This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008] See more...

Aliases for ACAA1 Gene

Aliases for ACAA1 Gene

  • Acetyl-CoA Acyltransferase 1 2 3 5
  • Peroxisomal 3-Oxoacyl-Coenzyme A Thiolase 2 3
  • 3-Ketoacyl-CoA Thiolase, Peroxisomal 3 4
  • Acetyl-Coenzyme A Acyltransferase 1 2 3
  • Peroxisomal 3-Oxoacyl-CoA Thiolase 3 4
  • Beta-Ketothiolase 3 4
  • EC 2.3.1.16 4 54
  • PTHIO 3 4
  • ACAA 3 4
  • Epididymis Secretory Sperm Binding Protein 3
  • Testicular Tissue Protein Li 197 3
  • Acetyl-CoA Acyltransferase 4
  • EC 2.3.1 54
  • THIO 3

External Ids for ACAA1 Gene

Previous GeneCards Identifiers for ACAA1 Gene

  • GC03M037452
  • GC03M037977
  • GC03M038124
  • GC03M038139
  • GC03M038164

Summaries for ACAA1 Gene

Entrez Gene Summary for ACAA1 Gene

  • This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

GeneCards Summary for ACAA1 Gene

ACAA1 (Acetyl-CoA Acyltransferase 1) is a Protein Coding gene. Diseases associated with ACAA1 include Arachnoiditis and Chondrodysplasia Punctata Syndrome. Among its related pathways are Peroxisomal lipid metabolism and alpha-linolenic acid (ALA) metabolism. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring acyl groups other than amino-acyl groups and palmitoyl-CoA oxidase activity. An important paralog of this gene is ACAT2.

Gene Wiki entry for ACAA1 Gene

Additional gene information for ACAA1 Gene

No data available for CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ACAA1 Gene

Genomics for ACAA1 Gene

GeneHancer (GH) Regulatory Elements for ACAA1 Gene

Promoters and enhancers for ACAA1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J038129 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas dbSUPER 760.8 +2.4 2382 11.5 SP1 ZBTB40 CTCF FOXA1 LCORL MLX SMARCE1 RBPJ POLR2A NR2F1 MYD88 ACAA1 lnc-PLCD1-1 piR-53275-004 WDR48 GORASP1 C3orf35 OXSR1 piR-44757
GH03J038164 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 20.3 -30.1 -30123 7.7 GTF3C2 E2F8 ZNF24 SP1 ZBTB40 RBPJ POLR2A NR2F6 ATF1 FOS OXSR1 LOC101928234 lnc-ACAA1-2 GORASP1 MYD88 C3orf35 ACAA1 WDR48 NDUFAF4P3 SLC22A13
GH03J038147 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 11.6 -12.1 -12059 13 SMARCE1 NFYC ELF1 RELA L3MBTL2 MAX MAFK CBFA2T2 MLLT1 SP7 VILL MYD88 OXSR1 ACAA1 SLC22A13 PLCD1 MF281454 lnc-ACAA1-2
GH03J038209 Enhancer 0.7 Ensembl 21.6 -71.3 -71259 11.4 RELA ZNF687 IKZF1 CREB1 PKNOX1 IKZF2 ZNF629 SOX13 NFE2 RUNX3 ACAA1 MYD88 SLC22A13 SLC22A14 piR-45349-014 OXSR1 piR-39232
GH03J038157 Enhancer 0.7 Ensembl ENCODE 17 -21.0 -21016 1.9 LCORL NFIB ZIK1 PRDM4 ZNF112 NFIC NFIA ZNF398 KLF1 NDUFAF4P3 ACAA1 ACVR2B LOC101928234 OXSR1 lnc-ACAA1-2 MF281454
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ACAA1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ACAA1 gene promoter:
  • AP-1
  • c-Fos
  • c-Jun
  • IRF-1
  • PPAR-gamma1
  • STAT1
  • STAT1alpha
  • STAT1beta
  • STAT3

Genomic Locations for ACAA1 Gene

Genomic Locations for ACAA1 Gene
chr3:38,103,129-38,137,242
(GRCh38/hg38)
Size:
34,114 bases
Orientation:
Minus strand
chr3:38,144,620-38,178,733
(GRCh37/hg19)
Size:
34,114 bases
Orientation:
Minus strand

Genomic View for ACAA1 Gene

Genes around ACAA1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ACAA1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ACAA1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ACAA1 Gene

Proteins for ACAA1 Gene

  • Protein details for ACAA1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P09110-THIK_HUMAN
    Recommended name:
    3-ketoacyl-CoA thiolase, peroxisomal
    Protein Accession:
    P09110
    Secondary Accessions:
    • G5E935
    • Q96CA6

    Protein attributes for ACAA1 Gene

    Size:
    424 amino acids
    Molecular mass:
    44292 Da
    Quaternary structure:
    • Homodimer.

    Three dimensional structures from OCA and Proteopedia for ACAA1 Gene

    Alternative splice isoforms for ACAA1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ACAA1 Gene

Selected DME Specific Peptides for ACAA1 Gene

P09110:
  • TLLNELKRRG
  • GSTTAGN
  • GMGAAAVFE
  • EKVNPLGGA
  • PAFKKDG
  • GLPILGV
  • MARIAQFLS
  • FALASQQKAA
  • PMGITSENVA
  • RGGFKDT
  • DVVVVHGRRT
  • NRQCSSGL
  • RLQVVLGHL
  • SMCIGTGMGAA
  • FEINEAFA
  • CLIPMGIT

Post-translational modifications for ACAA1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Antibody Products

  • Abcam antibodies for ACAA1
  • Santa Cruz Biotechnology (SCBT) Antibodies for ACAA1

Domains & Families for ACAA1 Gene

Gene Families for ACAA1 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • FDA approved drug targets
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for ACAA1 Gene

Suggested Antigen Peptide Sequences for ACAA1 Gene

GenScript: Design optimal peptide antigens:
  • cDNA, FLJ79450, highly similar to 3-ketoacyl-CoA thiolase, peroxisomal (EC 2.3.1.16) (B4DVF4_HUMAN)
  • cDNA FLJ61196, highly similar to 3-ketoacyl-CoA thiolase, peroxisomal (EC 2.3.1.16) (B4E072_HUMAN)
  • ACAA1 protein (Q96CA6_HUMAN)
  • Peroxisomal 3-oxoacyl-CoA thiolase (THIK_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P09110

UniProtKB/Swiss-Prot:

THIK_HUMAN :
  • Belongs to the thiolase-like superfamily. Thiolase family.
Family:
  • Belongs to the thiolase-like superfamily. Thiolase family.
genes like me logo Genes that share domains with ACAA1: view

Function for ACAA1 Gene

Molecular function for ACAA1 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=acetyl-CoA + an acyl-CoA = a 3-oxoacyl-CoA + CoA; Xref=Rhea:RHEA:21564, ChEBI:CHEBI:57287, ChEBI:CHEBI:57288, ChEBI:CHEBI:58342, ChEBI:CHEBI:90726; EC=2.3.1.16;.
UniProtKB/Swiss-Prot Induction:
Peroxisomal thiolase is markedly induced (at the level of transcription) by various hypolipidemic compounds in parallel with the other two enzymes of the peroxisomal beta-oxidation system.
GENATLAS Biochemistry:
acetyl-CoA acyltransferase,(peroxisomal matrix 3-oxoacyl-CoA thiolase),medium or long chain,catalyzing the fourth step of fatty acid beta-oxidation,expressed

Enzyme Numbers (IUBMB) for ACAA1 Gene

Phenotypes From GWAS Catalog for ACAA1 Gene

Gene Ontology (GO) - Molecular Function for ACAA1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003824 catalytic activity IEA --
GO:0003988 acetyl-CoA C-acyltransferase activity TAS --
GO:0005515 protein binding IPI 18281296
GO:0008775 acetate CoA-transferase activity EXP 11734571
GO:0016401 palmitoyl-CoA oxidase activity IMP 2882519
genes like me logo Genes that share ontologies with ACAA1: view
genes like me logo Genes that share phenotypes with ACAA1: view

Animal Models for ACAA1 Gene

MGI Knock Outs for ACAA1:
  • Acaa1a Acaa1a<tm1a(KOMP)Wtsi>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ACAA1

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ACAA1 Gene

Localization for ACAA1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ACAA1 Gene

Peroxisome.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ACAA1 gene
Compartment Confidence
peroxisome 5
extracellular 4
cytosol 4
mitochondrion 2
nucleus 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for ACAA1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005777 peroxisome IDA,IBA 1347505
GO:0005782 peroxisomal matrix TAS --
GO:0005829 cytosol TAS --
GO:0016020 membrane HDA 19946888
genes like me logo Genes that share ontologies with ACAA1: view

Pathways & Interactions for ACAA1 Gene

genes like me logo Genes that share pathways with ACAA1: view

UniProtKB/Swiss-Prot P09110-THIK_HUMAN

  • Pathway: Lipid metabolism; fatty acid metabolism.

Gene Ontology (GO) - Biological Process for ACAA1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000038 very long-chain fatty acid metabolic process IMP 2318981
GO:0006625 protein targeting to peroxisome TAS --
GO:0006629 lipid metabolic process IEA --
GO:0006631 fatty acid metabolic process IEA --
GO:0006635 fatty acid beta-oxidation IBA,IMP 2365812
genes like me logo Genes that share ontologies with ACAA1: view

No data available for SIGNOR curated interactions for ACAA1 Gene

Drugs & Compounds for ACAA1 Gene

(12) Drugs for ACAA1 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
FAD Approved Pharma Target 0
Glycolic acid Approved, Investigational Pharma Target 24
Trimetazidine Approved, Investigational Pharma Target, inhibitor 19
Vayarin Approved, Investigational Pharma Enzyme 0
Acetylglycine Experimental Pharma Target 0

(59) Additional Compounds for ACAA1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
(+)-7-Isojasmonic acid CoA
(2E)-Decenoyl-CoA
  • (e)-S-2-Decenoate
  • (e)-S-2-Decenoate CoA
  • (e)-S-2-Decenoate coenzyme A
  • (e)-S-2-Decenoic acid
  • 2-trans-Decenoyl-CoA
10018-95-8
(2E)-Dodecenoyl-CoA
1066-12-2
(2E)-Hexadecenoyl-CoA
  • (e)-C16:1 N-14-CoA
  • (e)-Hexadec-2-enoyl-CoA tetraanion
  • (e)-Hexadec-2-enoyl-coenzyme A tetraanion
  • (e)-Hexadec-2-enoyl-coenzyme A(4-)
  • trans-2-Hexadecenoyl-CoA(4-)
4460-95-1
(2E)-Octenoyl-CoA
  • (e)-S-2-Octenoate
  • (e)-S-2-Octenoate CoA
  • (e)-S-2-Octenoate coenzyme A
  • (e)-S-2-Octenoic acid
  • 2,3-trans-Octenoyl coenzyme A
10018-94-7
genes like me logo Genes that share compounds with ACAA1: view

Transcripts for ACAA1 Gene

mRNA/cDNA for ACAA1 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ACAA1

Alternative Splicing Database (ASD) splice patterns (SP) for ACAA1 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11a · 11b · 11c ^ 12a · 12b · 12c ^ 13 ^
SP1: - - - - - - - -
SP2: - - - - -
SP3: - - - - - - -
SP4: - - - - - - - - - -
SP5: - - - - - - - -
SP6: - - - - - - - - -
SP7: - - - - - - -
SP8: -
SP9: - -
SP10: - - - - - - - -
SP11: - - - -
SP12: -
SP13: - -
SP14:
SP15: -
SP16:
SP17: - - -
SP18: - - - -
SP19:

ExUns: 14a · 14b · 14c ^ 15 ^ 16a · 16b ^ 17a · 17b · 17c · 17d
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9: - - -
SP10:
SP11: - - -
SP12: - - -
SP13:
SP14:
SP15: - - -
SP16:
SP17:
SP18:
SP19:

Relevant External Links for ACAA1 Gene

GeneLoc Exon Structure for
ACAA1
ECgene alternative splicing isoforms for
ACAA1

Expression for ACAA1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ACAA1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ACAA1 Gene

This gene is overexpressed in Liver (x7.4) and Whole Blood (x4.2).

Protein differential expression in normal tissues from HIPED for ACAA1 Gene

This gene is overexpressed in Fetal Liver (22.6), Liver, secretome (6.5), and Kidney (6.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ACAA1 Gene



Protein tissue co-expression partners for ACAA1 Gene

NURSA nuclear receptor signaling pathways regulating expression of ACAA1 Gene:

ACAA1

SOURCE GeneReport for Unigene cluster for ACAA1 Gene:

Hs.643487

Evidence on tissue expression from TISSUES for ACAA1 Gene

  • Liver(4.8)
  • Nervous system(4.4)
  • Pancreas(4.3)
  • Intestine(3.1)
  • Lung(3)
  • Blood(2.3)
  • Heart(2.2)
  • Kidney(2.1)
  • Muscle(2)
genes like me logo Genes that share expression patterns with ACAA1: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for ACAA1 Gene

Orthologs for ACAA1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ACAA1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ACAA1 33 32
  • 99.84 (n)
OneToOne
dog
(Canis familiaris)
Mammalia ACAA1 33 32
  • 90.8 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ACAA1 33 32
  • 89.47 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Acaa1b 33
  • 86 (a)
OneToMany
Acaa1a 17 33 32
  • 85.06 (n)
rat
(Rattus norvegicus)
Mammalia Acaa1b 32
  • 85.14 (n)
oppossum
(Monodelphis domestica)
Mammalia ACAA1 33
  • 84 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ACAA1 33
  • 72 (a)
OneToOne
chicken
(Gallus gallus)
Aves ACAA1 33 32
  • 74.51 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ACAA1 33
  • 71 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia acaa1 32
  • 69.93 (n)
African clawed frog
(Xenopus laevis)
Amphibia acaa1-prov 32
zebrafish
(Danio rerio)
Actinopterygii acaa1 33 32
  • 66.67 (n)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes POT1 35 33
  • 51 (a)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.5310 32
rice
(Oryza sativa)
Liliopsida Os10g0457600 32
  • 57.38 (n)
wheat
(Triticum aestivum)
Liliopsida Ta.28367 32
Species where no ortholog for ACAA1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • worm (Caenorhabditis elegans)

Evolution for ACAA1 Gene

ENSEMBL:
Gene Tree for ACAA1 (if available)
TreeFam:
Gene Tree for ACAA1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ACAA1: view image

Paralogs for ACAA1 Gene

Paralogs for ACAA1 Gene

(4) SIMAP similar genes for ACAA1 Gene using alignment to 8 proteins:

  • THIK_HUMAN
  • B4DVF4_HUMAN
  • B4E072_HUMAN
  • C9JDE9_HUMAN
  • F2Z2Q6_HUMAN
  • F2Z3P7_HUMAN
  • H0Y4D4_HUMAN
  • H7C131_HUMAN
genes like me logo Genes that share paralogs with ACAA1: view

Variants for ACAA1 Gene

Sequence variations from dbSNP and Humsavar for ACAA1 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs137853065 pathogenic, Myd88 deficiency 38,138,978(-) T/C upstream_transcript_variant
rs372072898 uncertain-significance, Myd88 deficiency 38,138,806(-) T/C upstream_transcript_variant
rs373382593 benign, Myd88 deficiency 38,138,961(-) C/T upstream_transcript_variant
rs746651350 pathogenic, Myd88 deficiency 38,138,671(-) GACCGCGCTGAGGCTCCAGGACCGC/GACCGC upstream_transcript_variant
rs79867863 benign, Myd88 deficiency 38,138,736(-) C/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for ACAA1 Gene

Variant ID Type Subtype PubMed ID
nsv476175 CNV novel sequence insertion 20440878

Variation tolerance for ACAA1 Gene

Residual Variation Intolerance Score: 60.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.88; 79.49% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ACAA1 Gene

Human Gene Mutation Database (HGMD)
ACAA1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ACAA1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ACAA1 Gene

Disorders for ACAA1 Gene

MalaCards: The human disease database

(6) MalaCards diseases for ACAA1 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
arachnoiditis
  • spinal arachnoiditis
chondrodysplasia punctata syndrome
  • chondrodysplasia punctata
myd88 deficiency
  • myd88d
alpha-methylacetoacetic aciduria
  • 2-methyl-3-hydroxybutyric acidemia
alpha-methylacyl-coa racemase deficiency
  • amacrd
- elite association - COSMIC cancer census association via MalaCards
Search ACAA1 in MalaCards View complete list of genes associated with diseases

Genatlas disease for ACAA1 Gene

pseudo Zellweger syndrome with abundant peroxisomes and normal plasmalogen biosynthesis (ACAA deficiency)

Additional Disease Information for ACAA1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ACAA1: view

No data available for UniProtKB/Swiss-Prot for ACAA1 Gene

Publications for ACAA1 Gene

  1. Characterization of the gene encoding human peroxisomal 3-oxoacyl-CoA thiolase (ACAA). No large DNA rearrangement in a thiolase-deficient patient. (PMID: 1679347) Bout A … Benne R (Biochimica et biophysica acta 1991) 3 4 23 56
  2. Effects of endotoxin exposure on childhood asthma risk are modified by a genetic polymorphism in ACAA1. (PMID: 22151743) Sordillo JE … Litonjua AA (BMC medical genetics 2011) 2 3 56
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 43 56
  4. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 43 56
  5. Risk of meningioma and common variation in genes related to innate immunity. (PMID: 20406964) Rajaraman P … Inskip PD (Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2010) 3 43 56

Products for ACAA1 Gene

Sources for ACAA1 Gene