) - Biological Process for ADGRA2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002040 sprouting angiogenesis IEA,ISS --
GO:0007165 signal transduction IEA --
GO:0007166 cell surface receptor signaling pathway IEA --
GO:0007186 G protein-coupled receptor signaling pathway TAS,IEA --
GO:0007417 central nervous system development IEA,ISS --
genes like me logo Genes that share ontologies with ADGRA2: view

No data available for SIGNOR curated interactions for ADGRA2 Gene

Drugs & Compounds for ADGRA2 Gene

No Compound Related Data Available

Transcripts for ADGRA2 Gene

mRNA/cDNA for ADGRA2 Gene

(1) REFSEQ mRNAs :
(14) Additional mRNA sequences :
(167) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ADGRA2 Gene

No ASD Table

Relevant External Links for ADGRA2 Gene

GeneLoc Exon Structure for
ADGRA2
ECgene alternative splicing isoforms for
ADGRA2

Expression for ADGRA2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ADGRA2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ADGRA2 Gene

This gene is overexpressed in Placenta (13.2), Fetal gut (8.6), Heart (8.0), Fetal testis (6.9), and Prostate (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ADGRA2 Gene



Protein tissue co-expression partners for ADGRA2 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ADGRA2 Gene:

ADGRA2

mRNA Expression by UniProt/SwissProt for ADGRA2 Gene:

Q96PE1-AGRA2_HUMAN
Tissue specificity: Expressed in endothelial cells (at protein level) (PubMed:15021905, PubMed:16982628). Abundantly expressed in heart, placenta, ovary, small intestine, and colon (PubMed:15021905).

Evidence on tissue expression from TISSUES for ADGRA2 Gene

  • Nervous system(4.3)
  • Liver(4.2)
  • Spleen(4.2)
  • Heart(2)
genes like me logo Genes that share expression patterns with ADGRA2: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for ADGRA2 Gene

Orthologs for ADGRA2 Gene

This gene was present in the common ancestor of animals.

Orthologs for ADGRA2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GPR124 33 32
  • 99.45 (n)
OneToOne
dog
(Canis familiaris)
Mammalia GPR124 33 32
  • 88.97 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Gpr124 33 32
  • 84.4 (n)
OneToOne
Adgra2 17
rat
(Rattus norvegicus)
Mammalia LOC100363275 32
  • 84.16 (n)
oppossum
(Monodelphis domestica)
Mammalia GPR124 33
  • 80 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia GPR124 33
  • 66 (a)
OneToOne
cow
(Bos Taurus)
Mammalia GPR124 33
  • 50 (a)
OneToOne
chicken
(Gallus gallus)
Aves GPR124 33 32
  • 72.58 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia GPR124 33
  • 61 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia gpr124 32
  • 61.76 (n)
African clawed frog
(Xenopus laevis)
Amphibia MGC69043 32
zebrafish
(Danio rerio)
Actinopterygii gpr124 33 32
  • 60.01 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG15744 33
  • 15 (a)
OneToMany
Species where no ortholog for ADGRA2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ADGRA2 Gene

ENSEMBL:
Gene Tree for ADGRA2 (if available)
TreeFam:
Gene Tree for ADGRA2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ADGRA2: view image

Paralogs for ADGRA2 Gene

Variants for ADGRA2 Gene

Sequence variations from dbSNP and Humsavar for ADGRA2 Gene

SNP ID Clin Chr 08 pos Variation AA Info Type
rs1554525957 uncertain-significance, Ependymoma 37,833,705(+) CAATGCGCTGACCCTGGCTCA/CA coding_sequence_variant, frameshift
rs1000044150 -- 37,832,214(+) A/G intron_variant
rs1000048165 -- 37,837,693(+) C/G intron_variant
rs1000110508 -- 37,795,077(+) T/C upstream_transcript_variant
rs1000124614 -- 37,823,320(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ADGRA2 Gene

Variant ID Type Subtype PubMed ID
nsv397948 CNV deletion 16902084
nsv509261 CNV insertion 20534489
nsv528524 CNV loss 19592680
nsv528598 CNV loss 19592680
nsv951126 CNV deletion 24416366

Variation tolerance for ADGRA2 Gene

Residual Variation Intolerance Score: 21.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.53; 72.02% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ADGRA2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
ADGRA2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ADGRA2 Gene

Disorders for ADGRA2 Gene

Additional Disease Information for ADGRA2

No disorders were found for ADGRA2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ADGRA2 Gene

Publications for ADGRA2 Gene

  1. There exist at least 30 human G-protein-coupled receptors with long Ser/Thr-rich N-termini. (PMID: 12565841) Fredriksson R … Schiöth HB (Biochemical and biophysical research communications 2003) 2 3 4 56
  2. Cell surface tumor endothelial markers are conserved in mice and humans. (PMID: 11559528) Carson-Walter EB … St Croix B (Cancer research 2001) 2 3 4 56
  3. A molecular mechanism for Wnt ligand-specific signaling. (PMID: 30026314) Eubelen M … Vanhollebeke B (Science (New York, N.Y.) 2018) 3 4 56
  4. International Union of Basic and Clinical Pharmacology. XCIV. Adhesion G protein-coupled receptors. (PMID: 25713288) Hamann J … Schiöth HB (Pharmacological reviews 2015) 2 3 56
  5. Thrombin-induced shedding of tumour endothelial marker 5 and exposure of its RGD motif are regulated by cell-surface protein disulfide-isomerase. (PMID: 22013897) Vallon M … Essler M (The Biochemical journal 2012) 3 4 56

Products for ADGRA2 Gene

Sources for ADGRA2 Gene