Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC22A1 Gene

Aliases for SLC22A1 Gene

  • Solute Carrier Family 22 Member 1 2 3 5
  • Organic Cation Transporter 1 2 3 4
  • Solute Carrier Family 22 (Organic Cation Transporter), Member 1 2 3
  • HOCT1 3 4
  • OCT1 3 4
  • Oct1_cds 3

External Ids for SLC22A1 Gene

Previous GeneCards Identifiers for SLC22A1 Gene

  • GC06P159982
  • GC06P160416
  • GC06P160452
  • GC06P160513
  • GC06P160462
  • GC06P158013
  • GC06P160542

Summaries for SLC22A1 Gene

Entrez Gene Summary for SLC22A1 Gene

  • Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. Two transcript variants encoding two different isoforms have been found for this gene, but only the longer variant encodes a functional transporter. [provided by RefSeq, Jul 2008]

GeneCards Summary for SLC22A1 Gene

SLC22A1 (Solute Carrier Family 22 Member 1) is a Protein Coding gene. Diseases associated with SLC22A1 include Leukemia, Chronic Myeloid. Among its related pathways are Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds and Abacavir transport and metabolism. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and transmembrane transporter activity. An important paralog of this gene is SLC22A2.

UniProtKB/Swiss-Prot for SLC22A1 Gene

  • Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnicotinamide (NMN), 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP), the endogenous compounds choline, guanidine, histamine, epinephrine, adrenaline, noradrenaline and dopamine, and the drugs quinine, and metformin. The transport of organic cations is inhibited by a broad array of compounds like tetramethylammonium (TMA), cocaine, lidocaine, NMDA receptor antagonists, atropine, prazosin, cimetidine, TEA and NMN, guanidine, cimetidine, choline, procainamide, quinine, tetrabutylammonium, and tetrapentylammonium. Translocates organic cations in an electrogenic and pH-independent manner. Translocates organic cations across the plasma membrane in both directions. Transports the polyamines spermine and spermidine. Transports pramipexole across the basolateral membrane of the proximal tubular epithelial cells. The choline transport is activated by MMTS. Regulated by various intracellular signaling pathways including inhibition by protein kinase A activation, and endogenously activation by the calmodulin complex, the calmodulin-dependent kinase II and LCK tyrosine kinase.

Gene Wiki entry for SLC22A1 Gene

PharmGKB "VIP" Summary for SLC22A1 Gene

Additional gene information for SLC22A1 Gene

No data available for CIViC summary , Tocris Summary , fRNAdb sequence ontologies and piRNA Summary for SLC22A1 Gene

Genomics for SLC22A1 Gene

GeneHancer (GH) Regulatory Elements for SLC22A1 Gene

Promoters and enhancers for SLC22A1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06I160121 Promoter 0.8 EPDnew 550.8 +0.1 78 0.1 ATF3 MAX HNF4A REST YY1 SLC22A1 ENSG00000216516
GH06I159966 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 5.2 -153.1 -153061 5.5 HDGF PKNOX1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B IGF2R MAS1 ENSG00000236823 SLC22A1 LOC729603 LOC105378087
GH06I160088 Enhancer 0.6 ENCODE 21.6 -31.8 -31802 3.7 CTCF HLF ZNF143 SMC3 REST FOS HNF4A RAD21 SLC22A1 LOC729603 MAS1 ENSG00000236823 GC06P160076 PIR43380 GC06P160073 IGF2R
GH06I159975 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 7.1 -140.7 -140706 10.2 HDGF PKNOX1 SMAD1 ARID4B SIN3A FEZF1 ZNF2 IRF4 YY1 ZNF207 IGF2R WTAP MAS1 SOD2 ENSG00000236823 SLC22A1 AIRN
GH06I160138 Enhancer 1.1 Ensembl ENCODE 11.5 +17.3 17269 2 PKNOX1 FOXA2 ARNT BATF DNMT3B RAD21 ZNF143 FOS RUNX3 MIXL1 SLC22A1 SLC22A3 ENSG00000216516
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SLC22A1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SLC22A1 gene promoter:

Genomic Locations for SLC22A1 Gene

Genomic Locations for SLC22A1 Gene
37,410 bases
Plus strand

Genomic View for SLC22A1 Gene

Genes around SLC22A1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC22A1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC22A1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC22A1 Gene

Proteins for SLC22A1 Gene

  • Protein details for SLC22A1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Solute carrier family 22 member 1
    Protein Accession:
    Secondary Accessions:
    • A6NFF3
    • A8K1H2
    • C9JSU6
    • O15395
    • Q9NQD4

    Protein attributes for SLC22A1 Gene

    554 amino acids
    Molecular mass:
    61154 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SLC22A1 Gene


neXtProt entry for SLC22A1 Gene

Post-translational modifications for SLC22A1 Gene

No data available for DME Specific Peptides for SLC22A1 Gene

Domains & Families for SLC22A1 Gene

Gene Families for SLC22A1 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins
  • Transporters

Suggested Antigen Peptide Sequences for SLC22A1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family.
  • Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family.
genes like me logo Genes that share domains with SLC22A1: view

Function for SLC22A1 Gene

Molecular function for SLC22A1 Gene

GENATLAS Biochemistry:
solute carrier family 22,member A1,polyspecific transporter for organic cations,mainly expressed in liver
UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=1.47 mM for metformin {ECO:0000269 PubMed:16272756, ECO:0000269 PubMed:9187257, ECO:0000269 PubMed:9655880}; KM=229 uM for TEA {ECO:0000269 PubMed:16272756, ECO:0000269 PubMed:9187257, ECO:0000269 PubMed:9655880}; KM=14.6 uM for MPP {ECO:0000269 PubMed:16272756, ECO:0000269 PubMed:9187257, ECO:0000269 PubMed:9655880}; Vmax=396 pmol/min/mg enzyme for metformin uptake {ECO:0000269 PubMed:16272756, ECO:0000269 PubMed:9187257, ECO:0000269 PubMed:9655880}; Vmax=2.89 nmol/min/mg enzyme for TEA uptake {ECO:0000269 PubMed:16272756, ECO:0000269 PubMed:9187257, ECO:0000269 PubMed:9655880};
UniProtKB/Swiss-Prot Function:
Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnicotinamide (NMN), 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP), the endogenous compounds choline, guanidine, histamine, epinephrine, adrenaline, noradrenaline and dopamine, and the drugs quinine, and metformin. The transport of organic cations is inhibited by a broad array of compounds like tetramethylammonium (TMA), cocaine, lidocaine, NMDA receptor antagonists, atropine, prazosin, cimetidine, TEA and NMN, guanidine, cimetidine, choline, procainamide, quinine, tetrabutylammonium, and tetrapentylammonium. Translocates organic cations in an electrogenic and pH-independent manner. Translocates organic cations across the plasma membrane in both directions. Transports the polyamines spermine and spermidine. Transports pramipexole across the basolateral membrane of the proximal tubular epithelial cells. The choline transport is activated by MMTS. Regulated by various intracellular signaling pathways including inhibition by protein kinase A activation, and endogenously activation by the calmodulin complex, the calmodulin-dependent kinase II and LCK tyrosine kinase.
UniProtKB/Swiss-Prot Induction:
In the liver activated by HNF4A and suppressed by bile acids via NR0B2. Increased by cholesterol treatment in hepatocyte cells.

Phenotypes From GWAS Catalog for SLC22A1 Gene

Gene Ontology (GO) - Molecular Function for SLC22A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005277 acetylcholine transmembrane transporter activity IBA --
GO:0005329 dopamine transmembrane transporter activity IBA --
GO:0005333 norepinephrine transmembrane transporter activity IBA --
GO:0005515 protein binding IPI 11543633
GO:0008504 monoamine transmembrane transporter activity IEA --
genes like me logo Genes that share ontologies with SLC22A1: view
genes like me logo Genes that share phenotypes with SLC22A1: view

Animal Models for SLC22A1 Gene

MGI Knock Outs for SLC22A1:

Animal Model Products

  • Taconic Biosciences Mouse Models for SLC22A1

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SLC22A1 Gene

Localization for SLC22A1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SLC22A1 Gene

Basolateral cell membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SLC22A1 gene
Compartment Confidence
plasma membrane 5
peroxisome 1
nucleus 1

Gene Ontology (GO) - Cellular Components for SLC22A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane TAS 9187257
GO:0016020 membrane TAS 9187257
GO:0016021 integral component of membrane IEA --
GO:0016323 basolateral plasma membrane IEA --
genes like me logo Genes that share ontologies with SLC22A1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SLC22A1 Gene

Pathways & Interactions for SLC22A1 Gene

genes like me logo Genes that share pathways with SLC22A1: view

Gene Ontology (GO) - Biological Process for SLC22A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
GO:0006811 ion transport IEA --
GO:0006812 cation transport IEA --
GO:0006836 neurotransmitter transport IBA --
GO:0006855 drug transmembrane transport TAS --
genes like me logo Genes that share ontologies with SLC22A1: view

No data available for SIGNOR curated interactions for SLC22A1 Gene

Drugs & Compounds for SLC22A1 Gene

(95) Drugs for SLC22A1 Gene - From: DrugBank, PharmGKB, FDA Approved Drugs, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Amantadine Approved Pharma Transporter, inhibitor 70
imatinib Approved Pharma Transporter, substrate, inhibitor Kinase Inhibitors, SRC/BCR-ABL tyrosine kinase inhibitors 0
Metformin Approved Pharma Transporter, substrate, inhibitor AMP-activated protein kinase (AMPK) activator 1891
Cimetidine Approved, Investigational Pharma Inhibition, Inhibitor, Transporter, substrate, inhibitor H2 receptor antagonist 81
Desipramine Approved, Investigational Pharma Transporter, inhibitor 39

(10) Additional Compounds for SLC22A1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • CGP74588
O-Desmethylverapamil (D-702)
genes like me logo Genes that share compounds with SLC22A1: view

Transcripts for SLC22A1 Gene

Unigene Clusters for SLC22A1 Gene

Solute carrier family 22 (organic cation transporter), member 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLC22A1 Gene

No ASD Table

Relevant External Links for SLC22A1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC22A1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SLC22A1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SLC22A1 Gene

This gene is overexpressed in Liver (x50.5).

Protein differential expression in normal tissues from HIPED for SLC22A1 Gene

This gene is overexpressed in Gallbladder (28.4), Liver (22.3), and Plasma (18.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SLC22A1 Gene

Protein tissue co-expression partners for SLC22A1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SLC22A1 Gene:


SOURCE GeneReport for Unigene cluster for SLC22A1 Gene:


mRNA Expression by UniProt/SwissProt for SLC22A1 Gene:

Tissue specificity: Widely expressed with high level in liver. Isoform 1 and isoform 2 are expressed in liver. Isoform 1, isoform 2, isoform 3 and isoform 4 are expressed in glial cell lines.

Evidence on tissue expression from TISSUES for SLC22A1 Gene

  • Liver(4.8)
  • Nervous system(4)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with SLC22A1: view

Primer Products

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for SLC22A1 Gene

Orthologs for SLC22A1 Gene

This gene was present in the common ancestor of animals.

Orthologs for SLC22A1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SLC22A1 33 34
  • 95.37 (n)
(Canis familiaris)
Mammalia SLC22A1 33 34
  • 82.87 (n)
(Bos Taurus)
Mammalia SLC22A1 33 34
  • 82.26 (n)
(Mus musculus)
Mammalia Slc22a1 33 16 34
  • 80.57 (n)
(Rattus norvegicus)
Mammalia Slc22a1 33
  • 80.57 (n)
(Ornithorhynchus anatinus)
Mammalia SLC22A1 34
  • 68 (a)
(Monodelphis domestica)
Mammalia SLC22A1 34
  • 65 (a)
(Gallus gallus)
Aves -- 34
  • 64 (a)
-- 34
  • 63 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 63 (a)
-- 34
  • 61 (a)
(Danio rerio)
Actinopterygii slc22a2 34
  • 47 (a)
fruit fly
(Drosophila melanogaster)
Insecta Orct 35
  • 34 (a)
CG8654 35
  • 33 (a)
CG4630 35 34
  • 32 (a)
CG13610 35
  • 31 (a)
CG6600 35
  • 31 (a)
CG3790 35
  • 30 (a)
CG9317 35
  • 30 (a)
CG6126 35
  • 29 (a)
CG7442 35 34
  • 28 (a)
CG6231 35
  • 27 (a)
CG7458 35 34
  • 27 (a)
CG7084 35
  • 26 (a)
(Caenorhabditis elegans)
Secernentea B0252.3 35
  • 29 (a)
F52F12.1a 35
  • 29 (a)
oct-1 35
  • 29 (a)
K05F1.6 35
  • 26 (a)
Y82E9BR.16 35
  • 26 (a)
ZK455.8a 35
  • 26 (a)
ZK455.8b 35
  • 26 (a)
Species where no ortholog for SLC22A1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for SLC22A1 Gene

Gene Tree for SLC22A1 (if available)
Gene Tree for SLC22A1 (if available)

Paralogs for SLC22A1 Gene

(11) SIMAP similar genes for SLC22A1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SLC22A1: view

Variants for SLC22A1 Gene

Sequence variations from dbSNP and Humsavar for SLC22A1 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs35854239 benign, not specified 160,139,866(+) TGGTAAGTTGGTAAGTTG/TGGTAAGTTG/TGGTAAGTTGGTAAGTTGGTAAGTTG coding_sequence_variant, intron_variant, splice_donor_variant
rs1000015943 -- 160,137,867(+) T/C intron_variant
rs1000059246 -- 160,143,728(+) C/T intron_variant
rs1000616793 -- 160,139,031(+) C/T intron_variant
rs1000676003 -- 160,128,478(+) T/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SLC22A1 Gene

Variant ID Type Subtype PubMed ID
esv1157586 CNV deletion 17803354
esv23905 CNV loss 19812545
esv2733046 CNV deletion 23290073
esv2733047 CNV deletion 23290073
esv2733048 CNV deletion 23290073
esv2733049 CNV deletion 23290073
esv2759484 CNV gain+loss 17122850
esv33283 CNV gain 17666407
esv35098 CNV gain 17911159
esv3611425 CNV gain 21293372
nsv818463 CNV gain 17921354

Variation tolerance for SLC22A1 Gene

Residual Variation Intolerance Score: 95.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.18; 87.92% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SLC22A1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLC22A1 Gene

Disorders for SLC22A1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SLC22A1 Gene - From: HGMD, DISEASES, and Novoseek

Disorder Aliases PubMed IDs
leukemia, chronic myeloid
  • cml
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for SLC22A1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SLC22A1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SLC22A1 Gene

Publications for SLC22A1 Gene

  1. Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1 (OCT1). (PMID: 15499200) Itoda M … Sawada J (Drug metabolism and pharmacokinetics 2004) 3 4 22 44 58
  2. Cloning and functional expression of a human liver organic cation transporter. (PMID: 9187257) Zhang L … Giacomini KM (Molecular pharmacology 1997) 3 4 22 25 58
  3. The effects of genetic polymorphisms in the organic cation transporters OCT1, OCT2, and OCT3 on the renal clearance of metformin. (PMID: 19536068) Tzvetkov MV … Brockmöller J (Clinical pharmacology and therapeutics 2009) 3 22 44 58
  4. Reduced-function SLC22A1 polymorphisms encoding organic cation transporter 1 and glycemic response to metformin: a GoDARTS study. (PMID: 19336679) Zhou K … Pearson ER (Diabetes 2009) 3 22 44 58
  5. Genetic variation in the organic cation transporter 1 is associated with metformin response in patients with diabetes mellitus. (PMID: 19381165) Becker ML … Stricker BH (The pharmacogenomics journal 2009) 3 22 44 58

Products for SLC22A1 Gene

Sources for SLC22A1 Gene

Loading form....