This gene encodes a subunit of a tRNA-specific adenosine deaminase. This heterodimeric enzyme converts adenosine to inosine in the tRNA anticodon. A mutation in this gene causes a syndrome characterized by intellectual disability and strabismus. This gene shares its 5' exon with the overlapping gene, secretory carrier membrane protein 4 (Gene ID: 113178). [provided by RefSeq, J... See more...

Aliases for ADAT3 Gene

Aliases for ADAT3 Gene

  • Adenosine Deaminase TRNA Specific 3 2 3 5
  • Probable Inactive TRNA-Specific Adenosine Deaminase-Like Protein 3 3 4
  • TRNA-Specific Adenosine-34 Deaminase Subunit ADAT3 3 4
  • TAD3 3 4
  • Adenosine Deaminase, TRNA-Specific 3, TAD3 Homolog (S. Cerevisiae) 2
  • TRNA-Specific Adenosine Deaminase 3 Homolog (S. Cerevisiae) 2
  • Adenosine Deaminase, TRNA-Specific 3, TAD3 Homolog 3
  • MSTP121 3
  • FWP005 3
  • MST121 3
  • S863-5 3
  • MRT36 3

External Ids for ADAT3 Gene

Previous GeneCards Identifiers for ADAT3 Gene

  • GC19P001865
  • GC19P001677

Summaries for ADAT3 Gene

Entrez Gene Summary for ADAT3 Gene

  • This gene encodes a subunit of a tRNA-specific adenosine deaminase. This heterodimeric enzyme converts adenosine to inosine in the tRNA anticodon. A mutation in this gene causes a syndrome characterized by intellectual disability and strabismus. This gene shares its 5' exon with the overlapping gene, secretory carrier membrane protein 4 (Gene ID: 113178). [provided by RefSeq, Jul 2016]

GeneCards Summary for ADAT3 Gene

ADAT3 (Adenosine Deaminase TRNA Specific 3) is a Protein Coding gene. Diseases associated with ADAT3 include Mental Retardation, Autosomal Recessive 36 and Esotropia. Among its related pathways are tRNA processing and Gene Expression. Gene Ontology (GO) annotations related to this gene include hydrolase activity. An important paralog of this gene is ADAT2.

Additional gene information for ADAT3 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ADAT3 Gene

Genomics for ADAT3 Gene

GeneHancer (GH) Regulatory Elements for ADAT3 Gene

Promoters and enhancers for ADAT3 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ADAT3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ADAT3 gene promoter:
  • ATF
  • c-Myc
  • E47
  • Max
  • Max1
  • Olf-1
  • Pax-5
  • Tal-1
  • ZID

Genomic Locations for ADAT3 Gene

Genomic Locations for ADAT3 Gene
chr19:1,905,372-1,913,447
(GRCh38/hg38)
Size:
8,076 bases
Orientation:
Plus strand
chr19:1,905,377-1,913,446
(GRCh37/hg19)
Size:
8,070 bases
Orientation:
Plus strand

Genomic View for ADAT3 Gene

Genes around ADAT3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ADAT3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ADAT3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADAT3 Gene

Proteins for ADAT3 Gene

  • Protein details for ADAT3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96EY9-ADAT3_HUMAN
    Recommended name:
    Probable inactive tRNA-specific adenosine deaminase-like protein 3
    Protein Accession:
    Q96EY9

    Protein attributes for ADAT3 Gene

    Size:
    351 amino acids
    Molecular mass:
    38071 Da
    Cofactor:
    Name=Zn(2+); Xref=ChEBI:CHEBI:29105;
    Quaternary structure:
    No Data Available

neXtProt entry for ADAT3 Gene

Post-translational modifications for ADAT3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ADAT3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ADAT3 Gene

Domains & Families for ADAT3 Gene

Gene Families for ADAT3 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for ADAT3 Gene

Suggested Antigen Peptide Sequences for ADAT3 Gene

GenScript: Design optimal peptide antigens:
  • tRNA-specific adenosine-34 deaminase subunit ADAT3 (ADAT3_HUMAN)
  • MSTP121 (Q7Z2S3_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96EY9

UniProtKB/Swiss-Prot:

ADAT3_HUMAN :
  • Belongs to the cytidine and deoxycytidylate deaminase family. ADAT3 subfamily.
Family:
  • Belongs to the cytidine and deoxycytidylate deaminase family. ADAT3 subfamily.
genes like me logo Genes that share domains with ADAT3: view

Function for ADAT3 Gene

Phenotypes From GWAS Catalog for ADAT3 Gene

Gene Ontology (GO) - Molecular Function for ADAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0046872 metal ion binding IEA --
GO:0052717 tRNA-specific adenosine-34 deaminase activity IBA 21873635
genes like me logo Genes that share ontologies with ADAT3: view
genes like me logo Genes that share phenotypes with ADAT3: view

Human Phenotype Ontology for ADAT3 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for ADAT3 Gene

miRTarBase miRNAs that target ADAT3

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ADAT3 Gene

Localization for ADAT3 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ADAT3 gene
Compartment Confidence
nucleus 4
extracellular 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for ADAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm TAS --
GO:0052718 tRNA-specific adenosine-34 deaminase complex IBA 21873635
genes like me logo Genes that share ontologies with ADAT3: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for ADAT3 Gene

Pathways & Interactions for ADAT3 Gene

PathCards logo

SuperPathways for ADAT3 Gene

genes like me logo Genes that share pathways with ADAT3: view

Pathways by source for ADAT3 Gene

Gene Ontology (GO) - Biological Process for ADAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002100 tRNA wobble adenosine to inosine editing IBA 21873635
GO:0006400 tRNA modification TAS --
genes like me logo Genes that share ontologies with ADAT3: view

No data available for SIGNOR curated interactions for ADAT3 Gene

Drugs & Compounds for ADAT3 Gene

No Compound Related Data Available

Transcripts for ADAT3 Gene

mRNA/cDNA for ADAT3 Gene

(2) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(362) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ADAT3 Gene

No ASD Table

Relevant External Links for ADAT3 Gene

GeneLoc Exon Structure for
ADAT3
ECgene alternative splicing isoforms for
ADAT3

Expression for ADAT3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ADAT3 Gene

mRNA expression in normal human tissues for ADAT3 Gene

Protein differential expression in normal tissues from HIPED for ADAT3 Gene

This gene is overexpressed in Frontal cortex (50.0) and Fetal gut (15.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ADAT3 Gene



Protein tissue co-expression partners for ADAT3 Gene

NURSA nuclear receptor signaling pathways regulating expression of ADAT3 Gene:

ADAT3

Evidence on tissue expression from TISSUES for ADAT3 Gene

  • Skin(4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ADAT3 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cranial nerve
  • eye
  • head
  • skull
General:
  • peripheral nervous system
genes like me logo Genes that share expression patterns with ADAT3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for ADAT3 Gene

Orthologs for ADAT3 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for ADAT3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ADAT3 33 32
  • 99.73 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ADAT3 32
  • 82.04 (n)
rat
(Rattus norvegicus)
Mammalia Adat3 32
  • 80.56 (n)
mouse
(Mus musculus)
Mammalia Adat3 17 33 32
  • 79.79 (n)
oppossum
(Monodelphis domestica)
Mammalia ADAT3 33
  • 61 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ADAT3 33
  • 59 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ADAT3 33
  • 54 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii adat3 33 32
  • 55.34 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007066 32
  • 48.06 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG10927 33 32
  • 47.28 (n)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea Y47D3A.14 33
  • 28 (a)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes TAD3 35 33
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.909 33
  • 35 (a)
OneToOne
Species where no ortholog for ADAT3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for ADAT3 Gene

ENSEMBL:
Gene Tree for ADAT3 (if available)
TreeFam:
Gene Tree for ADAT3 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ADAT3: view image

Paralogs for ADAT3 Gene

Paralogs for ADAT3 Gene

genes like me logo Genes that share paralogs with ADAT3: view

Variants for ADAT3 Gene

Sequence variations from dbSNP and Humsavar for ADAT3 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs146212621 likely-benign, not specified, not provided 1,912,901(+) A/C/G coding_sequence_variant, missense_variant
rs200992550 benign, uncertain-significance, not specified, not provided 1,912,430(+) G/A/T coding_sequence_variant, missense_variant
rs730882213 pathogenic, Mental retardation, autosomal recessive 36, not provided 1,912,477(+) G/A coding_sequence_variant, missense_variant
rs746859902 pathogenic, Mental retardation, autosomal recessive 36 1,912,142(+) CCGGGAGCCCGG/CCGGGAGCCCGGGAGCCCGG coding_sequence_variant, frameshift
VAR_035804 A breast cancer sample p.Arg332Cys

Structural Variations from Database of Genomic Variants (DGV) for ADAT3 Gene

Variant ID Type Subtype PubMed ID
esv2717853 CNV deletion 23290073
esv32942 CNV gain+loss 17666407
esv3893156 CNV loss 25118596
nsv1160560 CNV deletion 26073780
nsv1160561 CNV deletion 26073780
nsv470107 CNV loss 18288195
nsv518629 CNV loss 19592680
nsv953942 CNV deletion 24416366

Variation tolerance for ADAT3 Gene

Gene Damage Index Score: 2.41; 42.59% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ADAT3 Gene

Human Gene Mutation Database (HGMD)
ADAT3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ADAT3

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ADAT3 Gene

Disorders for ADAT3 Gene

MalaCards: The human disease database

(3) MalaCards diseases for ADAT3 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, and GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal recessive 36
  • mrt36
esotropia
  • convergence in manifest squint
strabismus
  • strabismus, susceptibility to
- elite association - COSMIC cancer census association via MalaCards
Search ADAT3 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ADAT3_HUMAN
  • Mental retardation, autosomal recessive 36 (MRT36) [MIM:615286]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRT36 is often associated with esotropia and failure to thrive. Other more variable features included microcephaly, hypotonia, and mild brain abnormalities on MRI, such as dilated ventricles or delayed myelination. {ECO:0000269 PubMed:23620220}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ADAT3

genes like me logo Genes that share disorders with ADAT3: view

No data available for Genatlas for ADAT3 Gene

Publications for ADAT3 Gene

  1. Mutation in ADAT3, encoding adenosine deaminase acting on transfer RNA, causes intellectual disability and strabismus. (PMID: 23620220) Alazami AM … Alkuraya FS (Journal of medical genetics 2013) 3 4 56
  2. RNA editing by adenosine deaminases generates RNA and protein diversity. (PMID: 12457566) Schaub M … Keller W (Biochimie 2002) 2 3 56
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56
  4. ADAT3-related intellectual disability: Further delineation of the phenotype. (PMID: 26842963) El-Hattab AW … Alkuraya FS (American journal of medical genetics. Part A 2016) 3 56
  5. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 56

Products for ADAT3 Gene

Sources for ADAT3 Gene