Aliases for HES7 Gene
Aliases for HES7 Gene
External Ids for HES7 Gene
- HGNC: 15977
- Entrez Gene: 84667
- Ensembl: ENSG00000179111
- OMIM: 608059
- UniProtKB: Q9BYE0
Previous GeneCards Identifiers for HES7 Gene
- GC17P008428
- GC17M009113
- GC17M007966
- GC17M008226
- GC17M008227
- GC17M007965
- GC17M008030
- GC17M007919
- GC17M008046
- GC17M008051
- GC17M008056
- GC17M008060
Summaries for HES7 Gene
-
This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
GeneCards Summary for HES7 Gene
HES7 (Hes Family BHLH Transcription Factor 7) is a Protein Coding gene. Diseases associated with HES7 include Spondylocostal Dysostosis 4, Autosomal Recessive and Spondylocostal Dysostosis 4. Among its related pathways are Mesodermal Commitment Pathway and PI3K-Akt signaling pathway. Gene Ontology (GO) annotations related to this gene include transcription factor binding and protein dimerization activity.
UniProtKB/Swiss-Prot for HES7 Gene
-
Transcriptional repressor. Represses transcription from both N box- and E box-containing promoters. May with HES1, cooperatively regulate somite formation in the presomitic mesoderm (PSM). May function as a segmentation clock, which is essential for coordinated somite segmentation (By similarity).
Additional gene information for HES7 Gene
- Monarch Initiative
- Search for HES7 at DataMed
- Search for HES7 at HumanCyc
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HES7 Gene
Genomics for HES7 Gene
GeneHancer (GH) Regulatory Elements for HES7 Gene
Regulatory Element Products
Genomic Locations for HES7 Gene
- chr17:8,120,590-8,125,739
- (GRCh38/hg38)
- Size:
- 5,150 bases
- Orientation:
- Minus strand
- chr17:8,023,908-8,027,410
- (GRCh37/hg19)
Genomic View for HES7 Gene
- Cytogenetic band:
-
- 17p13.1 by Ensembl
- 17p13.1 by Entrez Gene
- 17p13.1 by HGNC


RefSeq DNA sequence for HES7 Gene
Proteins for HES7 Gene
-
Protein details for HES7 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9BYE0-HES7_HUMAN
- Recommended name:
- Transcription factor HES-7
- Protein Accession:
- Q9BYE0
- F8VPC9
Protein attributes for HES7 Gene
- Size:
- 225 amino acids
- Molecular mass:
- 24899 Da
- Quaternary structure:
-
- Transcription repression requires formation of a complex with a corepressor protein of the Groucho/TLE family.
Post-translational modifications for HES7 Gene
Other Protein References for HES7 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for HES7
- Novus Biologicals Antibodies for HES7
-
Abcam antibodies for HES7
- Invitrogen Antibodies for HES7
- GeneTex HES7 antibody for HES7
Protein Products
-
OriGene Purified Proteins for HES7
- Search Origene for MassSpec and Protein Over-expression Lysates for HES7
- Origene Custom Protein Services for HES7
- ProSpec Recombinant Proteins for HES7
- antibodies-online: Search results for 4 available HES7 Proteins ranked by validation data
- Compare Top HES7 Proteins
-
Quality Products:
- Search GeneTex for Proteins for HES7
-
Abcam proteins for HES7
Assay Products
- antibodies-online: Search results for available HES7 related products ranked by validation data
No data available for DME Specific Peptides for HES7 Gene
Domains & Families for HES7 Gene
Gene Families for HES7 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for HES7 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for HES7 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q9BYE0UniProtKB/Swiss-Prot:
HES7_HUMAN :- Has a particular type of basic domain which includes a helix-interrupting proline.
- Domain:
-
- Has a particular type of basic domain which includes a helix-interrupting proline.
- The C-terminal WRPW motif is a transcriptional repression motif which is necessary for interaction with Groucho/TLE family members, transcriptional corepressors recruited to specific target DNA by Hairy-related proteins.
Function for HES7 Gene
Molecular function for HES7 Gene
- UniProtKB/Swiss-Prot Function:
- Transcriptional repressor. Represses transcription from both N box- and E box-containing promoters. May with HES1, cooperatively regulate somite formation in the presomitic mesoderm (PSM). May function as a segmentation clock, which is essential for coordinated somite segmentation (By similarity).
Phenotypes From GWAS Catalog for HES7 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000977 | RNA polymerase II regulatory region sequence-specific DNA binding | IEA | -- |
GO:0003677 | DNA binding | IEA,NAS | 11260262 |
GO:0008134 | transcription factor binding | NAS | 17611704 |
GO:0046983 | protein dimerization activity | IEA | -- |
Phenotypes for HES7 Gene
- MGI mutant phenotypes for HES7:
- inferred from 5 alleles
- GenomeRNAi human phenotypes for HES7:
Animal Models for HES7 Gene
- MGI Knock Outs for HES7:
-
- Hes7 tm1Kag
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for HES7
-
-
ViGene Biosciences lentiviral particle packaged cDNA for HES7 gene
- Search ViGene Biosciences for HES7
CRISPR Products
-
OriGene CRISPR knockouts for HES7
- genomics-online: gRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- Applied Biological Materials CRISPR for HES7
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HES7
- GenScript: Design CRISPR guide RNA sequences for HES7
miRNA for HES7 Gene
- miRTarBase miRNAs that target HES7
-
- hsa-mir-5089-5p (MIRT482738)
- hsa-mir-6720-5p (MIRT482739)
- hsa-mir-6512-3p (MIRT482740)
- hsa-mir-4769-5p (MIRT482741)
- hsa-mir-4654 (MIRT482742)
- hsa-mir-885-3p (MIRT482743)
- hsa-mir-505-5p (MIRT482744)
- hsa-mir-873-3p (MIRT482745)
- hsa-mir-6868-5p (MIRT482746)
- hsa-mir-6786-5p (MIRT482747)
- hsa-mir-1281 (MIRT482748)
- hsa-mir-8073 (MIRT482749)
- hsa-mir-221-5p (MIRT482750)
- hsa-mir-5009-3p (MIRT482751)
- hsa-mir-4671-5p (MIRT482752)
- hsa-mir-6849-3p (MIRT482753)
- hsa-mir-4463 (MIRT482754)
- hsa-mir-3684 (MIRT508347)
- hsa-mir-766-3p (MIRT508348)
- hsa-mir-4738-5p (MIRT508349)
- hsa-mir-5586-5p (MIRT508350)
- hsa-mir-508-5p (MIRT508351)
- hsa-mir-605-5p (MIRT508352)
- hsa-mir-548x-3p (MIRT508353)
- hsa-mir-548j-3p (MIRT508354)
- hsa-mir-548aq-3p (MIRT508355)
- hsa-mir-548am-3p (MIRT508356)
- hsa-mir-548aj-3p (MIRT508357)
- hsa-mir-548ah-3p (MIRT508358)
- hsa-mir-548ae-3p (MIRT508359)
- hsa-mir-4693-5p (MIRT541221)
- hsa-mir-5582-3p (MIRT541222)
miRNA Products
- Search ViGene Biosciences for HES7
Inhibitory RNA Products
- Origene shrna, RNAi, and sirna products in human, mouse, rat for HES7
- Browse OriGene Inhibitory RNA Products For HES7
- genomics-online: shRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- Search ViGene Biosciences for HES7
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for HES7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HES7
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for HES7
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for HES7
-
ViGene Biosciences adenoviral particle packaged cDNA for HES7 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for HES7 gene
- Search ViGene Biosciences for HES7
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HES7 Gene
Localization for HES7 Gene
Subcellular locations from UniProtKB/Swiss-Prot for HES7 Gene
- Nucleus.
- Nucleoplasm (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005634 | nucleus | NAS,IEA | 11260262 |
Pathways & Interactions for HES7 Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | PI3K-Akt signaling pathway | ||
2 | Gene regulatory network modelling somitogenesis | ||
3 | Mesodermal Commitment Pathway |
Pathways by source for HES7 Gene
2 BioSystems pathways for HES7 Gene
1 KEGG pathway for HES7 Gene
Interacting Proteins for HES7 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000122 | negative regulation of transcription by RNA polymerase II | IEA | -- |
GO:0001501 | skeletal system development | IEA | -- |
GO:0001756 | somitogenesis | IEA | -- |
GO:0006351 | transcription, DNA-templated | IEA | -- |
GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
No data available for SIGNOR curated interactions for HES7 Gene
Transcripts for HES7 Gene
mRNA/cDNA for HES7 Gene
- (4) REFSEQ mRNAs :
- (2) Additional mRNA sequences :
- (13) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for HES7 Gene
CRISPR Products
-
OriGene CRISPR knockouts for HES7
- genomics-online: gRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- Applied Biological Materials CRISPR for HES7
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for HES7
- GenScript: Design CRISPR guide RNA sequences for HES7
miRNA Products
- Search ViGene Biosciences for HES7
Inhibitory RNA Products
- Origene shrna, RNAi, and sirna products in human, mouse, rat for HES7
- Browse OriGene Inhibitory RNA Products For HES7
- genomics-online: shRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- Search ViGene Biosciences for HES7
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for HES7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HES7
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for HES7
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4a | · | 4b | · | 4c |
---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | ||||||||||
SP2: |
Expression for HES7 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Paraxial Mesoderm (Gastrulation Derivatives)
- Paraxial Mesoderm Cells Trunk Mesoderm
- Presegmented Somitic Mesenchyme Cells Presomitic Mesoderm
- Presomitic Mesoderm Cells Presomitic Mesoderm
- Paraxial Mesoderm Cells Paraxial Mesoderm
-
Mesoderm (Gastrulation Derivatives)
- Paraxial Mesoderm Cells Trunk Mesoderm
- Paraxial Mesoderm Cells Paraxial Mesoderm
-
Somite (Muscoskeletal System)
- Presegmented Somitic Mesenchyme Cells Presomitic Mesoderm
- Presomitic Mesoderm Cells Presomitic Mesoderm
mRNA differential expression in normal tissues according to GTEx for HES7 Gene
NURSA nuclear receptor signaling pathways regulating expression of HES7 Gene:
HES7SOURCE GeneReport for Unigene cluster for HES7 Gene:
Hs.434828Phenotype-based relationships between genes and organs from Gene ORGANizer for HES7 Gene
- ectoderm
- endoderm
- mesoderm
- cardiovascular
- immune
- integumentary
- lymphatic
- nervous
- respiratory
- skeleton
- brain
- head
- jaw
- mandible
- maxilla
- meninges
- mouth
- neck
- skull
- tooth
- chest wall
- lung
- rib
- rib cage
- sternum
- pelvis
- digit
- finger
- hand
- upper limb
- blood vessel
- skin
- spinal column
- spinal cord
- vertebrae
Primer Products
-
OriGene qPCR primer pairs for HES7
No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for HES7 Gene
Orthologs for HES7 Gene
This gene was present in the common ancestor of chordates.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | HES7 34 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Hes7 33 16 34 |
|
||
cow (Bos Taurus) |
Mammalia | HES7 33 34 |
|
||
dog (Canis familiaris) |
Mammalia | HES7 33 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Hes7 33 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | HES7 34 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | HES7 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | LOC100135364 33 |
|
||
African clawed frog (Xenopus laevis) |
Amphibia | LOC398356 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | her5 34 |
|
OneToOne |
- Species where no ortholog for HES7 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for HES7 Gene
No data available for Paralogs for HES7 Gene
Variants for HES7 Gene
SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs113994160 | pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] | 8,123,096(-) | G/A | coding_sequence_variant, missense_variant | |
rs387906978 | pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] | 8,121,693(-) | C/A | coding_sequence_variant, missense_variant | |
rs387906979 | pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] | 8,122,397(-) | T/C | coding_sequence_variant, missense_variant | |
rs398122970 | pathogenic, Spondylocostal dysostosis 5 | 8,121,855(-) | GGGGCGGTTTGGGGCG/GGGGCGGTTTGGGGCGGTTTGGGGCG | coding_sequence_variant, frameshift | |
rs200833034 | uncertain-significance, not specified | 8,121,844(-) | C/T | coding_sequence_variant, synonymous_variant |
Additional Variant Information for HES7 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HES7 Gene
Disorders for HES7 Gene

(11) MalaCards diseases for HES7 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
spondylocostal dysostosis 4, autosomal recessive |
|
|
spondylocostal dysostosis 4 |
|
|
spondylocostal dysostosis 5 |
|
|
spondylocostal dysostosis, autosomal recessive |
|
|
spondylocostal dysostosis 1, autosomal recessive |
|
|
UniProtKB/Swiss-Prot
HES7_HUMAN- Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686]: A rare condition of variable severity characterized by vertebral and costal anomalies. The main feature include dwarfism, vertebral fusion, hemivertebrae, posterior rib fusion, reduced rib number, and other rib malformations. {ECO:0000269 PubMed:18775957, ECO:0000269 PubMed:20087400}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for HES7
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for HES7 Gene
Publications for HES7 Gene
- Hes7: a bHLH-type repressor gene regulated by Notch and expressed in the presomitic mesoderm. (PMID: 11260262) Bessho Y … Kageyama R (Genes to cells : devoted to molecular & cellular mechanisms 2001) 2 3 4 58
- Risk of meningioma and common variation in genes related to innate immunity. (PMID: 20406964) Rajaraman P … Inskip PD (Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2010) 3 44 58
- Polymorphisms in innate immunity genes and risk of childhood leukemia. (PMID: 20438785) Han S … Kang D (Human immunology 2010) 3 44 58
- Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
- Two novel missense mutations in HAIRY-AND-ENHANCER-OF-SPLIT-7 in a family with spondylocostal dysostosis. (PMID: 20087400) Sparrow DB … Dunwoodie SL (European journal of human genetics : EJHG 2010) 3 4 58
Products for HES7 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for HES7
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for HES7
- Search Origene for MassSpec and Protein Over-expression Lysates for HES7
- Origene Custom Protein Services for HES7
- Origene shrna, sirna, and RNAi products in human, mouse, rat for HES7
- Browse OriGene Inhibitory RNA Products For HES7
- OriGene qPCR primer pairs for HES7
- OriGene CRISPR knockouts for HES7
- OriGene ORF clones in human for HES7
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For HES7
- GenScript: Next-day shipping of latest version cDNA ORF clones for HES7 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for HES7
- GenScript Custom Assay Services for HES7
- GenScript Custom overexpressing Cell Line Services for HES7
- GenScript: Design CRISPR guide RNA sequences for HES7
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for HES7
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for HES7
- Novus Biologicals proteins and lysates for HES7
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for HES7
- Abcam proteins for HES7
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- ProSpec Recombinant Proteins for HES7
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for HES7
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for HES7
- VectorBuilder custom plasmid, inducible vectors for HES7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HES7
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 54 available HES7 Antibodies ranked by validation data
- Compare Top HES7 Antibodies
- antibodies-online: Search results for available HES7 related products ranked by validation data
- antibodies-online: Search results for 4 available HES7 Proteins ranked by validation data
- Compare Top HES7 Proteins
- Quality Products:
- GeneTex HES7 antibody for HES7
- Search GeneTex for Proteins for HES7
- ViGene Biosciences adenoviral particle packaged cDNA for HES7 gene
- ViGene Biosciences lentiviral particle packaged cDNA for HES7 gene
- Search ViGene Biosciences for HES7
- Horizon Cell Lines for HES7
- genomics-online: cdna clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- orf clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- genomics-online: gRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- genomics-online: primer clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
- genomics-online: shRNA clones - Search results for 74 available HES7 gene related products
- Overview of 74 available HES7 gene related products
Sources for HES7 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew