Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SCT Gene

Aliases for SCT Gene

  • Secretin 2 3 5
  • Prepro-Secretin 2 3

External Ids for SCT Gene

Previous GeneCards Identifiers for SCT Gene

  • GC11P001116
  • GC11P000936
  • GC11P000573
  • GC11M000616
  • GC11M000441

Summaries for SCT Gene

Entrez Gene Summary for SCT Gene

  • This gene encodes a member of the glucagon family of peptides. The encoded preproprotein is secreted by endocrine S cells in the proximal small intestinal mucosa as a prohormone, then proteolytically processed to generate the mature peptide hormone. The release of this active peptide hormone is stimulated by either fatty acids or acidic pH in the duodenum. This hormone stimulates the secretion of bile and bicarbonate in the duodenum, pancreatic and biliary ducts. [provided by RefSeq, Feb 2016]

GeneCards Summary for SCT Gene

SCT (Secretin) is a Protein Coding gene. Diseases associated with SCT include Spondylocarpotarsal Synostosis Syndrome and Larsen Syndrome. Among its related pathways are Presynaptic function of Kainate receptors and Signaling by GPCR. GO annotations related to this gene include hormone activity.

UniProtKB/Swiss-Prot for SCT Gene

  • Stimulates formation of NaHCO(3)-rich pancreatic juice and secretion of NaHCO(3)-rich bile and inhibits HCl production by the stomach.

Gene Wiki entry for SCT Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SCT Gene

Genomics for SCT Gene

Regulatory Elements for SCT Gene

Enhancers for SCT Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around SCT on UCSC Golden Path with GeneCards custom track

Promoters for SCT Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around SCT on UCSC Golden Path with GeneCards custom track

Genomic Location for SCT Gene

624,989 bp from pter
627,240 bp from pter
2,252 bases
Minus strand

Genomic View for SCT Gene

Genes around SCT on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SCT Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SCT Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SCT Gene

Proteins for SCT Gene

  • Protein details for SCT Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:

    Protein attributes for SCT Gene

    121 amino acids
    Molecular mass:
    13016 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SCT Gene

Proteomics data for SCT Gene at MOPED

Post-translational modifications for SCT Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SCT Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SCT Gene

Domains & Families for SCT Gene

Gene Families for SCT Gene

Protein Domains for SCT Gene

Suggested Antigen Peptide Sequences for SCT Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

  • Belongs to the glucagon family.
  • Belongs to the glucagon family.
genes like me logo Genes that share domains with SCT: view

Function for SCT Gene

Molecular function for SCT Gene

UniProtKB/Swiss-Prot Function:
Stimulates formation of NaHCO(3)-rich pancreatic juice and secretion of NaHCO(3)-rich bile and inhibits HCl production by the stomach.

LifeMap Function Summary for SCT Gene

It affects the following cells:
genes like me logo Genes that share phenotypes with SCT: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SCT

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SCT Gene

Localization for SCT Gene

Subcellular locations from UniProtKB/Swiss-Prot for SCT Gene

Subcellular locations from

Jensen Localization Image for SCT Gene COMPARTMENTS Subcellular localization image for SCT gene
Compartment Confidence
extracellular 5
plasma membrane 2
cytoskeleton 1
cytosol 1
lysosome 1
mitochondrion 1
nucleus 1
vacuole 1

Gene Ontology (GO) - Cellular Components for SCT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005576 extracellular region IEA,TAS --
genes like me logo Genes that share ontologies with SCT: view

Pathways & Interactions for SCT Gene

genes like me logo Genes that share pathways with SCT: view

Gene Ontology (GO) - Biological Process for SCT Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030157 pancreatic juice secretion NAS 11060443
GO:0090187 positive regulation of pancreatic juice secretion IEA --
GO:1903640 negative regulation of gastrin-induced gastric acid secretion IEA --
genes like me logo Genes that share ontologies with SCT: view

No data available for SIGNOR curated interactions for SCT Gene

Drugs & Compounds for SCT Gene

(126) Drugs for SCT Gene - From: ClinicalTrials and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Pyridoxine Approved Nutra 176,176
Azacitidine Approved, Investigational Pharma 471
Beclomethasone Approved, Investigational Pharma 161
Belinostat Approved, Investigational Pharma Histone deacetylase (HDAC)inhibitors 41
Busulfan Approved, Investigational Pharma 527

(52) Additional Compounds for SCT Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with SCT: view

Transcripts for SCT Gene

mRNA/cDNA for SCT Gene

(2) REFSEQ mRNAs :
(0) Additional mRNA sequences :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SCT Gene

Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for SCT Gene

No ASD Table

Relevant External Links for SCT Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SCT Gene

mRNA expression in normal human tissues for SCT Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SCT Gene

This gene is overexpressed in Muscle - Skeletal (x8.4), Spleen (x5.1), and Testis (x4.7).

SOURCE GeneReport for Unigene cluster for SCT Gene Hs.632324

genes like me logo Genes that share expression patterns with SCT: view

Primer Products

No data available for Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for SCT Gene

Orthologs for SCT Gene

This gene was present in the common ancestor of mammals.

Orthologs for SCT Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SCT 35
  • 98.62 (n)
  • 98.35 (a)
SCT 36
  • 95 (a)
(Bos Taurus)
Mammalia SCT 36
  • 55 (a)
(Mus musculus)
Mammalia Sct 36
  • 56 (a)
Species with no ortholog for SCT:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SCT Gene

Gene Tree for SCT (if available)
Gene Tree for SCT (if available)

Paralogs for SCT Gene

No data available for Paralogs for SCT Gene

Variants for SCT Gene

Sequence variations from dbSNP and Humsavar for SCT Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs61876660 -- 627,462(+) GAGGG(G/T)TTGGG upstream-variant-2KB
rs7929088 -- 628,108(-) agggg(A/G)ggggg upstream-variant-2KB
rs71022940 -- 627,835(+) AAATC(-/GTTCACAGACGCTCCCGTCCTCCCAAAATC)CGTTC upstream-variant-2KB
rs112888889 -- 627,517(+) GGAGG(C/T)CCCTG upstream-variant-2KB
rs143683089 -- 628,427(+) ACGGC(A/G)CTTCC upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for SCT Gene

Variant ID Type Subtype PubMed ID
dgv182e199 CNV Deletion 23128226
dgv920n71 CNV Loss 21882294
dgv921n71 CNV Loss 21882294
dgv922n71 CNV Loss 21882294
nsv469923 CNV Loss 18288195
essv23843 CNV CNV 17122850
nsv896544 CNV Loss 21882294
nsv896545 CNV Loss 21882294
dgv935n71 CNV Loss 21882294
dgv936n71 CNV Loss 21882294
nsv467635 CNV Loss 19166990
nsv896560 CNV Loss 21882294
dgv940n71 CNV Loss 21882294
dgv941n71 CNV Loss 21882294
nsv896569 CNV Loss 21882294
nsv896570 CNV Loss 21882294
dgv942n71 CNV Loss 21882294
esv2668299 CNV Deletion 23128226

Variation tolerance for SCT Gene

Gene Damage Index Score: 0.44; 9.56% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SCT Gene

Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SCT Gene

Disorders for SCT Gene

MalaCards: The human disease database

(48) MalaCards diseases for SCT Gene - From: OMIM, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
spondylocarpotarsal synostosis syndrome
  • scoliosis, congenital with unilateral unsegmented bar
larsen syndrome
  • dominant larsen syndrome
atelosteogenesis, type i
  • atelosteogenesis type 1
atelosteogenesis, type iii
  • atelosteogenesis type 3
boomerang dysplasia
  • boomerang-like skeletal dysplasia
- elite association - COSMIC cancer census association via MalaCards
Search SCT in MalaCards View complete list of genes associated with diseases

Relevant External Links for SCT

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with SCT: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SCT Gene

Publications for SCT Gene

  1. Human secretin (SCT): gene structure, chromosome location, and distribution of mRNA. (PMID: 11060443) Whitmore T.E. … Lok S. (Cytogenet. Cell Genet. 2000) 3 4 23 67
  2. Secretin inhibits cholangiocarcinoma growth via dysregulation of the cAMP-dependent signaling mechanisms of secretin receptor. (PMID: 19904746) Onori P. … Glaser S.S. (Int. J. Cancer 2010) 3 23
  3. Peptic ulceration may be a hormonal deficiency disease. (PMID: 18280672) Love J.W. (Med. Hypotheses 2008) 3 23
  4. Retinoic acid-induced human secretin gene expression in neuronal cells is mediated by cyclin-dependent kinase 1. (PMID: 16888198) Lee L.T. … Chow B.K. (Ann. N. Y. Acad. Sci. 2006) 3 23
  5. Secretin self-assembles and interacts spontaneously with phospholipids in vitro. (PMID: 11814635) Gandhi S. … Onyuksel H. (Peptides 2002) 3 23

Products for SCT Gene

Sources for SCT Gene