Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ASCL1 Gene

Aliases for ASCL1 Gene

  • Achaete-Scute Family BHLH Transcription Factor 1 2 3 5
  • Class A Basic Helix-Loop-Helix Protein 46 3 4
  • BHLHa46 3 4
  • ASH-1 3 4
  • HASH1 3 4
  • ASH1 3 4
  • Achaete-Scute Complex (Drosophila) Homolog-Like 1 2
  • Achaete-Scute Complex Homolog 1 (Drosophila) 2
  • Achaete-Scute Complex-Like 1 (Drosophila) 2
  • Achaete-Scute Complex Homolog 1 3
  • Achaete-Scute Complex-Like 1 3
  • Achaete-Scute Homolog 1 3
  • Achaete Scute Protein 3
  • MASH1 3

External Ids for ASCL1 Gene

Previous GeneCards Identifiers for ASCL1 Gene

  • GC12P102450
  • GC12P103310
  • GC12P101854
  • GC12P101855
  • GC12P101856
  • GC12P101875
  • GC12P100410
  • GC12P103352

Summaries for ASCL1 Gene

Entrez Gene Summary for ASCL1 Gene

  • This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

GeneCards Summary for ASCL1 Gene

ASCL1 (Achaete-Scute Family BHLH Transcription Factor 1) is a Protein Coding gene. Diseases associated with ASCL1 include Central Hypoventilation Syndrome, Congenital and Differentiating Neuroblastoma. Among its related pathways are Neural Crest Differentiation and Neural Stem Cell Differentiation Pathways and Lineage-specific Markers. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and sequence-specific DNA binding. An important paralog of this gene is ASCL2.

UniProtKB/Swiss-Prot for ASCL1 Gene

  • Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways. Directly binds the E box motif (5-CANNTG-3) on promoters and promotes transcription of neuronal genes. The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro. Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS. Essential for the generation of olfactory and autonomic neurons. Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation.

Gene Wiki entry for ASCL1 Gene

Additional gene information for ASCL1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ASCL1 Gene

Genomics for ASCL1 Gene

GeneHancer (GH) Regulatory Elements for ASCL1 Gene

Promoters and enhancers for ASCL1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I102957 Promoter/Enhancer 1.1 EPDnew ENCODE 550.8 +0.1 105 0.3 MXI1 SMAD1 TRIM22 E2F1 HDAC2 TARDBP IKZF1 NBN CTBP2 MLLT1 ASCL1 PAH
GH12I102958 Enhancer 0.7 ENCODE 550.8 +0.6 604 0.2 RING1 GTF2F1 PKNOX1 MXI1 RB1 BACH1 CTBP1 ZSCAN29 EZH2 SMARCA5 PAH ASCL1
GH12I102959 Enhancer 0.7 ENCODE 550.8 +0.9 854 0.3 HDGF CTCF RING1 GTF2F1 PKNOX1 MXI1 RB1 SUZ12 BACH1 CTBP1 PAH ASCL1 GC12M102978
GH12I102884 Enhancer 0.9 ENCODE 11.3 -71.7 -71733 2 ELF3 FOXA2 THRB ZNF48 RARA ETS1 CREM MIXL1 HMG20B KLF11 ASCL1 PAH GC12P102871 GC12M102927
GH12I102902 Enhancer 0.8 ENCODE 11.2 -53.5 -53463 3.5 ELF3 FOXA2 ARID4B RAD21 RARA YY1 ATF7 CREM IKZF2 THAP11 ASCL1 ENSG00000212594 STAB2 GC12M102927 GC12P102871 PAH
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ASCL1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ASCL1 gene promoter:

Genomic Locations for ASCL1 Gene

Genomic Locations for ASCL1 Gene
chr12:102,957,674-102,960,516
(GRCh38/hg38)
Size:
2,843 bases
Orientation:
Plus strand
chr12:103,351,452-103,354,294
(GRCh37/hg19)

Genomic View for ASCL1 Gene

Genes around ASCL1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ASCL1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ASCL1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ASCL1 Gene

Proteins for ASCL1 Gene

  • Protein details for ASCL1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P50553-ASCL1_HUMAN
    Recommended name:
    Achaete-scute homolog 1
    Protein Accession:
    P50553
    Secondary Accessions:
    • A8K3C4
    • Q9BQ30

    Protein attributes for ASCL1 Gene

    Size:
    236 amino acids
    Molecular mass:
    25454 Da
    Quaternary structure:
    • Efficient DNA binding requires dimerization with another bHLH protein. Forms a heterodimer with TCF3.

neXtProt entry for ASCL1 Gene

Post-translational modifications for ASCL1 Gene

No Post-translational modifications

Other Protein References for ASCL1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ASCL1 Gene

Domains & Families for ASCL1 Gene

Gene Families for ASCL1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted secreted proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for ASCL1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ASCL1: view

No data available for UniProtKB/Swiss-Prot for ASCL1 Gene

Function for ASCL1 Gene

Molecular function for ASCL1 Gene

GENATLAS Biochemistry:
Drosophila achaete-scute homolog 1,downregulated in differentiating neuroblastoma cells
UniProtKB/Swiss-Prot Function:
Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways. Directly binds the E box motif (5-CANNTG-3) on promoters and promotes transcription of neuronal genes. The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro. Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS. Essential for the generation of olfactory and autonomic neurons. Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation.

Phenotypes From GWAS Catalog for ASCL1 Gene

Gene Ontology (GO) - Molecular Function for ASCL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IDA 11736660
GO:0000989 transcription factor activity, transcription factor binding IEA,ISS --
GO:0001078 transcriptional repressor activity, RNA polymerase II proximal promoter sequence-specific DNA binding IDA 11736660
GO:0003677 DNA binding ISS --
GO:0003682 chromatin binding IEA --
genes like me logo Genes that share ontologies with ASCL1: view
genes like me logo Genes that share phenotypes with ASCL1: view

Human Phenotype Ontology for ASCL1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ASCL1 Gene

MGI Knock Outs for ASCL1:

Animal Model Products

Targeted motifs for ASCL1 Gene
HOMER Transcription Factor Regulatory Elements motif ASCL1
  • Consensus sequence: NNVVCAGCTGBN Submotif: canonical Cell Type: NeuralTubes GEO ID: GSE55840

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for ASCL1

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for ASCL1 Gene

Localization for ASCL1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ASCL1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ASCL1 gene
Compartment Confidence
nucleus 5
cytoskeleton 2
extracellular 1

Gene Ontology (GO) - Cellular Components for ASCL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA,IEA 12858003
GO:0043025 neuronal cell body IEA --
GO:0090575 RNA polymerase II transcription factor complex IBA --
genes like me logo Genes that share ontologies with ASCL1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ASCL1 Gene

Pathways & Interactions for ASCL1 Gene

genes like me logo Genes that share pathways with ASCL1: view

SIGNOR curated interactions for ASCL1 Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for ASCL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IDA 11736660
GO:0001764 neuron migration IEA --
GO:0003358 noradrenergic neuron development IEA,ISS --
GO:0003359 noradrenergic neuron fate commitment IMP 14532329
GO:0006351 transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with ASCL1: view

Drugs & Compounds for ASCL1 Gene

(4) Drugs for ASCL1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for ASCL1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ASCL1: view

Transcripts for ASCL1 Gene

mRNA/cDNA for ASCL1 Gene

(1) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(140) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ASCL1 Gene

Achaete-scute complex homolog 1 (Drosophila):
Representative Sequences:

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for ASCL1

Alternative Splicing Database (ASD) splice patterns (SP) for ASCL1 Gene

No ASD Table

Relevant External Links for ASCL1 Gene

GeneLoc Exon Structure for
ASCL1
ECgene alternative splicing isoforms for
ASCL1

Expression for ASCL1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ASCL1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ASCL1 Gene

This gene is overexpressed in Pituitary (x10.3) and Brain - Amygdala (x4.7).

NURSA nuclear receptor signaling pathways regulating expression of ASCL1 Gene:

ASCL1

SOURCE GeneReport for Unigene cluster for ASCL1 Gene:

Hs.703025

Evidence on tissue expression from TISSUES for ASCL1 Gene

  • Lung(5)
  • Nervous system(4.9)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ASCL1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
Organs:
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • mouth
  • outer ear
Thorax:
  • diaphragm
  • heart
  • lung
Abdomen:
  • intestine
  • large intestine
Pelvis:
  • rectum
General:
  • blood
  • blood vessel
  • peripheral nervous system
  • skin
  • spinal cord
  • sweat gland
genes like me logo Genes that share expression patterns with ASCL1: view

Primer Products

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for ASCL1 Gene

Orthologs for ASCL1 Gene

This gene was present in the common ancestor of animals.

Orthologs for ASCL1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ASCL1 33
  • 98.55 (n)
oppossum
(Monodelphis domestica)
Mammalia ASCL1 34
  • 93 (a)
OneToOne
dog
(Canis familiaris)
Mammalia ASCL1 33 34
  • 90.33 (n)
rat
(Rattus norvegicus)
Mammalia Ascl1 33
  • 90.13 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia ASCL1 34
  • 89 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Ascl1 33 16 34
  • 88.6 (n)
cow
(Bos Taurus)
Mammalia ASCL1 33 34
  • 88.43 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia ascl1 33
  • 81.41 (n)
African clawed frog
(Xenopus laevis)
Amphibia ascl1-A 33
zebrafish
(Danio rerio)
Actinopterygii ascl1a 33 34
  • 79.37 (n)
asha 33
worm
(Caenorhabditis elegans)
Secernentea hlh-6 34
  • 17 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 14 (a)
OneToMany
Species where no ortholog for ASCL1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ASCL1 Gene

ENSEMBL:
Gene Tree for ASCL1 (if available)
TreeFam:
Gene Tree for ASCL1 (if available)

Paralogs for ASCL1 Gene

Paralogs for ASCL1 Gene

(1) SIMAP similar genes for ASCL1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with ASCL1: view

Variants for ASCL1 Gene

Sequence variations from dbSNP and Humsavar for ASCL1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs267606667 pathogenic, Congenital central hypoventilation 102,958,296(+) C/A coding_sequence_variant, missense_variant
rs3832799 likely-benign, benign, conflicting-interpretations-of-pathogenicity, uncertain-significance, not specified 102,958,394(+) GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG coding_sequence_variant, inframe_deletion, inframe_insertion
rs558732328 conflicting-interpretations-of-pathogenicity, not specified 102,958,367(+) A/G coding_sequence_variant, synonymous_variant
rs552552603 likely-benign, not specified 102,958,382(+) A/T coding_sequence_variant, synonymous_variant
rs731682 benign, not specified 102,958,871(+) C/G coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for ASCL1 Gene

Variant ID Type Subtype PubMed ID
esv3581838 CNV gain 25503493
nsv1071051 CNV deletion 25765185

Variation tolerance for ASCL1 Gene

Residual Variation Intolerance Score: 33.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.43; 28.05% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ASCL1 Gene

Human Gene Mutation Database (HGMD)
ASCL1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ASCL1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ASCL1 Gene

Disorders for ASCL1 Gene

MalaCards: The human disease database

(20) MalaCards diseases for ASCL1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
central hypoventilation syndrome, congenital
  • cchs
differentiating neuroblastoma
neuroendocrine tumor
  • neuroendocrine neoplasm
prostate small cell carcinoma
  • prostate oat cell carcinoma
pulmonary neuroendocrine tumor
  • neuroendocrine neoplasm of lung
- elite association - COSMIC cancer census association via MalaCards
Search ASCL1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for ASCL1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ASCL1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ASCL1 Gene

Publications for ASCL1 Gene

  1. Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. (PMID: 8390674) Ball DW … Nelkin BD (Proceedings of the National Academy of Sciences of the United States of America 1993) 2 3 4 22 58
  2. Examination of the MASH1 gene in patients with Parkinson's disease. (PMID: 20097173) Deng H … Jankovic J (Biochemical and biophysical research communications 2010) 3 22 44 58
  3. Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (PMID: 21300955) Dehghan A … Chasman DI (Circulation 2011) 3 44 58
  4. A candidate gene study of obstructive sleep apnea in European Americans and African Americans. (PMID: 20538960) Larkin EK … Redline S (American journal of respiratory and critical care medicine 2010) 3 44 58
  5. ASCL1 regulates the expression of the CHRNA5/A3/B4 lung cancer susceptibility locus. (PMID: 20124469) Improgo MR … Gardner PD (Molecular cancer research : MCR 2010) 3 22 58

Products for ASCL1 Gene

  • Addgene plasmids for ASCL1

Sources for ASCL1 Gene

Content
Loading form....