Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HES7 Gene

Aliases for HES7 Gene

  • Hes Family BHLH Transcription Factor 7 2 3 5
  • BHLH Factor Hes7 2 3 4
  • Class B Basic Helix-Loop-Helix Protein 37 3 4
  • Hairy And Enhancer Of Split 7 3 4
  • BHLHb37 3 4
  • HHes7 3 4
  • Hairy And Enhancer Of Split 7 (Drosophila) 2
  • Transcription Factor HES-7 3
  • SCDO4 3

External Ids for HES7 Gene

Previous GeneCards Identifiers for HES7 Gene

  • GC17P008428
  • GC17M009113
  • GC17M007966
  • GC17M008226
  • GC17M008227
  • GC17M007965
  • GC17M008030
  • GC17M007919
  • GC17M008046
  • GC17M008051
  • GC17M008056
  • GC17M008060

Summaries for HES7 Gene

Entrez Gene Summary for HES7 Gene

  • This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]

GeneCards Summary for HES7 Gene

HES7 (Hes Family BHLH Transcription Factor 7) is a Protein Coding gene. Diseases associated with HES7 include Spondylocostal Dysostosis 4, Autosomal Recessive and Spondylocostal Dysostosis 4. Among its related pathways are Mesodermal Commitment Pathway and PI3K-Akt signaling pathway. Gene Ontology (GO) annotations related to this gene include transcription factor binding and protein dimerization activity.

UniProtKB/Swiss-Prot for HES7 Gene

  • Transcriptional repressor. Represses transcription from both N box- and E box-containing promoters. May with HES1, cooperatively regulate somite formation in the presomitic mesoderm (PSM). May function as a segmentation clock, which is essential for coordinated somite segmentation (By similarity).

Additional gene information for HES7 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HES7 Gene

Genomics for HES7 Gene

GeneHancer (GH) Regulatory Elements for HES7 Gene

Promoters and enhancers for HES7 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I008117 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 571.1 +4.5 4472 7.7 CLOCK FEZF1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 ZFP41 SSRP1 HES7 ALOXE3 GC17M008514 TRL-TAG1-1 TRQ-CTG1-5 TRR-TCT2-1 NEURL4 SENP3 NLGN2 DVL2
GH17I008126 Promoter/Enhancer 1.7 Ensembl ENCODE dbSUPER 570 -0.9 -851 2.1 HDGF ARID4B SIN3A FEZF1 ZNF2 ZNF213 ZNF207 ZNF143 FOS KLF13 HES7 LOC105376799 PIR51497 TRG-GCC2-6 NEURL4 SENP3 LOC100996842 DVL2 SNORD118 TMEM107
GH17I008125 Enhancer 0.5 ENCODE 550.8 +0.6 555 0 OSR2 ZBTB48 ZNF600 EZH2 HES7 PIR51497 TRG-GCC2-6 TRR-TCT2-1
GH17I007833 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.2 +286.0 286010 12.5 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF416 KDM6B DVL2 PFAS CTC1 WRAP53 CNTROB POLR2A SNORD10 SNORA48 PER1
GH17I007474 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.2 +645.2 645150 12.5 FEZF1 DMAP1 YBX1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC POLR2A ZBTB4 SLC35G6 DVL2 PFAS SNORD10 CTC1 WRAP53 SNORA48 CNTROB
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HES7 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HES7 gene promoter:

Genomic Locations for HES7 Gene

Genomic Locations for HES7 Gene
chr17:8,120,590-8,125,739
(GRCh38/hg38)
Size:
5,150 bases
Orientation:
Minus strand
chr17:8,023,908-8,027,410
(GRCh37/hg19)

Genomic View for HES7 Gene

Genes around HES7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HES7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HES7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HES7 Gene

Proteins for HES7 Gene

  • Protein details for HES7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BYE0-HES7_HUMAN
    Recommended name:
    Transcription factor HES-7
    Protein Accession:
    Q9BYE0
    Secondary Accessions:
    • F8VPC9

    Protein attributes for HES7 Gene

    Size:
    225 amino acids
    Molecular mass:
    24899 Da
    Quaternary structure:
    • Transcription repression requires formation of a complex with a corepressor protein of the Groucho/TLE family.

    Alternative splice isoforms for HES7 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for HES7 Gene

Post-translational modifications for HES7 Gene

No Post-translational modifications

Other Protein References for HES7 Gene

No data available for DME Specific Peptides for HES7 Gene

Domains & Families for HES7 Gene

Gene Families for HES7 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for HES7 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9BYE0

UniProtKB/Swiss-Prot:

HES7_HUMAN :
  • Has a particular type of basic domain which includes a helix-interrupting proline.
Domain:
  • Has a particular type of basic domain which includes a helix-interrupting proline.
  • The C-terminal WRPW motif is a transcriptional repression motif which is necessary for interaction with Groucho/TLE family members, transcriptional corepressors recruited to specific target DNA by Hairy-related proteins.
genes like me logo Genes that share domains with HES7: view

Function for HES7 Gene

Molecular function for HES7 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional repressor. Represses transcription from both N box- and E box-containing promoters. May with HES1, cooperatively regulate somite formation in the presomitic mesoderm (PSM). May function as a segmentation clock, which is essential for coordinated somite segmentation (By similarity).

Phenotypes From GWAS Catalog for HES7 Gene

Gene Ontology (GO) - Molecular Function for HES7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000977 RNA polymerase II regulatory region sequence-specific DNA binding IEA --
GO:0003677 DNA binding IEA,NAS 11260262
GO:0008134 transcription factor binding NAS 17611704
GO:0046983 protein dimerization activity IEA --
genes like me logo Genes that share ontologies with HES7: view
genes like me logo Genes that share phenotypes with HES7: view

Human Phenotype Ontology for HES7 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for HES7 Gene

MGI Knock Outs for HES7:

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HES7 Gene

Localization for HES7 Gene

Subcellular locations from UniProtKB/Swiss-Prot for HES7 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HES7 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for HES7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS,IEA 11260262
genes like me logo Genes that share ontologies with HES7: view

Pathways & Interactions for HES7 Gene

genes like me logo Genes that share pathways with HES7: view

Pathways by source for HES7 Gene

Interacting Proteins for HES7 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000446205%0d%0a9606.ENSP00000345206%0d%0a
Selected Interacting proteins: Q9BYE0-HES7_HUMAN ENSP00000446205 for HES7 Gene via IID STRING

Gene Ontology (GO) - Biological Process for HES7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0001501 skeletal system development IEA --
GO:0001756 somitogenesis IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with HES7: view

No data available for SIGNOR curated interactions for HES7 Gene

Drugs & Compounds for HES7 Gene

No Compound Related Data Available

Transcripts for HES7 Gene

mRNA/cDNA for HES7 Gene

(4) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(13) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HES7 Gene

Hairy and enhancer of split 7 (Drosophila):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HES7 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4a · 4b · 4c
SP1: -
SP2:

Relevant External Links for HES7 Gene

GeneLoc Exon Structure for
HES7
ECgene alternative splicing isoforms for
HES7

Expression for HES7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HES7 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for HES7 Gene

This gene is overexpressed in Brain - Cerebellar Hemisphere (x6.7) and Brain - Cerebellum (x6.6).

NURSA nuclear receptor signaling pathways regulating expression of HES7 Gene:

HES7

SOURCE GeneReport for Unigene cluster for HES7 Gene:

Hs.434828

Phenotype-based relationships between genes and organs from Gene ORGANizer for HES7 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • immune
  • integumentary
  • lymphatic
  • nervous
  • respiratory
  • skeleton
Organs:
Head and neck:
  • brain
  • head
  • jaw
  • mandible
  • maxilla
  • meninges
  • mouth
  • neck
  • skull
  • tooth
Thorax:
  • chest wall
  • lung
  • rib
  • rib cage
  • sternum
Pelvis:
  • pelvis
Limb:
  • digit
  • finger
  • hand
  • upper limb
General:
  • blood vessel
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with HES7: view

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for HES7 Gene

Orthologs for HES7 Gene

This gene was present in the common ancestor of chordates.

Orthologs for HES7 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia HES7 34
  • 99 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Hes7 33 16 34
  • 92 (n)
cow
(Bos Taurus)
Mammalia HES7 33 34
  • 91.3 (n)
dog
(Canis familiaris)
Mammalia HES7 33 34
  • 90.98 (n)
rat
(Rattus norvegicus)
Mammalia Hes7 33
  • 90.37 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia HES7 34
  • 54 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia HES7 34
  • 31 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100135364 33
  • 61.16 (n)
African clawed frog
(Xenopus laevis)
Amphibia LOC398356 33
zebrafish
(Danio rerio)
Actinopterygii her5 34
  • 32 (a)
OneToOne
Species where no ortholog for HES7 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HES7 Gene

ENSEMBL:
Gene Tree for HES7 (if available)
TreeFam:
Gene Tree for HES7 (if available)

Paralogs for HES7 Gene

No data available for Paralogs for HES7 Gene

Variants for HES7 Gene

Sequence variations from dbSNP and Humsavar for HES7 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs113994160 pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] 8,123,096(-) G/A coding_sequence_variant, missense_variant
rs387906978 pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] 8,121,693(-) C/A coding_sequence_variant, missense_variant
rs387906979 pathogenic, Spondylocostal dysostosis 5, Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686] 8,122,397(-) T/C coding_sequence_variant, missense_variant
rs398122970 pathogenic, Spondylocostal dysostosis 5 8,121,855(-) GGGGCGGTTTGGGGCG/GGGGCGGTTTGGGGCGGTTTGGGGCG coding_sequence_variant, frameshift
rs200833034 uncertain-significance, not specified 8,121,844(-) C/T coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for HES7 Gene

Variant ID Type Subtype PubMed ID
nsv457661 CNV loss 19166990
nsv574335 CNV loss 21841781
nsv833352 CNV loss 17160897

Variation tolerance for HES7 Gene

Gene Damage Index Score: 0.51; 11.15% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HES7 Gene

Human Gene Mutation Database (HGMD)
HES7
SNPedia medical, phenotypic, and genealogical associations of SNPs for
HES7

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HES7 Gene

Disorders for HES7 Gene

MalaCards: The human disease database

(11) MalaCards diseases for HES7 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search HES7 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

HES7_HUMAN
  • Spondylocostal dysostosis 4, autosomal recessive (SCDO4) [MIM:613686]: A rare condition of variable severity characterized by vertebral and costal anomalies. The main feature include dwarfism, vertebral fusion, hemivertebrae, posterior rib fusion, reduced rib number, and other rib malformations. {ECO:0000269 PubMed:18775957, ECO:0000269 PubMed:20087400}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for HES7

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HES7: view

No data available for Genatlas for HES7 Gene

Publications for HES7 Gene

  1. Hes7: a bHLH-type repressor gene regulated by Notch and expressed in the presomitic mesoderm. (PMID: 11260262) Bessho Y … Kageyama R (Genes to cells : devoted to molecular & cellular mechanisms 2001) 2 3 4 58
  2. Risk of meningioma and common variation in genes related to innate immunity. (PMID: 20406964) Rajaraman P … Inskip PD (Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2010) 3 44 58
  3. Polymorphisms in innate immunity genes and risk of childhood leukemia. (PMID: 20438785) Han S … Kang D (Human immunology 2010) 3 44 58
  4. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
  5. Two novel missense mutations in HAIRY-AND-ENHANCER-OF-SPLIT-7 in a family with spondylocostal dysostosis. (PMID: 20087400) Sparrow DB … Dunwoodie SL (European journal of human genetics : EJHG 2010) 3 4 58

Products for HES7 Gene

Sources for HES7 Gene

Content
Loading form....