Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FIGLA Gene

Aliases for FIGLA Gene

  • Folliculogenesis Specific BHLH Transcription Factor 2 3 5
  • Folliculogenesis-Specific Basic Helix-Loop-Helix Protein 3 4
  • Class C Basic Helix-Loop-Helix Protein 8 3 4
  • Factor In The Germline Alpha 2 3
  • Transcription Factor FIGa 3 4
  • FIGALPHA 3 4
  • BHLHC8 3 4
  • Folliculogenesis Specific Basic Helix-Loop-Helix 2
  • POF6 3

External Ids for FIGLA Gene

Previous GeneCards Identifiers for FIGLA Gene

  • GC02M070962
  • GC02U900441
  • GC02M070916
  • GC02M070847
  • GC02M071004

Summaries for FIGLA Gene

Entrez Gene Summary for FIGLA Gene

  • This gene encodes a protein that functions in postnatal oocyte-specific gene expression. The protein is a basic helix-loop-helix transcription factor that regulates multiple oocyte-specific genes, including genes involved in folliculogenesis and those that encode the zona pellucida. Mutations in this gene cause premature ovarian failure type 6. [provided by RefSeq, Sep 2009]

GeneCards Summary for FIGLA Gene

FIGLA (Folliculogenesis Specific BHLH Transcription Factor) is a Protein Coding gene. Diseases associated with FIGLA include Premature Ovarian Failure 6 and Premature Ovarian Failure. Among its related pathways are Ovarian Infertility Genes. GO annotations related to this gene include sequence-specific DNA binding and protein dimerization activity.

UniProtKB/Swiss-Prot for FIGLA Gene

  • Germline specific transcription factor implicated in postnatal oocyte-specific gene expression. Plays a key regulatory role in the expression of multiple oocyte-specific genes, including those that initiate folliculogenesis and those that encode the zona pellucida (ZP1, ZP2 and ZP3) required for fertilization and early embryonic survival. Essential for oocytes to survive and form primordial follicles. The persistence of FIGLA in adult females suggests that it may regulate additional pathways that are essential for normal ovarian development. Binds to the E-box (5-CANNTG-3) of the ZPs (ZP1, ZP2, ZP3) promoters.

Gene Wiki entry for FIGLA Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FIGLA Gene

Genomics for FIGLA Gene

Regulatory Elements for FIGLA Gene

Enhancers for FIGLA Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G070766 1.1 ENCODE 6.1 +23.2 23221 1.8 HDGF PKNOX1 ARNT AGO1 ZFP64 ARID4B SIN3A ZNF2 YY1 ZNF143 CLEC4F TEX261 MPHOSPH10 CD207 PCBP1-AS1 FIGLA ADD2 PIR38094
GH02G070732 0.6 ENCODE 6.5 +56.9 56899 2.6 CTCF RFX1 POLR2A SMARCA4 TEAD4 RBBP5 REST ADD2 FIGLA PIR38094
GH02G070619 1 FANTOM5 ENCODE dbSUPER 1.9 +170.5 170522 0.9 POLR2A PRDM1 ADD2 TGFA FIGLA GC02M070656
GH02G070509 1.2 FANTOM5 ENCODE dbSUPER 1.5 +280.4 280364 1.3 CTCF ZNF146 KLF9 KLF4 ZBTB20 TCF7L2 CD207 TGFA ASPRV1 FIGLA TGFA-IT1
GH02G070352 0.4 dbSUPER 4.4 +437.6 437595 1.0 HLF TGFA FIGLA BRD7P6 LOC105374793
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FIGLA on UCSC Golden Path with GeneCards custom track

Genomic Location for FIGLA Gene

Chromosome:
2
Start:
70,777,310 bp from pter
End:
70,790,643 bp from pter
Size:
13,334 bases
Orientation:
Minus strand

Genomic View for FIGLA Gene

Genes around FIGLA on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FIGLA Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FIGLA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FIGLA Gene

Proteins for FIGLA Gene

  • Protein details for FIGLA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6QHK4-FIGLA_HUMAN
    Recommended name:
    Factor in the germline alpha
    Protein Accession:
    Q6QHK4

    Protein attributes for FIGLA Gene

    Size:
    219 amino acids
    Molecular mass:
    24123 Da
    Quaternary structure:
    • Heterodimer with TCF3/isoform E12.

neXtProt entry for FIGLA Gene

Post-translational modifications for FIGLA Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FIGLA Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FIGLA Gene

Domains & Families for FIGLA Gene

Gene Families for FIGLA Gene

Protein Domains for FIGLA Gene

Suggested Antigen Peptide Sequences for FIGLA Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with FIGLA: view

No data available for UniProtKB/Swiss-Prot for FIGLA Gene

Function for FIGLA Gene

Molecular function for FIGLA Gene

UniProtKB/Swiss-Prot Function:
Germline specific transcription factor implicated in postnatal oocyte-specific gene expression. Plays a key regulatory role in the expression of multiple oocyte-specific genes, including those that initiate folliculogenesis and those that encode the zona pellucida (ZP1, ZP2 and ZP3) required for fertilization and early embryonic survival. Essential for oocytes to survive and form primordial follicles. The persistence of FIGLA in adult females suggests that it may regulate additional pathways that are essential for normal ovarian development. Binds to the E-box (5-CANNTG-3) of the ZPs (ZP1, ZP2, ZP3) promoters.

Gene Ontology (GO) - Molecular Function for FIGLA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II core promoter proximal region sequence-specific DNA binding IEA --
GO:0001077 transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding IEA --
GO:0003677 DNA binding IEA --
GO:0008134 transcription factor binding IPI 15044608
GO:0043565 contributes_to sequence-specific DNA binding IDA 15044608
genes like me logo Genes that share ontologies with FIGLA: view
genes like me logo Genes that share phenotypes with FIGLA: view

Human Phenotype Ontology for FIGLA Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for FIGLA Gene

MGI Knock Outs for FIGLA:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , miRNA , Transcription Factor Targets and HOMER Transcription for FIGLA Gene

Localization for FIGLA Gene

Subcellular locations from UniProtKB/Swiss-Prot for FIGLA Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FIGLA gene
Compartment Confidence
nucleus 5

Gene Ontology (GO) - Cellular Components for FIGLA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005667 transcription factor complex IDA 15044608
genes like me logo Genes that share ontologies with FIGLA: view

Pathways & Interactions for FIGLA Gene

SuperPathways for FIGLA Gene

SuperPathway Contained pathways
1 Ovarian Infertility Genes
genes like me logo Genes that share pathways with FIGLA: view

Pathways by source for FIGLA Gene

1 BioSystems pathway for FIGLA Gene

Interacting Proteins for FIGLA Gene

Gene Ontology (GO) - Biological Process for FIGLA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006366 transcription from RNA polymerase II promoter IEA --
GO:0007275 multicellular organism development IEA --
GO:0030154 cell differentiation IEA --
genes like me logo Genes that share ontologies with FIGLA: view

No data available for SIGNOR curated interactions for FIGLA Gene

Transcripts for FIGLA Gene

mRNA/cDNA for FIGLA Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(4) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FIGLA Gene

Folliculogenesis specific basic helix-loop-helix:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for FIGLA Gene

No ASD Table

Relevant External Links for FIGLA Gene

GeneLoc Exon Structure for
FIGLA
ECgene alternative splicing isoforms for
FIGLA

Expression for FIGLA Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FIGLA Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FIGLA Gene

This gene is overexpressed in Ovary (x7.8), Pancreas (x7.7), and Testis (x4.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FIGLA Gene



NURSA nuclear receptor signaling pathways regulating expression of FIGLA Gene:

FIGLA

SOURCE GeneReport for Unigene cluster for FIGLA Gene:

Hs.407636

mRNA Expression by UniProt/SwissProt for FIGLA Gene:

Q6QHK4-FIGLA_HUMAN
Tissue specificity: Germ cells. Expressed in the fetal ovary, but not by a range of other tissues. Expression increases across mid-gestation, rising some 40-fold by the time of primordial follicle formation.

Evidence on tissue expression from TISSUES for FIGLA Gene

  • Nervous system(4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FIGLA Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • endocrine
  • integumentary
  • nervous
  • reproductive
Organs:
Head and neck:
  • brain
  • head
  • pituitary gland
Thorax:
  • breast
Pelvis:
  • ovary
  • uterus
  • vagina
  • vulva
General:
  • hair
  • skin
genes like me logo Genes that share expression patterns with FIGLA: view

Primer Products

No data available for Protein differential expression in normal tissues and Protein tissue co-expression partners for FIGLA Gene

Orthologs for FIGLA Gene

This gene was present in the common ancestor of chordates.

Orthologs for FIGLA Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FIGLA 34 35
  • 99.24 (n)
cow
(Bos Taurus)
Mammalia FIGLA 34 35
  • 84.17 (n)
dog
(Canis familiaris)
Mammalia FIGLA 34 35
  • 79.87 (n)
rat
(Rattus norvegicus)
Mammalia Figla 34
  • 76.08 (n)
mouse
(Mus musculus)
Mammalia Figla 34 16 35
  • 74.47 (n)
oppossum
(Monodelphis domestica)
Mammalia FIGLA 35
  • 69 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii figla 35 35
  • 20 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 17 (a)
OneToOne
Species where no ortholog for FIGLA was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FIGLA Gene

ENSEMBL:
Gene Tree for FIGLA (if available)
TreeFam:
Gene Tree for FIGLA (if available)

Paralogs for FIGLA Gene

Pseudogenes.org Pseudogenes for FIGLA Gene

genes like me logo Genes that share paralogs with FIGLA: view

No data available for Paralogs for FIGLA Gene

Variants for FIGLA Gene

Sequence variations from dbSNP and Humsavar for FIGLA Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs587776535 Pathogenic 70,790,603(+) GGCGC(-/GGCGCGGGGATCTAGGACGCCG)GGCGC reference, frameshift-variant
rs150205874 Likely benign 70,777,314(+) AAACT(G/T)TCAAG utr-variant-3-prime
rs199650129 Likely benign 70,787,799(+) TTTTT(A/T)ATCTA reference, synonymous-codon
rs373561603 Likely benign 70,790,555(+) AACAC(G/T)TCCTC reference, missense
rs199702150 Uncertain significance 70,787,785(+) AACCA(C/T)GGTTG reference, missense

Structural Variations from Database of Genomic Variants (DGV) for FIGLA Gene

Variant ID Type Subtype PubMed ID
esv2762674 CNV gain 21179565
esv3892614 CNV gain 25118596
nsv1146915 OTHER inversion 26484159
nsv477319 CNV novel sequence insertion 20440878
nsv582192 CNV loss 21841781

Variation tolerance for FIGLA Gene

Residual Variation Intolerance Score: 65.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.41; 9.08% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FIGLA Gene

Human Gene Mutation Database (HGMD)
FIGLA
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FIGLA

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FIGLA Gene

Disorders for FIGLA Gene

MalaCards: The human disease database

(3) MalaCards diseases for FIGLA Gene - From: OMIM, ClinVar, GeneTests, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
premature ovarian failure 6
  • pof6
premature ovarian failure
  • premature menopause
female reproductive system disease
  • genital diseases, female
- elite association - COSMIC cancer census association via MalaCards
Search FIGLA in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

FIGLA_HUMAN
  • Premature ovarian failure 6 (POF6) [MIM:612310]: An ovarian disorder defined as the cessation of ovarian function under the age of 40 years. It is characterized by oligomenorrhea or amenorrhea, in the presence of elevated levels of serum gonadotropins and low estradiol. {ECO:0000269 PubMed:18499083}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for FIGLA

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FIGLA
genes like me logo Genes that share disorders with FIGLA: view

No data available for Genatlas for FIGLA Gene

Publications for FIGLA Gene

  1. Isolation, characterization and expression of the human Factor In the Germline alpha (FIGLA) gene in ovarian follicles and oocytes. (PMID: 12468641) Huntriss J. … Picton H.M. (Mol. Hum. Reprod. 2002) 2 3 4 22 64
  2. Increased expression of the FIGLA transcription factor is associated with primordial follicle formation in the human fetal ovary. (PMID: 15044608) Bayne R.A.L. … Anderson R.A. (Mol. Hum. Reprod. 2004) 3 4 22 64
  3. Transcription factor FIGLA is mutated in patients with premature ovarian failure. (PMID: 18499083) Zhao H. … Rajkovic A. (Am. J. Hum. Genet. 2008) 3 4 64
  4. Zona pellucida components are present in human fetal ovary before follicle formation. (PMID: 18502569) TAPrmAolAo R.M. … Vaskivuo T.E. (Mol. Cell. Endocrinol. 2008) 3 22 64
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64

Products for FIGLA Gene

Sources for FIGLA Gene

Content
Loading form....