Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AOAH Gene

Aliases for AOAH Gene

  • Acyloxyacyl Hydrolase 2 3 5
  • Acyloxyacyl Hydrolase (Neutrophil) 2
  • EC 3.1.1.77 4

External Ids for AOAH Gene

Previous GeneCards Identifiers for AOAH Gene

  • GC07M036199
  • GC07M036293
  • GC07M036325

Summaries for AOAH Gene

Entrez Gene Summary for AOAH Gene

  • This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Apr 2010]

GeneCards Summary for AOAH Gene

AOAH (Acyloxyacyl Hydrolase) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include hydrolase activity, acting on ester bonds and acyloxyacyl hydrolase activity.

UniProtKB/Swiss-Prot for AOAH Gene

  • Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).

Gene Wiki entry for AOAH Gene

Additional gene information for AOAH Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AOAH Gene

Genomics for AOAH Gene

GeneHancer (GH) Regulatory Elements for AOAH Gene

Promoters and enhancers for AOAH Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07I036722 Promoter/Enhancer 2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 570.1 -0.6 -601 5.2 MAX ELF1 GABPA POLR2A RUNX3 BCLAF1 MYC SPI1 AOAH ELMO1 ENSG00000272984
GH07I036735 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 19.1 -12.5 -12489 3.1 CTCF NR2F1 JUNB EBF1 ELF1 DPF2 IRF4 RELA POLR2A IKZF1 AOAH ELMO1 ENSG00000272984 ENSG00000229424
GH07I036745 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 18.1 -23.8 -23832 4.9 TAF1 MAX EBF1 CEBPG ZIC2 RAD21 ZBTB40 YY1 VEZF1 HNF4G AOAH MIR1200 ENSG00000229424 ENSG00000272984
GH07I036276 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 13.6 +441.8 441834 12.6 PKNOX1 FOXA2 MLX ARID4B DMAP1 IRF4 ZNF48 TCF12 SLC30A9 ZNF121 EEPD1 AOAH ENSG00000260070 SEPT7 ENSG00000234457 ENSG00000229679 GC07P036215
GH07I036261 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 15.4 +460.9 460863 5.4 ELF3 FOXA2 MAX BMI1 IRF4 ZFHX2 GATA3 POLR2A ATF7 PRDM10 EEPD1 AOAH SEPT7 ENSG00000229679 ENSG00000234457 GC07P036215
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around AOAH on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AOAH gene promoter:

Genomic Locations for AOAH Gene

Genomic Locations for AOAH Gene
chr7:36,512,941-36,724,549
(GRCh38/hg38)
Size:
211,609 bases
Orientation:
Minus strand
chr7:36,552,456-36,764,154
(GRCh37/hg19)

Genomic View for AOAH Gene

Genes around AOAH on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AOAH Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AOAH Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AOAH Gene

Proteins for AOAH Gene

  • Protein details for AOAH Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P28039-AOAH_HUMAN
    Recommended name:
    Acyloxyacyl hydrolase
    Protein Accession:
    P28039
    Secondary Accessions:
    • A4D1Y5
    • B7Z490
    • Q53F13

    Protein attributes for AOAH Gene

    Size:
    575 amino acids
    Molecular mass:
    65105 Da
    Quaternary structure:
    • Heterodimer of the large and small subunits; disulfide-linked.

    Alternative splice isoforms for AOAH Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AOAH Gene

Post-translational modifications for AOAH Gene

  • The small subunit is N-glycosylated.
  • Glycosylation at posLast=5959, Asn207, posLast=336336, Asn409, and posLast=466466

No data available for DME Specific Peptides for AOAH Gene

Domains & Families for AOAH Gene

Gene Families for AOAH Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Predicted secreted proteins

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with AOAH: view

No data available for UniProtKB/Swiss-Prot for AOAH Gene

Function for AOAH Gene

Molecular function for AOAH Gene

GENATLAS Biochemistry:
acyloxyacyl hydrolase,two-subunit lipase expressed in phagocytic cells,specifically hydrolyzing the secondary acyl chains of the liposaccharide found in the walls of gram-negative bacteria
UniProtKB/Swiss-Prot CatalyticActivity:
3-(acyloxy)acyl group of bacterial toxin = 3-hydroxyacyl group of bacterial toxin + a fatty acid.
UniProtKB/Swiss-Prot Function:
Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides (PubMed:1883828, PubMed:8089145). By breaking down LPS, terminates the host response to bacterial infection and prevents prolonged and damaging inflammatory responses (By similarity). In peritoneal macrophages, seems to be important for recovery from a state of immune tolerance following infection by Gram-negative bacteria (By similarity).

Enzyme Numbers (IUBMB) for AOAH Gene

Phenotypes From GWAS Catalog for AOAH Gene

Gene Ontology (GO) - Molecular Function for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003824 catalytic activity TAS 1883828
GO:0004465 lipoprotein lipase activity TAS 1883828
GO:0016787 hydrolase activity IEA --
GO:0016788 hydrolase activity, acting on ester bonds IEA --
GO:0050528 acyloxyacyl hydrolase activity IEA --
genes like me logo Genes that share ontologies with AOAH: view
genes like me logo Genes that share phenotypes with AOAH: view

Animal Models for AOAH Gene

MGI Knock Outs for AOAH:

Animal Model Products

Clone Products

No data available for Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for AOAH Gene

Localization for AOAH Gene

Subcellular locations from UniProtKB/Swiss-Prot for AOAH Gene

Secreted. Cytoplasmic vesicle. Note=Detected in urine. {ECO:0000250 UniProtKB:O35298}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AOAH gene
Compartment Confidence
extracellular 4
plasma membrane 2
lysosome 1

Gene Ontology (GO) - Cellular Components for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0031410 cytoplasmic vesicle IEA --
genes like me logo Genes that share ontologies with AOAH: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for AOAH Gene

Pathways & Interactions for AOAH Gene

No Data Available

Interacting Proteins for AOAH Gene

Selected Interacting proteins: P28039-AOAH_HUMAN for AOAH Gene via IID

Gene Ontology (GO) - Biological Process for AOAH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process TAS 1883828
GO:0006954 inflammatory response TAS 1883828
GO:0008653 lipopolysaccharide metabolic process IEA --
GO:0050728 negative regulation of inflammatory response IEA --
genes like me logo Genes that share ontologies with AOAH: view

No data available for Pathways by source and SIGNOR curated interactions for AOAH Gene

Drugs & Compounds for AOAH Gene

(1) Drugs for AOAH Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Water Approved Pharma 0

(1) Additional Compounds for AOAH Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with AOAH: view

Transcripts for AOAH Gene

Unigene Clusters for AOAH Gene

Acyloxyacyl hydrolase (neutrophil):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AOAH Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24a · 24b
SP1: - - - -
SP2:
SP3:

Relevant External Links for AOAH Gene

GeneLoc Exon Structure for
AOAH
ECgene alternative splicing isoforms for
AOAH

Expression for AOAH Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AOAH Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for AOAH Gene

This gene is overexpressed in Whole Blood (x29.7) and Spleen (x7.1).

Protein differential expression in normal tissues from HIPED for AOAH Gene

This gene is overexpressed in Spleen (31.7), Peripheral blood mononuclear cells (20.7), and Monocytes (13.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AOAH Gene



Protein tissue co-expression partners for AOAH Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of AOAH Gene:

AOAH

SOURCE GeneReport for Unigene cluster for AOAH Gene:

Hs.488007

Evidence on tissue expression from TISSUES for AOAH Gene

  • Blood(4.4)
  • Pancreas(4.1)
  • Spleen(2.3)
genes like me logo Genes that share expression patterns with AOAH: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for AOAH Gene

Orthologs for AOAH Gene

This gene was present in the common ancestor of chordates.

Orthologs for AOAH Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AOAH 33 34
  • 99.3 (n)
dog
(Canis familiaris)
Mammalia AOAH 34 33
  • 86.84 (n)
OneToOne
cow
(Bos Taurus)
Mammalia AOAH 33 34
  • 84.93 (n)
rat
(Rattus norvegicus)
Mammalia Aoah 33
  • 82.42 (n)
mouse
(Mus musculus)
Mammalia Aoah 16 34 33
  • 81.3 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia AOAH 34
  • 60 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia AOAH 34
  • 57 (a)
OneToOne
chicken
(Gallus gallus)
Aves AOAH 34 33
  • 68.09 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia AOAH 34
  • 62 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia aoah 33
  • 59.84 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 44 (a)
OneToOne
Species where no ortholog for AOAH was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for AOAH Gene

ENSEMBL:
Gene Tree for AOAH (if available)
TreeFam:
Gene Tree for AOAH (if available)

Paralogs for AOAH Gene

No data available for Paralogs for AOAH Gene

Variants for AOAH Gene

Sequence variations from dbSNP and Humsavar for AOAH Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000006851 -- 36,619,449(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000011334 -- 36,640,194(-) G/C genic_upstream_transcript_variant, intron_variant
rs1000018486 -- 36,601,755(-) T/A genic_upstream_transcript_variant, intron_variant
rs1000070682 -- 36,558,973(-) CTGCACCCACTGTCCTGCACCCACTGTC/CTGCACCCACTGTC intron_variant
rs1000086225 -- 36,720,006(-) C/A/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for AOAH Gene

Variant ID Type Subtype PubMed ID
esv2613811 CNV deletion 19546169
esv2676624 CNV deletion 23128226
esv33783 CNV gain 17666407
esv3576308 CNV gain 25503493
esv3612835 CNV loss 21293372
nsv1016732 CNV gain 25217958
nsv1032157 CNV gain 25217958
nsv1115738 CNV duplication 24896259
nsv1125426 OTHER inversion 24896259
nsv1137210 CNV deletion 24896259
nsv366801 CNV deletion 16902084
nsv464427 CNV loss 19166990
nsv470199 CNV loss 18288195
nsv473135 CNV novel sequence insertion 20440878
nsv477438 CNV novel sequence insertion 20440878
nsv5700 CNV insertion 18451855
nsv606618 CNV loss 21841781
nsv606619 CNV loss 21841781
nsv606620 CNV loss 21841781
nsv830957 CNV gain 17160897
nsv830958 CNV gain 17160897
nsv830960 CNV loss 17160897
nsv951630 CNV deletion 24416366
nsv957603 CNV deletion 24416366

Variation tolerance for AOAH Gene

Residual Variation Intolerance Score: 91.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.92; 74.39% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AOAH Gene

Human Gene Mutation Database (HGMD)
AOAH
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AOAH

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AOAH Gene

Disorders for AOAH Gene

Additional Disease Information for AOAH

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for AOAH Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for AOAH Gene

Publications for AOAH Gene

  1. Expression and characterization of recombinant human acyloxyacyl hydrolase, a leukocyte enzyme that deacylates bacterial lipopolysaccharides. (PMID: 1883828) Hagen FS … Munford RS (Biochemistry 1991) 2 3 4 22 58
  2. Polymorphisms in the novel gene acyloxyacyl hydroxylase (AOAH) are associated with asthma and associated phenotypes. (PMID: 16815140) Barnes KC … Mathias RA (The Journal of allergy and clinical immunology 2006) 3 22 44 58
  3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  4. Host determinants of HIV-1 control in African Americans. (PMID: 20205591) Pelak K … National Institute of Allergy and Infectious Diseases Center for HIV/AIDS Vaccine Immunology (CHAVI) (The Journal of infectious diseases 2010) 3 44 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for AOAH Gene

Sources for AOAH Gene

Content
Loading form....