The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variet... See more...

Aliases for PPP2R2B Gene

Aliases for PPP2R2B Gene

  • Protein Phosphatase 2 Regulatory Subunit Bbeta 2 3 5
  • Serine/Threonine-Protein Phosphatase 2A 55 KDa Regulatory Subunit B Beta Isoform 3 4
  • Protein Phosphatase 2 (Formerly 2A), Regulatory Subunit B (PR 52), Beta Isoform 2 3
  • PP2A Subunit B Isoform PR55-Beta 3 4
  • PP2A Subunit B Isoform B55-Beta 3 4
  • PP2A Subunit B Isoform R2-Beta 3 4
  • PP2A Subunit B Isoform Beta 2 4
  • Serine/Threonine Protein Phosphatase 2A, 55 KDa Regulatory Subunit B, Beta Isoform 3
  • Protein Phosphatase 2 (Formerly 2A), Regulatory Subunit B, Beta Isoform 3
  • Serine/Threonine Protein Phosphatase 2A, Neuronal Isoform 3
  • Protein Phosphatase 2, Regulatory Subunit B, Beta 3
  • PP2A, Subunit B, B-Beta Isoform 3
  • Spinocerebellar Ataxia 12 2
  • PP2APR55BETA 3
  • PR2APR55BETA 3
  • PP2AB55BETA 3
  • PR2AB55BETA 3
  • PP2ABBETA 3
  • PP2APR55B 3
  • PR2ABBETA 3
  • PR55-BETA 3
  • PR55BETA 3
  • B55BETA 3
  • PR52B 3
  • SCA12 3

External Ids for PPP2R2B Gene

Previous HGNC Symbols for PPP2R2B Gene

  • SCA12

Previous GeneCards Identifiers for PPP2R2B Gene

  • GC05M145936
  • GC05M146549
  • GC05M145997
  • GC05M145949
  • GC05M141115
  • GC05M145969

Summaries for PPP2R2B Gene

Entrez Gene Summary for PPP2R2B Gene

  • The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

GeneCards Summary for PPP2R2B Gene

PPP2R2B (Protein Phosphatase 2 Regulatory Subunit Bbeta) is a Protein Coding gene. Diseases associated with PPP2R2B include Spinocerebellar Ataxia 12 and Autosomal Dominant Cerebellar Ataxia. Among its related pathways are Wnt Signaling Pathway and Pluripotency and p70S6K Signaling. An important paralog of this gene is PPP2R2A.

UniProtKB/Swiss-Prot Summary for PPP2R2B Gene

  • The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. Within the PP2A holoenzyme complex, isoform 2 is required to promote proapoptotic activity (By similarity). Isoform 2 regulates neuronal survival through the mitochondrial fission and fusion balance (By similarity).

Tocris Summary for PPP2R2B Gene

  • Protein Ser/Thr phosphatases are a group of enzymes that catalyze the removal of phosphate groups from serine and/or threonine residues by hydrolysis of phosphoric acid monoesters. They oppose the action of kinases and phosphorylases and are involved in signal transduction.

Gene Wiki entry for PPP2R2B Gene

Additional gene information for PPP2R2B Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for PPP2R2B Gene

Genomics for PPP2R2B Gene

GeneHancer (GH) Regulatory Elements for PPP2R2B Gene

Promoters and enhancers for PPP2R2B Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J146877 Promoter/Enhancer 1.7 EPDnew Ensembl ENCODE CraniofacialAtlas 762.9 +206.8 206766 2.4 ZNF548 GLIS2 PRDM10 PATZ1 POLR2A ZNF692 ZBTB20 EZH2 SCRT2 ZBTB48 PPP2R2B 5MWI_A-151 TCERG1 RBM27 RF00017-4987 lnc-PPP2R2B-4
GH05J147055 Promoter/Enhancer 0.7 EPDnew Ensembl dbSUPER 761.5 +28.9 28883 1 PPP2R2B lnc-PPP2R2B-4 piR-31846-027
GH05J147083 Enhancer 0.3 Ensembl dbSUPER 750.6 +0.4 383 1.6 PPP2R2B lnc-PPP2R2B-4 piR-31846-027
GH05J146864 Promoter 0.3 EPDnew 750.1 +220.4 220369 0.1 PPP2R2B 5MWI_A-151 RF00017-4987 lnc-PPP2R2B-4
GH05J146446 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas 11.8 +636.9 636897 2.6 ZNF785 SP1 CTCF MLX RBPJ SMARCE1 POLR2A CEBPZ USF2 ATF1 TCERG1 RBM27 GPR151 ENSG00000249363 LARS1 PPP2R2B lnc-POU4F3-2 RF00017-4985
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around PPP2R2B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PPP2R2B gene promoter:
  • TBP

Genomic Locations for PPP2R2B Gene

Genomic Locations for PPP2R2B Gene
chr5:146,581,146-147,084,784
(GRCh38/hg38)
Size:
503,639 bases
Orientation:
Minus strand
chr5:145,967,936-146,464,347
(GRCh37/hg19)
Size:
496,412 bases
Orientation:
Minus strand

Genomic View for PPP2R2B Gene

Genes around PPP2R2B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP2R2B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP2R2B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PPP2R2B Gene

Proteins for PPP2R2B Gene

  • Protein details for PPP2R2B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q00005-2ABB_HUMAN
    Recommended name:
    Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B beta isoform
    Protein Accession:
    Q00005
    Secondary Accessions:
    • A6NEJ2
    • A8K102
    • B3KPD0
    • B7Z2F2
    • B7Z304
    • D3DQF7
    • D3DQF8
    • G3V149

    Protein attributes for PPP2R2B Gene

    Size:
    443 amino acids
    Molecular mass:
    51710 Da
    Quaternary structure:
    • PP2A consists of a common heterodimeric core enzyme, composed of a 36 kDa catalytic subunit (subunit C) and a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B''/PR72/PR130/PR59 and R5/B'/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules (By similarity). Interacts with TOMM22 (By similarity). Interacts with IER5 (via N- and C-terminal regions) (PubMed:25816751, PubMed:26496226).
    SequenceCaution:
    • Sequence=AAH31790.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAG51642.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAG51642.1; Type=Erroneous termination; Positions=116; Note=Translated as Lys.; Evidence={ECO:0000305};

    Alternative splice isoforms for PPP2R2B Gene

neXtProt entry for PPP2R2B Gene

Post-translational modifications for PPP2R2B Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for PPP2R2B Gene

Domains & Families for PPP2R2B Gene

Gene Families for PPP2R2B Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for PPP2R2B Gene

GenScript: Design optimal peptide antigens:
  • PP2A subunit B isoform beta (2ABB_HUMAN)
  • Protein phosphatase 2 regulatory subunit B (Q9NS07_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q00005

UniProtKB/Swiss-Prot:

2ABB_HUMAN :
  • The N-terminal 26 residues of isoform 2 constitute a cryptic mitochondrial matrix import signal with critical basic and hydrophobic residues, that is necessary and sufficient for targeting the PP2A holoenzyme to the outer mitochondrial membrane (OMM) and does not affect holoenzyme formation or catalytic activity.
  • Belongs to the phosphatase 2A regulatory subunit B family.
Domain:
  • The N-terminal 26 residues of isoform 2 constitute a cryptic mitochondrial matrix import signal with critical basic and hydrophobic residues, that is necessary and sufficient for targeting the PP2A holoenzyme to the outer mitochondrial membrane (OMM) and does not affect holoenzyme formation or catalytic activity.
  • The last WD repeat of isoform 2 constitutes a mitochondrial stop-transfer domain that confers resistance to the unfolding step process required for import and therefore prevents PPP2R2B matrix translocation and signal sequence cleavage.
Family:
  • Belongs to the phosphatase 2A regulatory subunit B family.
genes like me logo Genes that share domains with PPP2R2B: view

Function for PPP2R2B Gene

Molecular function for PPP2R2B Gene

UniProtKB/Swiss-Prot Function:
The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. Within the PP2A holoenzyme complex, isoform 2 is required to promote proapoptotic activity (By similarity). Isoform 2 regulates neuronal survival through the mitochondrial fission and fusion balance (By similarity).
GENATLAS Biochemistry:
protein phosphatase 2A,regulating subunit 3,beta isoform specifically expressed in brain (PR53) with a polymorphic CAG repeat in the 5'utr promoter region

Phenotypes From GWAS Catalog for PPP2R2B Gene

Gene Ontology (GO) - Molecular Function for PPP2R2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004722 contributes_to protein serine/threonine phosphatase activity IBA 21873635
GO:0005515 protein binding IPI 17274953
GO:0019888 protein phosphatase regulator activity TAS,IEA --
genes like me logo Genes that share ontologies with PPP2R2B: view
genes like me logo Genes that share phenotypes with PPP2R2B: view

Human Phenotype Ontology for PPP2R2B Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PPP2R2B Gene

MGI Knock Outs for PPP2R2B:

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for PPP2R2B Gene

Localization for PPP2R2B Gene

Subcellular locations from UniProtKB/Swiss-Prot for PPP2R2B Gene

Isoform 1: Cytoplasm. Cytoplasm, cytoskeleton. Membrane.
Isoform 2: Cytoplasm. Mitochondrion. Mitochondrion outer membrane. Note=Under basal conditions, localizes to both cytosolic and mitochondrial compartments. Relocalizes from the cytosolic to the mitochondrial compartment during apoptosis. Its targeting to the outer mitochondrial membrane (OMM) involves an association with import receptors of the TOM complex and is required to promote proapoptotic activity (By similarity). {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP2R2B gene
Compartment Confidence
mitochondrion 4
cytosol 4
cytoskeleton 3
nucleus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for PPP2R2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000159 protein phosphatase type 2A complex IBA 21873635
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion ISS --
GO:0005741 mitochondrial outer membrane ISS --
GO:0005829 cytosol IBA 21873635
genes like me logo Genes that share ontologies with PPP2R2B: view

Pathways & Interactions for PPP2R2B Gene

PathCards logo

SuperPathways for PPP2R2B Gene

SuperPathway Contained pathways
1 Beta-Adrenergic Signaling
.37
.37
.36
2 p70S6K Signaling
.60
.60
.54
3 Toll-like Receptor Signaling Pathway
4 PI3K-Akt signaling pathway
5 Cyclins and Cell Cycle Regulation
.67
.36
genes like me logo Genes that share pathways with PPP2R2B: view

Pathways by source for PPP2R2B Gene

25 Qiagen pathways for PPP2R2B Gene
  • Akt Signaling
  • BAD Phosphorylation
  • Beta-Adrenergic Signaling
  • Breast Cancer Regulation by Stathmin1
  • CDK5 Pathway

SIGNOR curated interactions for PPP2R2B Gene

Inactivates:

Gene Ontology (GO) - Biological Process for PPP2R2B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000278 mitotic cell cycle IBA 21873635
GO:0006915 apoptotic process IEA --
GO:0043666 regulation of phosphoprotein phosphatase activity IEA --
GO:0070262 peptidyl-serine dephosphorylation IBA 21873635
genes like me logo Genes that share ontologies with PPP2R2B: view

Drugs & Compounds for PPP2R2B Gene

(3) Drugs for PPP2R2B Gene - From: Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Cyclosporin A Approved, Investigational, Vet_approved Pharma Antagonist, Inhibition, Inhibitor Immunosuppressive agent, Calcineurin inhibitor 0
Calcineurin Autoinhibitory Peptide Pharma CaMKII inhibitor, Selective calcineurin inhibitor 0
INCA-6 Pharma Selective calcineurin-NFAT signaling inhibitor, Inhibitor of calcineurin-substrate association 0

(1) Additional Compounds for PPP2R2B Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
FK 506
104987-11-3

(4) Tocris Compounds for PPP2R2B Gene

Compound Action Cas Number
Calcineurin Autoinhibitory Peptide Selective calcineurin inhibitor 148067-21-4
Cyclosporin A Calcineurin inhibitor 59865-13-3
FK 506 Potent calcineurin inhibitor; immunosuppressant 104987-11-3
INCA-6 Inhibitor of calcineurin-substrate association 3519-82-2
genes like me logo Genes that share compounds with PPP2R2B: view

Transcripts for PPP2R2B Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP2R2B Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b
SP1: - -
SP2: -
SP3: - - - -
SP4:
SP5: - - - - -

Relevant External Links for PPP2R2B Gene

GeneLoc Exon Structure for
PPP2R2B
ECgene alternative splicing isoforms for
PPP2R2B

Expression for PPP2R2B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP2R2B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for PPP2R2B Gene

This gene is overexpressed in Brain - Putamen (basal ganglia) (x5.1), Brain - Nucleus accumbens (basal ganglia) (x5.1), Brain - Caudate (basal ganglia) (x4.8), Brain - Frontal Cortex (BA9) (x4.5), Brain - Anterior cingulate cortex (BA24) (x4.4), Brain - Cortex (x4.4), and Brain - Amygdala (x4.3).

Protein differential expression in normal tissues from HIPED for PPP2R2B Gene

This gene is overexpressed in Saliva (38.9), Urine (12.1), and Heart (7.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for PPP2R2B Gene



Protein tissue co-expression partners for PPP2R2B Gene

NURSA nuclear receptor signaling pathways regulating expression of PPP2R2B Gene:

PPP2R2B

SOURCE GeneReport for Unigene cluster for PPP2R2B Gene:

Hs.655213

mRNA Expression by UniProt/SwissProt for PPP2R2B Gene:

Q00005-2ABB_HUMAN
Tissue specificity: Brain.

Evidence on tissue expression from TISSUES for PPP2R2B Gene

  • Nervous system(5)

Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP2R2B Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • eye
  • face
  • head
  • neck
Thorax:
  • chest wall
Abdomen:
  • abdominal wall
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with PPP2R2B: view

Orthologs for PPP2R2B Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for PPP2R2B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PPP2R2B 33 32
  • 99.7 (n)
OneToOne
dog
(Canis familiaris)
Mammalia PPP2R2B 33 32
  • 95.77 (n)
OneToOne
cow
(Bos Taurus)
Mammalia PPP2R2B 33 32
  • 95.62 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Ppp2r2b 32
  • 94.47 (n)
mouse
(Mus musculus)
Mammalia Ppp2r2b 17 33 32
  • 94.15 (n)
oppossum
(Monodelphis domestica)
Mammalia PPP2R2B 33
  • 83 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia PPP2R2B 33
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves PPP2R2B 33 32
  • 83.59 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia PPP2R2B 33
  • 95 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ppp2r2b 32
  • 83.02 (n)
African clawed frog
(Xenopus laevis)
Amphibia ppp2r2b-A-prov 32
zebrafish
(Danio rerio)
Actinopterygii PPP2R2B (2 of 3) 33
  • 93 (a)
OneToMany
ppp2r2bb 33
  • 90 (a)
OneToMany
ppp2r2ba 33
  • 87 (a)
OneToMany
LOC100335012 32
  • 77.15 (n)
fruit fly
(Drosophila melanogaster)
Insecta tws 33 34
  • 67 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea sur-6 33
  • 58 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CDC55 35 33
  • 46 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6047 33
  • 67 (a)
OneToMany
Cin.5205 32
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.5205 32
Species where no ortholog for PPP2R2B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PPP2R2B Gene

ENSEMBL:
Gene Tree for PPP2R2B (if available)
TreeFam:
Gene Tree for PPP2R2B (if available)
Aminode:
Evolutionary constrained regions (ECRs) for PPP2R2B: view image

Paralogs for PPP2R2B Gene

Paralogs for PPP2R2B Gene

(3) SIMAP similar genes for PPP2R2B Gene using alignment to 9 proteins:

  • 2ABB_HUMAN
  • D6RB57_HUMAN
  • D6RF04_HUMAN
  • D6RGF9_HUMAN
  • E5RFC4_HUMAN
  • E5RJ91_HUMAN
  • E9PCT7_HUMAN
  • H0YA16_HUMAN
  • Q9NS07_HUMAN
genes like me logo Genes that share paralogs with PPP2R2B: view

Variants for PPP2R2B Gene

Sequence variations from dbSNP and Humsavar for PPP2R2B Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs10591869 benign, uncertain-significance, likely-benign, Spinocerebellar ataxia 12, not specified, not provided 146,878,728(-) GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 5_prime_UTR_variant, coding_sequence_variant, inframe_deletion, inframe_insertion, intron_variant, non_coding_transcript_variant
rs1554126530 uncertain-significance, Spinocerebellar ataxia 12 146,701,094(-) G/A coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs1064796487 uncertain-significance, not provided 146,697,985(-) T/C coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs150981315 uncertain-significance, not provided 146,638,334(-) T/C coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs778233469 uncertain-significance, not provided 146,590,089(-) C/G/T coding_sequence_variant, missense_variant, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for PPP2R2B Gene

Variant ID Type Subtype PubMed ID
dgv1656e212 CNV loss 25503493
dgv356n21 CNV loss 19592680
esv1159529 CNV insertion 17803354
esv2053966 CNV deletion 18987734
esv2422173 CNV deletion 20811451
esv2659662 CNV deletion 23128226
esv2660911 CNV deletion 23128226
esv2664858 CNV deletion 23128226
esv26695 CNV loss 19812545
esv2670593 CNV deletion 23128226
esv2672689 CNV deletion 23128226
esv2675913 CNV deletion 23128226
esv2730881 CNV deletion 23290073
esv2730882 CNV deletion 23290073
esv2730883 CNV deletion 23290073
esv2759385 CNV loss 17122850
esv2763505 CNV loss 21179565
esv3304864 CNV mobile element insertion 20981092
esv3306710 CNV mobile element insertion 20981092
esv3310476 CNV novel sequence insertion 20981092
esv3324641 CNV insertion 20981092
esv3394455 CNV insertion 20981092
esv3427676 CNV duplication 20981092
esv3429928 CNV insertion 20981092
esv3444421 CNV insertion 20981092
esv3570481 CNV loss 25503493
esv3570482 CNV loss 25503493
esv3570485 CNV loss 25503493
esv3607080 CNV loss 21293372
esv3607081 CNV loss 21293372
esv3607083 CNV loss 21293372
esv3607084 CNV loss 21293372
esv3607085 CNV loss 21293372
esv3607086 CNV loss 21293372
esv988317 CNV insertion 20482838
nsv1117590 CNV deletion 24896259
nsv1145843 CNV deletion 26484159
nsv327242 CNV insertion 16902084
nsv328338 CNV deletion 16902084
nsv499741 CNV loss 21111241
nsv5052 CNV insertion 18451855
nsv5053 CNV deletion 18451855
nsv514327 CNV loss 21397061
nsv519847 CNV gain+loss 19592680
nsv528827 CNV loss 19592680
nsv599938 CNV gain 21841781
nsv823286 CNV loss 20364138
nsv969003 CNV duplication 23825009

Variation tolerance for PPP2R2B Gene

Residual Variation Intolerance Score: 16.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.68; 14.54% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PPP2R2B Gene

Human Gene Mutation Database (HGMD)
PPP2R2B
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PPP2R2B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP2R2B Gene

Disorders for PPP2R2B Gene

MalaCards: The human disease database

(8) MalaCards diseases for PPP2R2B Gene - From: HGMD, OMIM, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

2ABB_HUMAN
  • Spinocerebellar ataxia 12 (SCA12) [MIM:604326]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA12 is an autosomal dominant cerebellar ataxia (ADCA). {ECO:0000269 PubMed:10581021}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for PPP2R2B

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with PPP2R2B: view

No data available for Genatlas for PPP2R2B Gene

Publications for PPP2R2B Gene

  1. PPP2R2B CAG repeat length in the Han Chinese in Taiwan: Association analyses in neurological and psychiatric disorders and potential functional implications. (PMID: 18484086) Chen CM … Lee-Chen GJ (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2009) 3 23 43 56
  2. Screening for premutation in the FMR1 gene in male patients suspected of spinocerebellar ataxia. (PMID: 19235102) Rajkiewicz M … Zaremba J (Neurologia i neurochirurgia polska 2008) 3 23 43 56
  3. Expansion of a novel CAG trinucleotide repeat in the 5' region of PPP2R2B is associated with SCA12. (PMID: 10581021) Holmes SE … Margolis RL (Nature genetics 1999) 2 3 4 56
  4. Structure of the 55-kDa regulatory subunit of protein phosphatase 2A: evidence for a neuronal-specific isoform. (PMID: 1849734) Mayer RE … Hemmings BA (Biochemistry 1991) 2 3 4 56
  5. HSF1 transcriptional activity is modulated by IER5 and PP2A/B55. (PMID: 25816751) Ishikawa Y … Sakurai H (FEBS letters 2015) 3 4 56

Products for PPP2R2B Gene

Sources for PPP2R2B Gene