Free for academic non-profit institutions. Other users need a Commercial license
The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
ACKR1 (Atypical Chemokine Receptor 1 (Duffy Blood Group)) is a Protein Coding gene. Diseases associated with ACKR1 include White Blood Cell Count Quantitative Trait Locus 1 and Malaria. Among its related pathways are GPCRs, Other and Peptide ligand-binding receptors. Gene Ontology (GO) annotations related to this gene include G protein-coupled receptor activity and transmembrane signaling receptor activity.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0004888 | transmembrane signaling receptor activity | TAS | 9058825 |
GO:0004930 | G protein-coupled receptor activity | IEA | -- |
GO:0019956 | chemokine binding | IEA | -- |
GO:0019957 | C-C chemokine binding | IPI | 7517217 |
GO:0038023 | signaling receptor activity | TAS | 7689250 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005768 | endosome | IEA | -- |
GO:0005769 | early endosome | IEA | -- |
GO:0005886 | plasma membrane | TAS | -- |
GO:0016020 | membrane | IEA | -- |
GO:0016021 | integral component of membrane | IEA | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Peptide ligand-binding receptors |
.34
|
|
2 | Signaling by GPCR | ||
3 | Malaria |
-
|
|
4 | Chemokine Superfamily Pathway: Human/Mouse Ligand-Receptor Interactions | ||
5 | GPCRs, Other |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0006952 | defense response | NAS | 10570183 |
GO:0006954 | inflammatory response | IBA | 21873635 |
GO:0007165 | signal transduction | IEA | -- |
GO:0007186 | G protein-coupled receptor signaling pathway | IEA | -- |
GO:0032642 | regulation of chemokine production | IBA | 21873635 |
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
---|
This gene was present in the common ancestor of chordates.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | DARC 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | DARC 33 32 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | DARC 33 32 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Darc 32 |
|
||
mouse (Mus musculus) |
Mammalia | Darc 33 32 |
|
OneToOne | |
Ackr1 17 |
|
||||
chicken (Gallus gallus) |
Aves | DARC 33 |
|
OneToOne |
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs12075 | benign, DUFFY BLOOD GROUP SYSTEM, FYA/FYB POLYMORPHISM, - | 159,205,564(+) | G/A | coding_sequence_variant, missense_variant | |
rs2814778 | pathogenic, protective, association, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE, Plasmodium vivax, resistance to, White blood cell count quantitative trait locus 1 | 159,204,893(+) | T/C | 5_prime_UTR_variant | |
rs34599082 | pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(bwk) PHENOTYPE, - | 159,205,704(+) | C/T | coding_sequence_variant, missense_variant | |
rs587776507 | pathogenic, DUFFY BLOOD GROUP SYSTEM, FY(a-b-) PHENOTYPE | 159,205,719(+) | CCTGGCTGGCCTGTCCTGGC/CCTGGC | coding_sequence_variant, frameshift | |
rs1000157237 | -- | 159,203,016(+) | T/G | upstream_transcript_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
white blood cell count quantitative trait locus 1 |
|
|
malaria |
|
|
plasmodium vivax malaria |
|
|
genital herpes |
|
|
neonatal herpes |
|
|