Free for academic non-profit institutions. Other users need a Commercial license

ACKR1 Gene(Protein Coding)

Atypical Chemokine Receptor 1 (Duffy Blood Group)

GCID:
GC01P159203
GIFtS:
44
Genes Participants
UDN Logo

Aliases for ACKR1 Gene

Aliases for ACKR1 Gene

  • Atypical Chemokine Receptor 1 (Duffy Blood Group) 2 3 5
  • Duffy Blood Group, Chemokine Receptor 2 3
  • Atypical Chemokine Receptor 1 2 3
  • Plasmodium Vivax Receptor 3 4
  • Fy Glycoprotein 3 4
  • Glycoprotein D 3 4
  • DARC 3 4
  • GpFy 3 4
  • GPD 3 4
  • FY 3 4
  • Duffy Blood Group, Atypical Chemokine Receptor 2
  • Duffy Antigen Chemokine Receptor 3
  • Duffy Blood Group System Protein 3
  • Duffy Antigen/Chemokine Receptor 4
  • Duffy Blood Group Antigen 3
  • Duffy Blood Group 2
  • CD234 Antigen 4
  • DARC/ACKR1 3
  • CCBP1 3
  • CD234 3
  • WBCQ1 3
  • Dfy 3

External Ids for ACKR1 Gene

Previous HGNC Symbols for ACKR1 Gene

  • FY
  • DARC

Summaries for ACKR1 Gene

Entrez Gene Summary for ACKR1 Gene

  • The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for ACKR1 Gene

ACKR1 (Atypical Chemokine Receptor 1 (Duffy Blood Group)) is a Protein Coding gene. Diseases associated with ACKR1 include White Blood Cell Count Quantitative Trait Locus 1 and Malaria. Among its related pathways are Peptide ligand-binding receptors and Signaling by GPCR. Gene Ontology (GO) annotations related to this gene include G-protein coupled receptor activity and transmembrane signaling receptor activity.

UniProtKB/Swiss-Prot for ACKR1 Gene

  • Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Has a promiscuous chemokine-binding profile, interacting with inflammatory chemokines of both the CXC and the CC subfamilies but not with homeostatic chemokines. Acts as a receptor for chemokines including CCL2, CCL5, CCL7, CCL11, CCL13, CCL14, CCL17, CXCL5, CXCL6, IL8/CXCL8, CXCL11, GRO, RANTES, MCP-1, TARC and also for the malaria parasites P.vivax and P.knowlesi. May regulate chemokine bioavailability and, consequently, leukocyte recruitment through two distinct mechanisms: when expressed in endothelial cells, it sustains the abluminal to luminal transcytosis of tissue-derived chemokines and their subsequent presentation to circulating leukocytes; when expressed in erythrocytes, serves as blood reservoir of cognate chemokines but also as a chemokine sink, buffering potential surges in plasma chemokine levels.

Gene Wiki entry for ACKR1 Gene

Additional gene information for ACKR1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ACKR1 Gene

Genomics for ACKR1 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for ACKR1 Gene

Promoters and enhancers for ACKR1 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH01I159206 Promoter 1 EPDnew 550.8 +1.5 1549 0.1 MEIS2 NFRKB TEAD4 TAL1 TCF12 NCOR1 POLR2A VEZF1 CBFA2T2 PRDM10 ACKR1 CADM3-AS1
GH01I159204 Promoter 0.8 EPDnew 550.8 +0.9 879 0.1 POLR2A NCOR1 KDM1A MGA ACKR1 CADM3-AS1
GH01I159205 Promoter 0.8 EPDnew 550.8 +1.9 1886 0.1 FOXK2 NFRKB IKZF1 NR2C1 PRDM10 MCM2 ACKR1 CADM3-AS1
GH01I160187 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE dbSUPER 10.1 +987.5 987470 6.7 HDGF ARNT ARID4B SIN3A DMAP1 ZNF2 IRF4 ZNF143 ZNF548 KLF13 CASQ1 USP21 LOC100287049 PPOX LOC729867 NCSTN SNHG28 RPSAP18 SLAMF8 B4GALT3
GH01I159004 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 6.3 -192.2 -192235 12.6 HDGF PKNOX1 ATF1 SMAD1 IRF4 YY1 TCF12 ZNF766 ZNF207 ATF7 IFI16 OR6N2 CADM3-AS1 RAD1P2 ACKR1 AIM2 PYHIN1 GC01M159011
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ACKR1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for ACKR1 Gene

Genomic Locations for ACKR1 Gene
chr1:159,203,307-159,206,500
(GRCh38/hg38)
Size:
3,194 bases
Orientation:
Plus strand
chr1:159,173,097-159,176,290
(GRCh37/hg19)

Genomic View for ACKR1 Gene

Genes around ACKR1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ACKR1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ACKR1 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for ACKR1 Gene

Proteins for ACKR1 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for ACKR1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q16570-ACKR1_HUMAN
    Recommended name:
    Atypical chemokine receptor 1
    Protein Accession:
    Q16570
    Secondary Accessions:
    • A8YPG5
    • O75898
    • Q16300
    • Q8WWE3
    • Q9UJP0
    • Q9UKZ5
    • Q9UKZ6
    • Q9UQE1

    Protein attributes for ACKR1 Gene

    Size:
    336 amino acids
    Molecular mass:
    35553 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for ACKR1 Gene

    Alternative splice isoforms for ACKR1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ACKR1 Gene

Protein Expression for ACKR1 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for ACKR1 Gene

  • Glycosylation at Asn16 and Asn33
  • Modification sites at PhosphoSitePlus

Other Protein References for ACKR1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ACKR1 Gene

Domains & Families for ACKR1 Gene

Gene Families for ACKR1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Blood group antigen proteins
  • CD markers
  • G-protein coupled receptors
  • Predicted membrane proteins

Protein Domains for ACKR1 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for ACKR1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q16570

UniProtKB/Swiss-Prot:

ACKR1_HUMAN :
  • Belongs to the G-protein coupled receptor 1 family. Atypical chemokine receptor subfamily.
Family:
  • Belongs to the G-protein coupled receptor 1 family. Atypical chemokine receptor subfamily.
genes like me logo Genes that share domains with ACKR1: view

Function for ACKR1 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for ACKR1 Gene

UniProtKB/Swiss-Prot Function:
Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Has a promiscuous chemokine-binding profile, interacting with inflammatory chemokines of both the CXC and the CC subfamilies but not with homeostatic chemokines. Acts as a receptor for chemokines including CCL2, CCL5, CCL7, CCL11, CCL13, CCL14, CCL17, CXCL5, CXCL6, IL8/CXCL8, CXCL11, GRO, RANTES, MCP-1, TARC and also for the malaria parasites P.vivax and P.knowlesi. May regulate chemokine bioavailability and, consequently, leukocyte recruitment through two distinct mechanisms: when expressed in endothelial cells, it sustains the abluminal to luminal transcytosis of tissue-derived chemokines and their subsequent presentation to circulating leukocytes; when expressed in erythrocytes, serves as blood reservoir of cognate chemokines but also as a chemokine sink, buffering potential surges in plasma chemokine levels.

Phenotypes From GWAS Catalog for ACKR1 Gene

Gene Ontology (GO) - Molecular Function for ACKR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004872 receptor activity TAS 7689250
GO:0004888 transmembrane signaling receptor activity TAS 9058825
GO:0004930 G-protein coupled receptor activity IEA --
GO:0019956 chemokine binding IEA --
GO:0019957 C-C chemokine binding IPI 7517217
genes like me logo Genes that share ontologies with ACKR1: view
genes like me logo Genes that share phenotypes with ACKR1: view

Animal Models for ACKR1 Gene

MGI Knock Outs for ACKR1:

Animal Model Products

Clone Products

  • Addgene plasmids for ACKR1

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for ACKR1 Gene

Localization for ACKR1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ACKR1 Gene

Early endosome. Recycling endosome. Membrane; Multi-pass membrane protein. Note=Predominantly localizes to endocytic vesicles, and upon stimulation by the ligand is internalized via caveolae. Once internalized, the ligand dissociates from the receptor, and is targeted to degradation while the receptor is recycled back to the cell membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ACKR1 gene
Compartment Confidence
plasma membrane 5
endosome 5
extracellular 1
cytoskeleton 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for ACKR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005768 endosome IEA --
GO:0005769 early endosome IEA --
GO:0005886 plasma membrane TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with ACKR1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ACKR1 Gene

Pathways & Interactions for ACKR1 Gene

genes like me logo Genes that share pathways with ACKR1: view

Pathways by source for ACKR1 Gene

2 BioSystems pathways for ACKR1 Gene
1 KEGG pathway for ACKR1 Gene

Gene Ontology (GO) - Biological Process for ACKR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006952 defense response NAS 10570183
GO:0006954 inflammatory response IBA --
GO:0007165 signal transduction IEA --
GO:0007186 G-protein coupled receptor signaling pathway IEA --
GO:0032642 regulation of chemokine production IBA --
genes like me logo Genes that share ontologies with ACKR1: view

No data available for SIGNOR curated interactions for ACKR1 Gene

Drugs & Compounds for ACKR1 Gene

Products:

  1. Drug

(5) Drugs for ACKR1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for ACKR1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ACKR1: view

Transcripts for ACKR1 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for ACKR1 Gene

(2) REFSEQ mRNAs :
(264) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

  • Addgene plasmids for ACKR1

Alternative Splicing Database (ASD) splice patterns (SP) for ACKR1 Gene

No ASD Table

Relevant External Links for ACKR1 Gene

GeneLoc Exon Structure for
ACKR1
ECgene alternative splicing isoforms for
ACKR1

Expression for ACKR1 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ACKR1 Gene

mRNA expression in normal human tissues for ACKR1 Gene
mRNA expression by GTEx for ACKR1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ACKR1 Gene

This gene is overexpressed in Lung (60.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ACKR1 Gene



Protein tissue co-expression partners for ACKR1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ACKR1 Gene:

ACKR1

mRNA Expression by UniProt/SwissProt for ACKR1 Gene:

Q16570-ACKR1_HUMAN
Tissue specificity: Found in adult kidney, adult spleen, bone marrow and fetal liver. In particular, it is expressed along postcapillary venules throughout the body, except in the adult liver. Erythroid cells and postcapillary venule endothelium are the principle tissues expressing duffy. Fy(-A-B) individuals do not express duffy in the bone marrow, however they do, in postcapillary venule endothelium.

Evidence on tissue expression from TISSUES for ACKR1 Gene

  • Blood(4.5)
  • Lung(4.4)
  • Bone marrow(4.3)
  • Nervous system(3.1)
  • Spleen(2.7)
  • Lymph node(2.6)
  • Heart(2.3)
  • Skin(2.3)
genes like me logo Genes that share expression patterns with ACKR1: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for ACKR1 Gene

Orthologs for ACKR1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for ACKR1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia DARC 34 33
  • 99.4 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia DARC 34 33
  • 75.66 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia DARC 34 33
  • 74.14 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Darc 33
  • 72.61 (n)
mouse
(Mus musculus)
 Mammalia Darc 34 33
  • 71.07 (n)
 OneToOne
Ackr1 16
chicken
(Gallus gallus)
 Aves DARC 34
  • 29 (a)
 OneToOne
Species where no ortholog for ACKR1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for ACKR1 Gene

ENSEMBL:
Gene Tree for ACKR1 (if available)
TreeFam:
Gene Tree for ACKR1 (if available)

Paralogs for ACKR1 Gene

No data available for Paralogs for ACKR1 Gene

Variants for ACKR1 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Polymorphic Variants from UniProtKB/Swiss-Prot for ACKR1 Gene

ACKR1_HUMAN-Q16570
DARC is responsible for the Duffy blood group system (FY) [MIM:110700]. The molecular basis of the Fy(A)=Fy1/Fy(B)=Fy2 blood group antigens is a single variation in position 42; Gly-42 corresponds to Fy(A) and Asp-42 to Fy(B). Individuals that do not produce the Duffy antigen (FY(A-B-)) are more resistant to infection by the malarial parasite Plasmodium vivax. This allele is found predominantly in population of African origin [MIM:611162].
ACKR1_HUMAN-Q16570
Genetic variations in DARC define the white blood cell count quantitative trait locus 1 (WBCQ1) [MIM:611862]. Peripheral white blood cell count (WBC) is a common clinical measurement, used to determine evidence of acute inflammation or infection. Peripheral WBC is the sum of several cell types including neutrophils and lymphocytes, which are the most common types of WBC, as well as less common cell types such as eosinophils, basophils, and monocytes. Elevated WBC has been associated with risk of coronary heart disease, cancer, and all-cause mortality. White blood cell levels have widespread clinical applications including assessment of patients undergoing chemotherapy and evaluation of infection.

Sequence variations from dbSNP and Humsavar for ACKR1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs12075 benign, DUFFY BLOOD GROUP SYSTEM, FYA/FYB POLYMORPHISM 159,205,564(+) G/A coding_sequence_variant, missense_variant
rs2814778 pathogenic, protective, association, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE, Plasmodium vivax, resistance to, White blood cell count quantitative trait locus 1 159,204,893(+) T/C 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs34599082 pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(bwk) PHENOTYPE 159,205,704(+) C/T coding_sequence_variant, missense_variant
rs587776507 pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE 159,205,719(+) CCTGGCTGGCCTGTCCTGGC/CCTGGC coding_sequence_variant, frameshift
rs1000157237 -- 159,203,016(+) T/G upstream_transcript_variant

Variation tolerance for ACKR1 Gene

Residual Variation Intolerance Score: 32.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.09; 61.05% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ACKR1 Gene

Human Gene Mutation Database (HGMD)
ACKR1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ACKR1

SNP Genotyping and Copy Number Assay Products

No data available for Structural Variations from Database of Genomic Variants (DGV) for ACKR1 Gene

Disorders for ACKR1 Gene

MalaCards: The human disease database

(17) MalaCards diseases for ACKR1 Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
white blood cell count quantitative trait locus 1
  • wbcq1
malaria
  • malaria, susceptibility to
plasmodium vivax malaria
  • malaria by plasmodium vivax
genital herpes
  • genital herpes simplex
neonatal herpes
  • congenital herpes simplex
- elite association - COSMIC cancer census association via MalaCards
Search ACKR1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for ACKR1

ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ACKR1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ACKR1 Gene

Publications for ACKR1 Gene

  1. Cloning of glycoprotein D cDNA, which encodes the major subunit of the Duffy blood group system and the receptor for the Plasmodium vivax malaria parasite. (PMID: 8248172) Chaudhuri A … Pogo AO (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 22 58
  2. Structure-function analysis of the extracellular domains of the Duffy antigen/receptor for chemokines: characterization of antibody and chemokine binding sites. (PMID: 12956774) Tournamille C … Le Van Kim C (British journal of haematology 2003) 3 4 22 58
  3. Arg89Cys substitution results in very low membrane expression of the Duffy antigen/receptor for chemokines in Fy(x) individuals. (PMID: 9731074) Tournamille C … Colin Y (Blood 1998) 3 4 22 58
  4. Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy-negative individuals. (PMID: 7663520) Tournamille C … Le Van Kim C (Nature genetics 1995) 2 3 4 58
  5. Genomic organization of the glycoprotein D gene: Duffy blood group Fya/Fyb alloantigen system is associated with a polymorphism at the 44-amino acid residue. (PMID: 7833467) Iwamoto S … Ikemoto S (Blood 1995) 3 4 22 58

Products for ACKR1 Gene

  • Addgene plasmids for ACKR1

Sources for ACKR1 Gene

Content
Loading form....