Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PRPF4 Gene

Aliases for PRPF4 Gene

  • Pre-MRNA Processing Factor 4 2 3 5
  • U4/U6 Small Nuclear Ribonucleoprotein Prp4 2 3
  • PRP4/STK/WD Splicing Factor 2 3
  • U4/U6 SnRNP 60 KDa Protein 3 4
  • WD Splicing Factor Prp4 3 4
  • PRP4 Homolog 3 4
  • HPRP4 3 4
  • PRP4 3 4
  • PRP4 Pre-MRNA Processing Factor 4 Homolog (Yeast) 2
  • PRP4 Pre-MRNA Processing Factor 4 Homolog 3
  • SNRNP60 3
  • HPRP4P 3
  • Prp4p 3
  • RP70 3

External Ids for PRPF4 Gene

Previous GeneCards Identifiers for PRPF4 Gene

  • GC09P106836
  • GC09P107770
  • GC09P109491
  • GC09P111414
  • GC09P113117
  • GC09P115077
  • GC09P116037
  • GC09P085645

Summaries for PRPF4 Gene

Entrez Gene Summary for PRPF4 Gene

  • The protein encoded by this gene is part of a heteromeric complex that binds U4, U5, and U6 small nuclear RNAs and is involved in pre-mRNA splicing. The encoded protein also is a mitotic checkpoint protein and a regulator of chemoresistance in human ovarian cancer. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]

GeneCards Summary for PRPF4 Gene

PRPF4 (Pre-MRNA Processing Factor 4) is a Protein Coding gene. Diseases associated with PRPF4 include Retinitis Pigmentosa 70 and Retinitis Pigmentosa. Among its related pathways are mRNA Splicing - Major Pathway and Gene Expression. Gene Ontology (GO) annotations related to this gene include U6 snRNA binding and U4 snRNA binding. An important paralog of this gene is SPAG16.

UniProtKB/Swiss-Prot for PRPF4 Gene

  • Participates in pre-mRNA splicing. Part of the U4/U5/U6 tri-snRNP complex, one of the building blocks of the spliceosome.

Gene Wiki entry for PRPF4 Gene

Additional gene information for PRPF4 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PRPF4 Gene

Genomics for PRPF4 Gene

GeneHancer (GH) Regulatory Elements for PRPF4 Gene

Promoters and enhancers for PRPF4 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09I113274 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 610.9 +0.2 217 2.5 HDGF PKNOX1 SMAD1 MLX ARID4B SIN3A DMAP1 ZBTB7B YY1 POLR2B PRPF4 CDC26 PIR61584 GC09P114623 WDR31 FKBP15 PTBP3 SLC31A2 RGS3
GH09I112716 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 36.4 -557.4 -557435 2.1 HDGF PKNOX1 ARNT ARID4B SIN3A FEZF1 ZNF2 ZBTB7B YY1 POLR2B INIP PRPF4 FKBP15 CDC26 RPL32P22 PTBP3 GC09P112628
GH09I113339 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 31.3 +64.8 64815 1.7 SMAD1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 ZBTB7B IRF4 YY1 WDR31 PRPF4 CDC26 BSPRY RNF183 RPL32P22 ALAD C9orf43 POLE3 HDHD3
GH09I113409 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 25.8 +135.3 135278 2.7 CLOCK DMAP1 YY1 SLC30A9 E2F8 ZNF143 SP3 MEF2D ZNF610 GLIS1 C9orf43 POLE3 PRPF4 RGS3 FKBP15 CDC26
GH09I113463 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 25.3 +188.7 188711 1.9 ARID4B SIN3A DMAP1 ZNF2 ZNF48 GLIS2 SP3 NFYC REST ZNF610 RGS3 C9orf43 PRPF4 CDC26 POLE3 FKBP15 ALAD RNF183 GC09P114125
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around PRPF4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the PRPF4 gene promoter:

Genomic Locations for PRPF4 Gene

Genomic Locations for PRPF4 Gene
18,572 bases
Plus strand

Genomic View for PRPF4 Gene

Genes around PRPF4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PRPF4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PRPF4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PRPF4 Gene

Proteins for PRPF4 Gene

  • Protein details for PRPF4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    U4/U6 small nuclear ribonucleoprotein Prp4
    Protein Accession:
    Secondary Accessions:
    • O43445
    • O43864
    • Q5T1M8
    • Q96DG2
    • Q96IK4

    Protein attributes for PRPF4 Gene

    522 amino acids
    Molecular mass:
    58449 Da
    Quaternary structure:
    • Interacts directly with PRPF18, PPIH and PRPF3. Part of a heteromeric complex containing PPIH, PRPF3 and PRPF4 that is stable in the absence of RNA. Component of the U4/U6-U5 tri-snRNP complex composed of the U4, U6 and U5 snRNAs and at least PRPF3, PRPF4, PRPF6, PRPF8, PRPF31, SNRNP200, TXNL4A, WDR57, SNRNP40, DDX23, CD2BP2, PPIH, SNU13, EFTUD2, SART1 and USP39.

    Three dimensional structures from OCA and Proteopedia for PRPF4 Gene

    Alternative splice isoforms for PRPF4 Gene


neXtProt entry for PRPF4 Gene

Post-translational modifications for PRPF4 Gene

Other Protein References for PRPF4 Gene

No data available for DME Specific Peptides for PRPF4 Gene

Domains & Families for PRPF4 Gene

Gene Families for PRPF4 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for PRPF4 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with PRPF4: view

No data available for UniProtKB/Swiss-Prot for PRPF4 Gene

Function for PRPF4 Gene

Molecular function for PRPF4 Gene

UniProtKB/Swiss-Prot Function:
Participates in pre-mRNA splicing. Part of the U4/U5/U6 tri-snRNP complex, one of the building blocks of the spliceosome.

Phenotypes From GWAS Catalog for PRPF4 Gene

Gene Ontology (GO) - Molecular Function for PRPF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 9570313
GO:0017070 U6 snRNA binding IBA --
GO:0030621 U4 snRNA binding IBA --
genes like me logo Genes that share ontologies with PRPF4: view
genes like me logo Genes that share phenotypes with PRPF4: view

Human Phenotype Ontology for PRPF4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for PRPF4 Gene

miRTarBase miRNAs that target PRPF4

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for PRPF4 Gene

Localization for PRPF4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PRPF4 Gene

Nucleus speckle. Note=Colocalizes with spliceosomal snRNPs. {ECO:0000250}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PRPF4 gene
Compartment Confidence
nucleus 5
cytosol 2
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear speckles (4)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PRPF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS 9328476
GO:0005654 nucleoplasm TAS --
GO:0005681 spliceosomal complex NAS,IC 9328476
GO:0015030 Cajal body IDA 15257298
GO:0016607 nuclear speck IDA,IEA 25383878
genes like me logo Genes that share ontologies with PRPF4: view

Pathways & Interactions for PRPF4 Gene

genes like me logo Genes that share pathways with PRPF4: view

Pathways by source for PRPF4 Gene

1 KEGG pathway for PRPF4 Gene

Gene Ontology (GO) - Biological Process for PRPF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000375 RNA splicing, via transesterification reactions NAS 9328476
GO:0000398 mRNA splicing, via spliceosome TAS,IC --
GO:0006396 RNA processing TAS 9328476
GO:0006397 mRNA processing IEA --
GO:0008380 RNA splicing TAS 9328476
genes like me logo Genes that share ontologies with PRPF4: view

No data available for SIGNOR curated interactions for PRPF4 Gene

Drugs & Compounds for PRPF4 Gene

(1) Drugs for PRPF4 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
ATP Investigational Nutra Agonist 0

(1) Additional Compounds for PRPF4 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
genes like me logo Genes that share compounds with PRPF4: view

Transcripts for PRPF4 Gene

Unigene Clusters for PRPF4 Gene

PRP4 pre-mRNA processing factor 4 homolog (yeast):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for PRPF4 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12 ^ 13a · 13b ^ 14a · 14b · 14c
SP1: - -
SP2: - -
SP3: -

Relevant External Links for PRPF4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PRPF4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PRPF4 Gene

Protein differential expression in normal tissues from HIPED for PRPF4 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (24.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PRPF4 Gene

Protein tissue co-expression partners for PRPF4 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PRPF4 Gene:


SOURCE GeneReport for Unigene cluster for PRPF4 Gene:


Evidence on tissue expression from TISSUES for PRPF4 Gene

  • Intestine(4.4)
  • Nervous system(3.4)
  • Eye(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for PRPF4 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • immune
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • middle ear
  • nose
  • outer ear
  • skull
  • penis
  • testicle
  • blood
  • blood vessel
  • peripheral nervous system
  • red blood cell
  • skin
genes like me logo Genes that share expression patterns with PRPF4: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for PRPF4 Gene

Orthologs for PRPF4 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PRPF4 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PRPF4 33 34
  • 99.55 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 95 (a)
-- 34
  • 92 (a)
(Ornithorhynchus anatinus)
Mammalia PRPF4 34
  • 94 (a)
(Canis familiaris)
Mammalia PRPF4 33 34
  • 92.9 (n)
(Bos Taurus)
Mammalia PRPF4 33 34
  • 92.19 (n)
(Rattus norvegicus)
Mammalia Prpf4 33
  • 91.36 (n)
(Mus musculus)
Mammalia Prpf4 33 16 34
  • 90.91 (n)
(Gallus gallus)
Aves PRPF4 33 34
  • 78.49 (n)
(Anolis carolinensis)
Reptilia PRPF4 34
  • 90 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia prpf4 33
  • 72.82 (n)
MGC75813 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.6885 33
(Danio rerio)
Actinopterygii prpf4 33 34 34
  • 70.76 (n)
mgab03a02 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.10096 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002144 33
  • 56.92 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG6322 35
  • 56 (a)
U4-U6-60K 33 34
  • 56 (n)
(Caenorhabditis elegans)
Secernentea prp-4 33 34
  • 49.37 (n)
C36B1.5 35
  • 45 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes PRP4 33 34 36
  • 47.12 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AEL269C 33
  • 45.84 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0E04819g 33
  • 45.2 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons LIS 33
  • 50.5 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 57 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes SPAC227.12 33
  • 47.53 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU11251 33
  • 46.85 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.14002 33
Species where no ortholog for PRPF4 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PRPF4 Gene

Gene Tree for PRPF4 (if available)
Gene Tree for PRPF4 (if available)

Paralogs for PRPF4 Gene

Paralogs for PRPF4 Gene

(5) SIMAP similar genes for PRPF4 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with PRPF4: view

Variants for PRPF4 Gene

Sequence variations from dbSNP and Humsavar for PRPF4 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs41296057 Retinitis pigmentosa 70 (RP70) [MIM:615922] 113,283,400(+) G/A 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs541873609 pathogenic, Retinitis pigmentosa 70 113,275,630(+) TGTCAGTGACGCACTTCCTGTCAGTGACGCACTTCC/TGTCAGTGACGCACTTCC 5_prime_UTR_variant, non_coding_transcript_variant, upstream_transcript_variant
rs587777599 pathogenic, Retinitis pigmentosa 70, Retinitis pigmentosa 70 (RP70) [MIM:615922] 113,288,183(+) C/T coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs1000033229 -- 113,292,775(+) A/T 3_prime_UTR_variant, non_coding_transcript_variant
rs1000147463 -- 113,276,459(+) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for PRPF4 Gene

Variant ID Type Subtype PubMed ID
esv3621540 CNV gain 21293372
nsv1117905 CNV deletion 24896259

Variation tolerance for PRPF4 Gene

Residual Variation Intolerance Score: 23.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.64; 31.48% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for PRPF4 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PRPF4 Gene

Disorders for PRPF4 Gene

MalaCards: The human disease database

(4) MalaCards diseases for PRPF4 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search PRPF4 in MalaCards View complete list of genes associated with diseases


  • Retinitis pigmentosa 70 (RP70) [MIM:615922]: A retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. {ECO:0000269 PubMed:24419317, ECO:0000269 PubMed:25383878}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for PRPF4

genes like me logo Genes that share disorders with PRPF4: view

No data available for Genatlas for PRPF4 Gene

Publications for PRPF4 Gene

  1. A new cyclophilin and the human homologues of yeast Prp3 and Prp4 form a complex associated with U4/U6 snRNPs. (PMID: 9404889) Horowitz DS … Krainer AR (RNA (New York, N.Y.) 1997) 2 3 4 22 58
  2. The human U4/U6 snRNP contains 60 and 90kD proteins that are structurally homologous to the yeast splicing factors Prp4p and Prp3p. (PMID: 9257651) Lauber J … Lührmann R (RNA (New York, N.Y.) 1997) 2 3 4 58
  3. Identification and characterization of human genes encoding Hprp3p and Hprp4p, interacting components of the spliceosome. (PMID: 9328476) Wang A … Hu J (Human molecular genetics 1997) 3 4 22 58
  4. Identification of a PRPF4 loss-of-function variant that abrogates U4/U6.U5 tri-snRNP integration and is associated with retinitis pigmentosa. (PMID: 25383878) Linder B … Fischer U (PloS one 2014) 3 4 58
  5. PRPF4 mutations cause autosomal dominant retinitis pigmentosa. (PMID: 24419317) Chen X … Zhao C (Human molecular genetics 2014) 3 4 58

Products for PRPF4 Gene

Sources for PRPF4 Gene

Loading form....