Aliases for ACKR1 Gene
Aliases for ACKR1 Gene
- Atypical Chemokine Receptor 1 (Duffy Blood Group) 2 3 5
- Duffy Blood Group, Chemokine Receptor 2 3
- Atypical Chemokine Receptor 1 2 3
- Plasmodium Vivax Receptor 3 4
- Fy Glycoprotein 3 4
- Glycoprotein D 3 4
- DARC 3 4
- GpFy 3 4
- GPD 3 4
- FY 3 4
- Duffy Blood Group, Atypical Chemokine Receptor 2
- Duffy Antigen Chemokine Receptor 3
External Ids for ACKR1 Gene
- HGNC: 4035
- Entrez Gene: 2532
- Ensembl: ENSG00000213088
- OMIM: 613665
- UniProtKB: Q16570
Previous HGNC Symbols for ACKR1 Gene
- FY
- DARC
Summaries for ACKR1 Gene
-
The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
GeneCards Summary for ACKR1 Gene
ACKR1 (Atypical Chemokine Receptor 1 (Duffy Blood Group)) is a Protein Coding gene. Diseases associated with ACKR1 include White Blood Cell Count Quantitative Trait Locus 1 and Malaria. Among its related pathways are GPCRs, Other and Signaling by GPCR. Gene Ontology (GO) annotations related to this gene include G-protein coupled receptor activity and transmembrane signaling receptor activity.
UniProtKB/Swiss-Prot for ACKR1 Gene
-
Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Has a promiscuous chemokine-binding profile, interacting with inflammatory chemokines of both the CXC and the CC subfamilies but not with homeostatic chemokines. Acts as a receptor for chemokines including CCL2, CCL5, CCL7, CCL11, CCL13, CCL14, CCL17, CXCL5, CXCL6, IL8/CXCL8, CXCL11, GRO, RANTES, MCP-1, TARC and also for the malaria parasites P.vivax and P.knowlesi. May regulate chemokine bioavailability and, consequently, leukocyte recruitment through two distinct mechanisms: when expressed in endothelial cells, it sustains the abluminal to luminal transcytosis of tissue-derived chemokines and their subsequent presentation to circulating leukocytes; when expressed in erythrocytes, serves as blood reservoir of cognate chemokines but also as a chemokine sink, buffering potential surges in plasma chemokine levels.
Additional gene information for ACKR1 Gene
- Monarch Initiative
- Search for ACKR1 at DataMed
- Search for ACKR1 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ACKR1 Gene
Genomics for ACKR1 Gene
GeneHancer (GH) Regulatory Elements for ACKR1 Gene
Promoters and enhancers for ACKR1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around ACKR1 on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Locations for ACKR1 Gene
Genomic Locations for ACKR1 Gene
- chr1:159,203,307-159,206,500
- (GRCh38/hg38)
- Size:
- 3,194 bases
- Orientation:
- Plus strand
- chr1:159,173,097-159,176,290
- (GRCh37/hg19)
- Size:
- 3,194 bases
- Orientation:
- Plus strand
Genomic View for ACKR1 Gene
Genes around ACKR1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1q23.2 by Entrez Gene
- 1q23.2 by HGNC
- 1q23.2 by Ensembl
ACKR1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for ACKR1 Gene
Proteins for ACKR1 Gene
-
Protein details for ACKR1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q16570-ACKR1_HUMAN
- Recommended name:
- Atypical chemokine receptor 1
- Protein Accession:
- Q16570
- A8YPG5
- O75898
- Q16300
- Q8WWE3
- Q9UJP0
- Q9UKZ5
- Q9UKZ6
- Q9UQE1
Protein attributes for ACKR1 Gene
- Size:
- 336 amino acids
- Molecular mass:
- 35553 Da
- Quaternary structure:
- No Data Available
Protein Expression for ACKR1 Gene
Post-translational modifications for ACKR1 Gene
Other Protein References for ACKR1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for ACKR1 (DARC)
-
Custom Antibody ServicesOriGene Antibodies for ACKR1
- Novus Biologicals Antibodies for ACKR1
-
Abcam antibodies for ACKR1
- Invitrogen Antibodies for ACKR1
- GeneTex ACKR1 Antibody for ACKR1
-
Boster Bio Antibodies for ACKR1
-
Custom Antibody ServicesProSci Antibodies for ACKR1
Protein Products
-
OriGene Purified Proteins for ACKR1
- Search Origene for MassSpec and Protein Over-expression Lysates for ACKR1
- Origene Custom Protein Services for ACKR1
- Search GeneTex for Proteins for ACKR1
-
Abcam proteins for ACKR1
Assay Products
- antibodies-online: Search results for 4 available DARC Elisa Kits ranked by validation data
- Compare Top DARC Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for ACKR1 Gene
Domains & Families for ACKR1 Gene
Gene Families for ACKR1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Blood group antigen proteins
- CD markers
- G-protein coupled receptors
- Predicted membrane proteins
Protein Domains for ACKR1 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for ACKR1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q16570UniProtKB/Swiss-Prot:
ACKR1_HUMAN :- Belongs to the G-protein coupled receptor 1 family. Atypical chemokine receptor subfamily.
- Family:
-
- Belongs to the G-protein coupled receptor 1 family. Atypical chemokine receptor subfamily.
Function for ACKR1 Gene
Molecular function for ACKR1 Gene
- UniProtKB/Swiss-Prot Function:
- Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Has a promiscuous chemokine-binding profile, interacting with inflammatory chemokines of both the CXC and the CC subfamilies but not with homeostatic chemokines. Acts as a receptor for chemokines including CCL2, CCL5, CCL7, CCL11, CCL13, CCL14, CCL17, CXCL5, CXCL6, IL8/CXCL8, CXCL11, GRO, RANTES, MCP-1, TARC and also for the malaria parasites P.vivax and P.knowlesi. May regulate chemokine bioavailability and, consequently, leukocyte recruitment through two distinct mechanisms: when expressed in endothelial cells, it sustains the abluminal to luminal transcytosis of tissue-derived chemokines and their subsequent presentation to circulating leukocytes; when expressed in erythrocytes, serves as blood reservoir of cognate chemokines but also as a chemokine sink, buffering potential surges in plasma chemokine levels.
Phenotypes From GWAS Catalog for ACKR1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004888 | transmembrane signaling receptor activity | TAS | 9058825 |
| GO:0004930 | G-protein coupled receptor activity | IEA | -- |
| GO:0019956 | chemokine binding | IEA | -- |
| GO:0019957 | C-C chemokine binding | IPI | 7517217 |
| GO:0038023 | signaling receptor activity | TAS | 7689250 |
Phenotypes for ACKR1 Gene
- MGI mutant phenotypes for ACKR1:
- inferred from 3 alleles
- GenomeRNAi human phenotypes for ACKR1:
-
- Dynamic nuclei (hole, folded or small irregular)
- Negative genetic interaction between PTTG1-/- and PTTG1+/+
- Decreased viability in esophageal squamous lineage
- Decreased viability
- no effect
- Increased vaccinia virus (VACV) infection
- Decreased viability after Maraba virus infection
- Increased transferrin (TF) endocytosis
Animal Models for ACKR1 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ACKR1
-
CRISPR Products
-
OriGene CRISPR knockouts for ACKR1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ACKR1
- genomics-online: gRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- Applied Biological Materials CRISPR for ACKR1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ACKR1
- GenScript: Design CRISPR guide RNA sequences for ACKR1
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ACKR1
- Browse OriGene Inhibitory RNA Products For ACKR1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ACKR1
- genomics-online: shRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
Clone Products
- Sino Biological Human cDNA Clone for ACKR1
- VectorBuilder custom plasmid, inducible vectors for ACKR1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ACKR1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for ACKR1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ACKR1
- Applied Biological Materials Clones for ACKR1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for ACKR1 (DARC)
Cell Line Products
-
Horizon Cell Lines for ACKR1
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for ACKR1 Gene
Localization for ACKR1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for ACKR1 Gene
- Early endosome. Recycling endosome. Membrane; Multi-pass membrane protein. Note=Predominantly localizes to endocytic vesicles, and upon stimulation by the ligand is internalized via caveolae. Once internalized, the ligand dissociates from the receptor, and is targeted to degradation while the receptor is recycled back to the cell membrane.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| endosome | 5 |
| extracellular | 1 |
| cytoskeleton | 1 |
| nucleus | 1 |
| cytosol | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005768 | endosome | IEA | -- |
| GO:0005769 | early endosome | IEA | -- |
| GO:0005886 | plasma membrane | TAS | -- |
| GO:0016020 | membrane | IEA | -- |
| GO:0016021 | integral component of membrane | IEA | -- |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for ACKR1 Gene
Pathways & Interactions for ACKR1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Peptide ligand-binding receptors |
.34
|
|
| 2 | Signaling by GPCR | ||
| 3 | Malaria |
-
|
|
| 4 | Chemokine Superfamily Pathway: Human/Mouse Ligand-Receptor Interactions | ||
| 5 | GPCRs, Other | ||
Pathways by source for ACKR1 Gene
2 BioSystems pathways for ACKR1 Gene
5 Reactome pathways for ACKR1 Gene
1 KEGG pathway for ACKR1 Gene
1 R&D Systems pathway for ACKR1 Gene
Interacting Proteins for ACKR1 Gene
Selected Interacting proteins:
Q16570-ACKR1_HUMAN
ENSP00000357103
for ACKR1 Gene via
IID
STRING
UniProtKB
GPS-Prot Interaction Network for ACKR1
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006952 | defense response | NAS | 10570183 |
| GO:0006954 | inflammatory response | IBA | -- |
| GO:0007165 | signal transduction | IEA | -- |
| GO:0007186 | G-protein coupled receptor signaling pathway | IEA | -- |
| GO:0032642 | regulation of chemokine production | IBA | -- |
No data available for SIGNOR curated interactions for ACKR1 Gene
Transcripts for ACKR1 Gene
mRNA/cDNA for ACKR1 Gene
- (2) REFSEQ mRNAs :
- (264) Selected AceView cDNA sequences:
- (4) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000368122 2008 bps (uc001fto.4)
- ENST00000435307 550 bps (uc057mgx.1)
- ENST00000368121 1242 bps (uc001ftp.5)
- ENST00000537147 1902 bps (uc057mgw.1)
CRISPR Products
-
OriGene CRISPR knockouts for ACKR1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ACKR1
- genomics-online: gRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- Applied Biological Materials CRISPR for ACKR1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ACKR1
- GenScript: Design CRISPR guide RNA sequences for ACKR1
miRNA Products
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ACKR1
- Browse OriGene Inhibitory RNA Products For ACKR1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ACKR1
- genomics-online: shRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
Clone Products
- Sino Biological Human cDNA Clone for ACKR1
- VectorBuilder custom plasmid, inducible vectors for ACKR1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ACKR1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for ACKR1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ACKR1
- Applied Biological Materials Clones for ACKR1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for ACKR1 (DARC)
Expression for ACKR1 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Blood (Hematopoietic System)
- Proerythroblasts Hematopoietic Bone Marrow
- Erythroblasts Hematopoietic Bone Marrow
-
Eye (Sensory Organs)
- GABAergic Amacrine Cells Inner Nuclear Layer
-
Neurons
- GABAergic Amacrine Cells Inner Nuclear Layer
- Neural Tube (Nervous System)
-
Ovary (Reproductive System)
This gene is overexpressed in Lung (60.1).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ACKR1 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of ACKR1 Gene:
ACKR1mRNA Expression by UniProt/SwissProt for ACKR1 Gene:
Q16570-ACKR1_HUMAN
Tissue specificity:
Found in adult kidney, adult spleen, bone marrow and fetal liver. In particular, it is expressed along postcapillary venules throughout the body, except in the adult liver. Erythroid cells and postcapillary venule endothelium are the principle tissues expressing duffy. Fy(-A-B) individuals do not express duffy in the bone marrow, however they do, in postcapillary venule endothelium.
Evidence on tissue expression from TISSUES for ACKR1 Gene
- Blood(4.5)
- Lung(4.4)
- Bone marrow(4.3)
- Nervous system(3.2)
- Spleen(2.7)
- Lymph node(2.6)
- Heart(2.3)
- Skin(2.3)
Primer Products
-
OriGene qPCR primer pairs and template standards for ACKR1
-
OriGene qPCR primer pairs for ACKR1
- genomics-online: primer clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for ACKR1 Gene
Orthologs for ACKR1 Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | DARC 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | DARC 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | DARC 34 33 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Darc 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Darc 34 33 |
|
OneToOne | |
| Ackr1 16 |
|
||||
| chicken (Gallus gallus) |
Aves | DARC 34 |
|
OneToOne |
- Species where no ortholog for ACKR1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- lizard (Anolis carolinensis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
- zebrafish (Danio rerio)
Evolution for ACKR1 Gene
- ENSEMBL:
- Gene Tree for ACKR1 (if available)
- TreeFam:
- Gene Tree for ACKR1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for ACKR1: view image
Paralogs for ACKR1 Gene
No data available for Paralogs for ACKR1 Gene
Variants for ACKR1 Gene
Polymorphic Variants from UniProtKB/Swiss-Prot for ACKR1 Gene
- ACKR1_HUMAN-Q16570
- DARC is responsible for the Duffy blood group system (FY) [MIM:110700]. The molecular basis of the Fy(A)=Fy1/Fy(B)=Fy2 blood group antigens is a single variation in position 42; Gly-42 corresponds to Fy(A) and Asp-42 to Fy(B). Individuals that do not produce the Duffy antigen (FY(A-B-)) are more resistant to infection by the malarial parasite Plasmodium vivax. This allele is found predominantly in population of African origin [MIM:611162].
- ACKR1_HUMAN-Q16570
- Genetic variations in DARC define the white blood cell count quantitative trait locus 1 (WBCQ1) [MIM:611862]. Peripheral white blood cell count (WBC) is a common clinical measurement, used to determine evidence of acute inflammation or infection. Peripheral WBC is the sum of several cell types including neutrophils and lymphocytes, which are the most common types of WBC, as well as less common cell types such as eosinophils, basophils, and monocytes. Elevated WBC has been associated with risk of coronary heart disease, cancer, and all-cause mortality. White blood cell levels have widespread clinical applications including assessment of patients undergoing chemotherapy and evaluation of infection.
| SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs12075 | benign, DUFFY BLOOD GROUP SYSTEM, FYA/FYB POLYMORPHISM | 159,205,564(+) | G/A | coding_sequence_variant, missense_variant | |
| rs2814778 | pathogenic, protective, association, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE, Plasmodium vivax, resistance to, White blood cell count quantitative trait locus 1 | 159,204,893(+) | T/C | 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant | |
| rs34599082 | pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(bwk) PHENOTYPE | 159,205,704(+) | C/T | coding_sequence_variant, missense_variant | |
| rs587776507 | pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE | 159,205,719(+) | CCTGGCTGGCCTGTCCTGGC/CCTGGC | coding_sequence_variant, frameshift | |
| rs1000157237 | -- | 159,203,016(+) | T/G | upstream_transcript_variant |
Residual Variation Intolerance Score:
32.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
4.09;
61.05% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for ACKR1 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Structural Variations from Database of Genomic Variants (DGV) for ACKR1 Gene
Disorders for ACKR1 Gene
(19) MalaCards diseases for ACKR1 Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| white blood cell count quantitative trait locus 1 |
|
|
| malaria |
|
|
| plasmodium vivax malaria |
|
|
| genital herpes |
|
|
| neonatal herpes |
|
|
Search ACKR1 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for ACKR1
No data available for UniProtKB/Swiss-Prot and Genatlas for ACKR1 Gene
Publications for ACKR1 Gene
- Cloning of glycoprotein D cDNA, which encodes the major subunit of the Duffy blood group system and the receptor for the Plasmodium vivax malaria parasite. (PMID: 8248172) Chaudhuri A … Pogo AO (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 22 58
- Structure-function analysis of the extracellular domains of the Duffy antigen/receptor for chemokines: characterization of antibody and chemokine binding sites. (PMID: 12956774) Tournamille C … Le Van Kim C (British journal of haematology 2003) 3 4 22 58
- Arg89Cys substitution results in very low membrane expression of the Duffy antigen/receptor for chemokines in Fy(x) individuals. (PMID: 9731074) Tournamille C … Colin Y (Blood 1998) 3 4 22 58
- Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy-negative individuals. (PMID: 7663520) Tournamille C … Le Van Kim C (Nature genetics 1995) 2 3 4 58
- Genomic organization of the glycoprotein D gene: Duffy blood group Fya/Fyb alloantigen system is associated with a polymorphism at the 44-amino acid residue. (PMID: 7833467) Iwamoto S … Ikemoto S (Blood 1995) 3 4 22 58
Products for ACKR1 Gene
- R&D Systems Antibodies for ACKR1 (DARC)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- R&D Systems cDNA Clones for ACKR1 (DARC)
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for ACKR1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for ACKR1
- Search Origene for MassSpec and Protein Over-expression Lysates for ACKR1
- Origene Custom Protein Services for ACKR1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ACKR1
- Browse OriGene Inhibitory RNA Products For ACKR1
- OriGene qPCR primer pairs and template standards for ACKR1
- OriGene qPCR primer pairs for ACKR1
- OriGene CRISPR knockouts for ACKR1
- OriGene ORF clones in human for ACKR1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ACKR1
- GenScript: Next-day shipping of latest version cDNA ORF clones for ACKR1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for ACKR1
- GenScript Custom Assay Services for ACKR1
- GenScript Custom overexpressing Cell Line Services for ACKR1
- GenScript: Design CRISPR guide RNA sequences for ACKR1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ACKR1
- Sino Biological Human cDNA Clone for ACKR1
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for ACKR1
- Novus Biologicals proteins and lysates for ACKR1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for ACKR1
- Abcam proteins for ACKR1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Cyagen custom Knockout/knockin (KOKI) mouse models for ACKR1
- VectorBuilder custom plasmid, inducible vectors for ACKR1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ACKR1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for ACKR1
- antibodies-online: Search results for 140 available DARC Antibodies ranked by validation data
- Compare Top DARC Antibodies
- antibodies-online: Search results for 4 available DARC Elisa Kits ranked by validation data
- Compare Top DARC Elisa Kits
- Quality Products:
- antibodies-online: Search results for 8 available DARC Proteins ranked by validation data
- Compare Top DARC Proteins
- Quality Products:
- genomics-online: cdna clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- orf clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- genomics-online: gRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- genomics-online: primer clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- genomics-online: shRNA clones - Search results for 77 available DARC gene related products
- Overview of 77 available DARC gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for ACKR1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for ACKR1
- GeneCopoeia miRNA 3'UTR Target clone products for ACKR1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ACKR1
- Boster Bio Antibodies for ACKR1
- Browse Boster Bio ELISA Kits
Sources for ACKR1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt