Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FOXN1 Gene

Aliases for FOXN1 Gene

  • Forkhead Box N1 2 3 5
  • Winged-Helix Transcription Factor Nude 3 4
  • Winged-Helix Nude 2 3
  • Rowett Nude 2 3
  • RONU 3 4
  • WHN 3 4
  • Forkhead Box Protein N1 3
  • FKHL20 3

External Ids for FOXN1 Gene

Previous HGNC Symbols for FOXN1 Gene

  • WHN
  • RONU

Previous GeneCards Identifiers for FOXN1 Gene

  • GC17P026702
  • GC17P026996
  • GC17P023875
  • GC17P026850
  • GC17P023059

Summaries for FOXN1 Gene

Entrez Gene Summary for FOXN1 Gene

  • Mutations in the winged-helix transcription factor gene at the nude locus in mice and rats produce the pleiotropic phenotype of hairlessness and athymia, resulting in a severely compromised immune system. This gene is orthologous to the mouse and rat genes and encodes a similar DNA-binding transcription factor that is thought to regulate keratin gene expression. A mutation in this gene has been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing in the 5' UTR of this gene has been observed. [provided by RefSeq, Jul 2008]

GeneCards Summary for FOXN1 Gene

FOXN1 (Forkhead Box N1) is a Protein Coding gene. Diseases associated with FOXN1 include T-Cell Immunodeficiency, Congenital Alopecia, And Nail Dystrophy and Alopecia And T-Cell Immunodeficiency. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and RNA polymerase II transcription factor activity, sequence-specific DNA binding. An important paralog of this gene is FOXN4.

UniProtKB/Swiss-Prot for FOXN1 Gene

  • Transcriptional regulator which regulates the development, differentiation, and function of thymic epithelial cells (TECs) both in the prenatal and postnatal thymus. Acts as a master regulator of the TECs lineage development and is required from the onset of differentiation in progenitor TECs in the developing fetus to the final differentiation steps through which TECs mature to acquire their full functionality. Regulates, either directly or indirectly the expression of a variety of genes that mediate diverse aspects of thymus development and function, including MHC Class II, DLL4, CCL25, CTSL, CD40 and PAX1. Regulates the differentiation of the immature TECs into functional cortical TECs (cTECs) and medullary TECs (mTECs). Essential for maintenance of mTECs population in the postnatal thymus. Involved in the morphogenesis and maintenance of the three-dimensional thymic microstructure which is necessary for a fully functional thymus. Plays an important role in the maintenance of hematopoiesis and particularly T lineage progenitors within the bone marrow niche with age. Essential for the vascularization of the thymus anlage. Promotes the terminal differentiation of epithelial cells in the epidermis and hair follicles, partly by negatively regulating the activity of protein kinase C (By similarity). Plays a crucial role in the early prenatal stages of T-cell ontogeny (PubMed:21507891).

Gene Wiki entry for FOXN1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FOXN1 Gene

Genomics for FOXN1 Gene

Regulatory Elements for FOXN1 Gene

Enhancers for FOXN1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17G028480 0.8 ENCODE dbSUPER 17.5 -25.3 -25274 1.6 ZNF280D ZNF621 ZNF26 ZNF530 SALL2 FOXN1 ENSG00000264577 SLC46A1 UNC119 PIGS TMEM97 SLC13A2
GH17G028546 1 ENCODE 12.1 +44.2 44181 7.7 HDGF PKNOX1 AGO1 ARID4B SIN3A GLI4 ZNF48 YY1 GLIS2 ZNF143 ENSG00000264577 NUFIP2 ENSG00000264044 LOC101927018 PHF12 ENSG00000265205 PIGS SDF2 FOXN1 ALDOC
GH17G028507 0.8 ENCODE dbSUPER 12 +1.8 1798 0.8 ZNF747 KDM1A EBF1 PRDM1 FOXN1 PIGS SPAG5-AS1 SGK494 SLC46A1 GC17P028538
GH17G028524 1.2 Ensembl ENCODE dbSUPER 7.6 +19.3 19271 2.2 TBP TFAP4 NFIA HLF CEBPB CEBPG ZNF398 ZIC2 TEAD3 GLIS2 FOXN1 PROCA1 GC17P028538
GH17G028526 1.2 ENCODE dbSUPER 7.5 +21.7 21730 2.3 ATF1 ARNT E2F7 TCF12 ZNF766 CBX5 ELK1 GATA2 NCOA1 MEF2D UNC119 PIGS FOXN1 ENSG00000265205 GC17P028538
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FOXN1 on UCSC Golden Path with GeneCards custom track

Genomic Location for FOXN1 Gene

Chromosome:
17
Start:
28,506,229 bp from pter
End:
28,538,900 bp from pter
Size:
32,672 bases
Orientation:
Plus strand

Genomic View for FOXN1 Gene

Genes around FOXN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FOXN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FOXN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FOXN1 Gene

Proteins for FOXN1 Gene

  • Protein details for FOXN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15353-FOXN1_HUMAN
    Recommended name:
    Forkhead box protein N1
    Protein Accession:
    O15353
    Secondary Accessions:
    • B2R9Q7
    • O15352

    Protein attributes for FOXN1 Gene

    Size:
    648 amino acids
    Molecular mass:
    68925 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FOXN1 Gene

Post-translational modifications for FOXN1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for FOXN1 Gene

Domains & Families for FOXN1 Gene

Gene Families for FOXN1 Gene

Protein Domains for FOXN1 Gene

Suggested Antigen Peptide Sequences for FOXN1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with FOXN1: view

No data available for UniProtKB/Swiss-Prot for FOXN1 Gene

Function for FOXN1 Gene

Molecular function for FOXN1 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional regulator which regulates the development, differentiation, and function of thymic epithelial cells (TECs) both in the prenatal and postnatal thymus. Acts as a master regulator of the TECs lineage development and is required from the onset of differentiation in progenitor TECs in the developing fetus to the final differentiation steps through which TECs mature to acquire their full functionality. Regulates, either directly or indirectly the expression of a variety of genes that mediate diverse aspects of thymus development and function, including MHC Class II, DLL4, CCL25, CTSL, CD40 and PAX1. Regulates the differentiation of the immature TECs into functional cortical TECs (cTECs) and medullary TECs (mTECs). Essential for maintenance of mTECs population in the postnatal thymus. Involved in the morphogenesis and maintenance of the three-dimensional thymic microstructure which is necessary for a fully functional thymus. Plays an important role in the maintenance of hematopoiesis and particularly T lineage progenitors within the bone marrow niche with age. Essential for the vascularization of the thymus anlage. Promotes the terminal differentiation of epithelial cells in the epidermis and hair follicles, partly by negatively regulating the activity of protein kinase C (By similarity). Plays a crucial role in the early prenatal stages of T-cell ontogeny (PubMed:21507891).

Gene Ontology (GO) - Molecular Function for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding IBA --
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding IEA --
GO:0003677 DNA binding IEA --
GO:0003700 transcription factor activity, sequence-specific DNA binding IEA --
GO:0043565 sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with FOXN1: view
genes like me logo Genes that share phenotypes with FOXN1: view

Human Phenotype Ontology for FOXN1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for FOXN1 Gene

MGI Knock Outs for FOXN1:

Animal Model Products

CRISPR Products

miRNA for FOXN1 Gene

miRTarBase miRNAs that target FOXN1

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for FOXN1 Gene

Localization for FOXN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FOXN1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FOXN1 gene
Compartment Confidence
nucleus 5
cytosol 2

Gene Ontology (GO) - Cellular Components for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS,IBA --
genes like me logo Genes that share ontologies with FOXN1: view

Pathways & Interactions for FOXN1 Gene

SuperPathways for FOXN1 Gene

No Data Available

SIGNOR curated interactions for FOXN1 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for FOXN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001942 hair follicle development IEA --
GO:0002260 lymphocyte homeostasis IEA --
GO:0002360 T cell lineage commitment IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with FOXN1: view

No data available for Pathways by source for FOXN1 Gene

Drugs & Compounds for FOXN1 Gene

No Compound Related Data Available

Transcripts for FOXN1 Gene

mRNA/cDNA for FOXN1 Gene

(13) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(3) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FOXN1 Gene

Forkhead box N1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for FOXN1 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8
SP1:
SP2:

Relevant External Links for FOXN1 Gene

GeneLoc Exon Structure for
FOXN1
ECgene alternative splicing isoforms for
FOXN1

Expression for FOXN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FOXN1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FOXN1 Gene

This gene is overexpressed in Skin - Sun Exposed (Lower leg) (x18.8), Skin - Not Sun Exposed (Suprapubic) (x17.1), Esophagus - Mucosa (x8.0), and Vagina (x4.2).

Protein differential expression in normal tissues from HIPED for FOXN1 Gene

This gene is overexpressed in Heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FOXN1 Gene



Protein tissue co-expression partners for FOXN1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of FOXN1 Gene:

FOXN1

SOURCE GeneReport for Unigene cluster for FOXN1 Gene:

Hs.663679

mRNA Expression by UniProt/SwissProt for FOXN1 Gene:

O15353-FOXN1_HUMAN
Tissue specificity: Expressed in thymus.

Evidence on tissue expression from TISSUES for FOXN1 Gene

  • Skin(2.7)
  • Blood(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FOXN1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • immune
  • integumentary
  • lymphatic
Organs:
Limb:
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
General:
  • blood
  • bone marrow
  • hair
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with FOXN1: view

Primer Products

Orthologs for FOXN1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for FOXN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FOXN1 35 34
  • 99.13 (n)
OneToOne
dog
(Canis familiaris)
Mammalia FOXN1 35 34
  • 90.2 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FOXN1 35 34
  • 89.49 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Foxn1 16 35 34
  • 85.13 (n)
rat
(Rattus norvegicus)
Mammalia Foxn1 34
  • 83.95 (n)
oppossum
(Monodelphis domestica)
Mammalia FOXN1 35
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia FOXN1 35
  • 65 (a)
OneToOne
chicken
(Gallus gallus)
Aves FOXN1 35 34
  • 63.57 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FOXN1 35
  • 64 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia foxn1 34
  • 59.5 (n)
zebrafish
(Danio rerio)
Actinopterygii foxn1 34 35
  • 58.73 (n)
fruit fly
(Drosophila melanogaster)
Insecta jumu 35
  • 21 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes FHL1 35
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 68 (a)
OneToMany
Species where no ortholog for FOXN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FOXN1 Gene

ENSEMBL:
Gene Tree for FOXN1 (if available)
TreeFam:
Gene Tree for FOXN1 (if available)

Paralogs for FOXN1 Gene

Paralogs for FOXN1 Gene

genes like me logo Genes that share paralogs with FOXN1: view

Variants for FOXN1 Gene

Sequence variations from dbSNP and Humsavar for FOXN1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs104894562 Pathogenic 28,529,157(+) ACCAG(C/T)GAATG reference, stop-gained
rs797046135 Likely pathogenic 28,524,525(+) CTGCT(C/T)GTCAT intron-variant, upstream-variant-2KB, reference, missense
rs886043619 Likely pathogenic 28,534,766(+) TGGGC(-/TGTCCGCCCCCTGGGCTGTCCGGCTCAGGCC)CCATC intron-variant, reference, frameshift-variant
rs202144980 Likely benign 28,524,929(+) ACGGG(A/C)TCCCC intron-variant, upstream-variant-2KB, reference, missense
rs35240903 Likely benign 28,529,108(+) GGTGG(C/T)GGCAG reference, synonymous-codon

Structural Variations from Database of Genomic Variants (DGV) for FOXN1 Gene

Variant ID Type Subtype PubMed ID
nsv1064087 CNV gain 25217958
nsv1064958 CNV loss 25217958

Variation tolerance for FOXN1 Gene

Residual Variation Intolerance Score: 70.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.08; 87.65% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FOXN1 Gene

Human Gene Mutation Database (HGMD)
FOXN1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FOXN1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FOXN1 Gene

Disorders for FOXN1 Gene

MalaCards: The human disease database

(6) MalaCards diseases for FOXN1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search FOXN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

FOXN1_HUMAN
  • T-cell immunodeficiency, congenital alopecia, and nail dystrophy (TIDAND) [MIM:601705]: A disorder characterized by the association of congenital alopecia, severe T-cell immunodeficiency, and ridging and pitting of all nails. {ECO:0000269 PubMed:10206641, ECO:0000269 PubMed:21507891}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for FOXN1

Genetic Association Database (GAD)
FOXN1
Human Genome Epidemiology (HuGE) Navigator
FOXN1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FOXN1
genes like me logo Genes that share disorders with FOXN1: view

No data available for Genatlas for FOXN1 Gene

Publications for FOXN1 Gene

  1. Characterization of mouse and human nude genes. (PMID: 9321431) Schorpp M. … Boehm T. (Immunogenetics 1997) 2 3 4 22 64
  2. FOXN1 mutation abrogates prenatal T-cell development in humans. (PMID: 21507891) Vigliano I. … Pignata C. (J. Med. Genet. 2011) 3 4 64
  3. Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PMID: 20634891) Jugessur A. … Murray J.C. (PLoS ONE 2010) 3 46 64
  4. Human clinical phenotype associated with FOXN1 mutations. (PMID: 20429426) Pignata C. … Amorosi S. (Adv. Exp. Med. Biol. 2009) 3 22 64
  5. Forkhead/winged-helix transcription factor Whn regulates hair keratin gene expression: molecular analysis of the nude skin phenotype. (PMID: 10767081) Schlake T. … Boehm T. (Dev. Dyn. 2000) 3 22 64

Products for FOXN1 Gene

Sources for FOXN1 Gene

Content
Loading form....