Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PLEKHJ1 Gene

Aliases for PLEKHJ1 Gene

  • Pleckstrin Homology Domain Containing J1 2 3 5
  • Pleckstrin Homology Domain Containing, Family J Member 1 2 3
  • Guanine Nucleotide Releasing Protein X 2 3
  • PH Domain-Containing Family J Member 1 3 4
  • GNRPX 3 4
  • Guanine Nucleotide-Releasing Protein X 4

External Ids for PLEKHJ1 Gene

Previous GeneCards Identifiers for PLEKHJ1 Gene

  • GC19M002185
  • GC19M002186
  • GC19M002004

Summaries for PLEKHJ1 Gene

GeneCards Summary for PLEKHJ1 Gene

PLEKHJ1 (Pleckstrin Homology Domain Containing J1) is a Protein Coding gene.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PLEKHJ1 Gene

Genomics for PLEKHJ1 Gene

Regulatory Elements for PLEKHJ1 Gene

Enhancers for PLEKHJ1 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around PLEKHJ1 on UCSC Golden Path with GeneCards custom track

Promoters for PLEKHJ1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around PLEKHJ1 on UCSC Golden Path with GeneCards custom track

Genomic Location for PLEKHJ1 Gene

2,229,952 bp from pter
2,237,704 bp from pter
7,753 bases
Minus strand

Genomic View for PLEKHJ1 Gene

Genes around PLEKHJ1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PLEKHJ1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PLEKHJ1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PLEKHJ1 Gene

Proteins for PLEKHJ1 Gene

  • Protein details for PLEKHJ1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Pleckstrin homology domain-containing family J member 1
    Protein Accession:
    Secondary Accessions:
    • B3KUQ9
    • D6W604

    Protein attributes for PLEKHJ1 Gene

    149 amino acids
    Molecular mass:
    17551 Da
    Quaternary structure:
    No Data Available

neXtProt entry for PLEKHJ1 Gene

Proteomics data for PLEKHJ1 Gene at MOPED

Post-translational modifications for PLEKHJ1 Gene

  • Ubiquitination at Lys 6
  • Modification sites at PhosphoSitePlus

Other Protein References for PLEKHJ1 Gene

No data available for DME Specific Peptides for PLEKHJ1 Gene

Domains & Families for PLEKHJ1 Gene

Gene Families for PLEKHJ1 Gene

Protein Domains for PLEKHJ1 Gene


Suggested Antigen Peptide Sequences for PLEKHJ1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 PH domain.
  • Contains 1 PH domain.
genes like me logo Genes that share domains with PLEKHJ1: view

Function for PLEKHJ1 Gene

genes like me logo Genes that share phenotypes with PLEKHJ1: view

Animal Model Products

CRISPR Products

miRNA for PLEKHJ1 Gene

miRTarBase miRNAs that target PLEKHJ1

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PLEKHJ1 Gene

Localization for PLEKHJ1 Gene

Subcellular locations from

Jensen Localization Image for PLEKHJ1 Gene COMPARTMENTS Subcellular localization image for PLEKHJ1 gene
Compartment Confidence
cytosol 2
mitochondrion 2
nucleus 2
extracellular 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for PLEKHJ1 Gene

Pathways & Interactions for PLEKHJ1 Gene

SuperPathways for PLEKHJ1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for PLEKHJ1 Gene


No data available for Pathways by source and SIGNOR curated interactions for PLEKHJ1 Gene

Drugs & Compounds for PLEKHJ1 Gene

No Compound Related Data Available

Transcripts for PLEKHJ1 Gene

Unigene Clusters for PLEKHJ1 Gene

Pleckstrin homology domain containing, family J member 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for PLEKHJ1 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b · 4c ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8
SP1: - - - - - -
SP2: - - -
SP3: - - - - -
SP4: - - -
SP5: - - - -
SP6: - - - -

Relevant External Links for PLEKHJ1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PLEKHJ1 Gene

mRNA expression in normal human tissues for PLEKHJ1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PLEKHJ1 Gene

This gene is overexpressed in Ovary (39.9) and Platelet (29.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for PLEKHJ1 Gene

SOURCE GeneReport for Unigene cluster for PLEKHJ1 Gene Hs.501353

mRNA Expression by UniProt/SwissProt for PLEKHJ1 Gene

Tissue specificity: Expressed in testis and liver.
genes like me logo Genes that share expression patterns with PLEKHJ1: view

Protein tissue co-expression partners for PLEKHJ1 Gene

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues for PLEKHJ1 Gene

Orthologs for PLEKHJ1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for PLEKHJ1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia PLEKHJ1 35
  • 88.14 (n)
  • 88.59 (a)
  • 89 (a)
(Mus musculus)
Mammalia Plekhj1 35
  • 86.17 (n)
  • 87.76 (a)
Plekhj1 16
Plekhj1 36
  • 79 (a)
(Pan troglodytes)
Mammalia PLEKHJ1 35
  • 99.11 (n)
  • 99.33 (a)
  • 99 (a)
(Rattus norvegicus)
Mammalia Plekhj1 35
  • 86.39 (n)
  • 89.8 (a)
(Canis familiaris)
Mammalia PLEKHJ1 36
  • 75 (a)
(Monodelphis domestica)
Mammalia PLEKHJ1 36
  • 84 (a)
(Ornithorhynchus anatinus)
Mammalia PLEKHJ1 36
  • 66 (a)
(Gallus gallus)
Aves PLEKHJ1 35
  • 79 (n)
  • 82.88 (a)
  • 81 (a)
(Anolis carolinensis)
Reptilia PLEKHJ1 36
  • 80 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia plekhj1 35
  • 71.53 (n)
  • 77.78 (a)
(Danio rerio)
Actinopterygii LOC100537951 35
  • 68.49 (n)
  • 69.18 (a)
plekhj1 36
  • 64 (a)
Species with no ortholog for PLEKHJ1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PLEKHJ1 Gene

Gene Tree for PLEKHJ1 (if available)
Gene Tree for PLEKHJ1 (if available)

Paralogs for PLEKHJ1 Gene

(1) SIMAP similar genes for PLEKHJ1 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with PLEKHJ1: view

No data available for Paralogs for PLEKHJ1 Gene

Variants for PLEKHJ1 Gene

Sequence variations from dbSNP and Humsavar for PLEKHJ1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs72101460 -- 2,233,330(+) CGGGG(-/CAGGGGGGCCATGCCACCAGCCTGGGGGCTCAC)CAGGC intron-variant, cds-indel
rs35228862 -- 2,233,351(+) CCAGC(-/C)TGGGG intron-variant, utr-variant-3-prime
rs77585572 -- 2,233,483(+) GGAGC(A/G)CAGCT intron-variant, utr-variant-3-prime
rs371123331 -- 2,233,442(+) CACCA(A/C/G)GTGCC intron-variant, utr-variant-3-prime
rs80224142 -- 2,233,411(+) AGGCG(C/T)ATATC intron-variant, utr-variant-3-prime

Structural Variations from Database of Genomic Variants (DGV) for PLEKHJ1 Gene

Variant ID Type Subtype PubMed ID
nsv910499 CNV Loss 21882294
dgv3614n71 CNV Loss 21882294
dgv3622n71 CNV Loss 21882294
dgv3626n71 CNV Loss 21882294
nsv910623 CNV Loss 21882294
dgv3629n71 CNV Loss 21882294
dgv3630n71 CNV Loss 21882294
nsv833706 CNV Loss 17160897
dgv3631n71 CNV Loss 21882294
nsv833707 CNV Loss 17160897
nsv2389 CNV Insertion 18451855
nsv910636 CNV Loss 21882294
dgv3632n71 CNV Loss 21882294
dgv3633n71 CNV Loss 21882294

Variation tolerance for PLEKHJ1 Gene

Residual Variation Intolerance Score: 81.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.21; 52.24% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PLEKHJ1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PLEKHJ1 Gene

Disorders for PLEKHJ1 Gene

Relevant External Links for PLEKHJ1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for PLEKHJ1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for PLEKHJ1 Gene

Publications for PLEKHJ1 Gene

  1. An expressed GNRP-like gene shares a bi-directional promoter with SF3A2 (SAP62) immediately upstream of AMH. (PMID: 11602354) Dresser D.W. … Guerrier D. (Gene 2001) 2 3 4 67
  2. A deep proteomics perspective on CRM1-mediated nuclear export and nucleocytoplasmic partitioning. (PMID: 26673895) KA+rlA+ K. … GAPrlich D. (Elife 2015) 3
  3. Interactions of pathological hallmark proteins: tubulin polymerization promoting protein/p25, beta-amyloid, and alpha-synuclein. (PMID: 21832049) OlA!h J. … OvA!di J. (J. Biol. Chem. 2011) 3
  4. A directed protein interaction network for investigating intracellular signal transduction. (PMID: 21900206) Vinayagam A. … Wanker E.E. (Sci Signal 2011) 3
  5. Expanding the substantial interactome of NEMO using protein microarrays. (PMID: 20098747) Fenner B.J. … Prehn J.H. (PLoS ONE 2010) 3

Products for PLEKHJ1 Gene

Sources for PLEKHJ1 Gene
