Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FLT3LG Gene

Aliases for FLT3LG Gene

  • Fms Related Tyrosine Kinase 3 Ligand 2 3
  • Fms-Related Tyrosine Kinase 3 Ligand 2 5
  • Flt3 Ligand 3 4
  • FLT3L 3 4
  • SL Cytokine 4
  • FL 3

External Ids for FLT3LG Gene

Previous GeneCards Identifiers for FLT3LG Gene

  • GC19P050635
  • GC19P050345
  • GC19P054653
  • GC19P054669
  • GC19P049977
  • GC19P046355

Summaries for FLT3LG Gene

Entrez Gene Summary for FLT3LG Gene

  • Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011]

GeneCards Summary for FLT3LG Gene

FLT3LG (Fms Related Tyrosine Kinase 3 Ligand) is a Protein Coding gene. Diseases associated with FLT3LG include aplastic anemia. Among its related pathways are Immune System and Interleukin-3, 5 and GM-CSF signaling. GO annotations related to this gene include protein homodimerization activity and cytokine activity.

UniProtKB/Swiss-Prot for FLT3LG Gene

  • Stimulates the proliferation of early hematopoietic cells by activating FLT3. Synergizes well with a number of other colony stimulating factors and interleukins.

Gene Wiki entry for FLT3LG Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FLT3LG Gene

Genomics for FLT3LG Gene

Regulatory Elements for FLT3LG Gene

Promoters for FLT3LG Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around FLT3LG on UCSC Golden Path with GeneCards custom track

Genomic Location for FLT3LG Gene

49,474,172 bp from pter
49,486,234 bp from pter
12,063 bases
Plus strand

Genomic View for FLT3LG Gene

Genes around FLT3LG on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FLT3LG Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FLT3LG Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FLT3LG Gene

Proteins for FLT3LG Gene

  • Protein details for FLT3LG Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Fms-related tyrosine kinase 3 ligand
    Protein Accession:
    Secondary Accessions:
    • A0AVC2
    • B9EGH2
    • Q05C96

    Protein attributes for FLT3LG Gene

    235 amino acids
    Molecular mass:
    26416 Da
    Quaternary structure:
    • Homodimer (isoform 2).

    Three dimensional structures from OCA and Proteopedia for FLT3LG Gene

    Alternative splice isoforms for FLT3LG Gene


neXtProt entry for FLT3LG Gene

Proteomics data for FLT3LG Gene at MOPED

Post-translational modifications for FLT3LG Gene

  • Glycosylation at Asn 126 and Asn 149

Antibody Products

  • R&D Systems Antibodies for FLT3LG (Flt-3 Ligand)

No data available for DME Specific Peptides for FLT3LG Gene

Domains & Families for FLT3LG Gene

Gene Families for FLT3LG Gene

Protein Domains for FLT3LG Gene

Suggested Antigen Peptide Sequences for FLT3LG Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with FLT3LG: view

No data available for UniProtKB/Swiss-Prot for FLT3LG Gene

Function for FLT3LG Gene

Molecular function for FLT3LG Gene

GENATLAS Biochemistry:
FLT3 ligand,stimulating proliferation of hematopoietic cells
UniProtKB/Swiss-Prot Function:
Stimulates the proliferation of early hematopoietic cells by activating FLT3. Synergizes well with a number of other colony stimulating factors and interleukins.
genes like me logo Genes that share phenotypes with FLT3LG: view

Animal Models for FLT3LG Gene

MGI Knock Outs for FLT3LG:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for FLT3LG Gene

Localization for FLT3LG Gene

Subcellular locations from UniProtKB/Swiss-Prot for FLT3LG Gene

Isoform 1: Cell membrane; Single-pass type I membrane protein.
Isoform 2: Secreted.

Subcellular locations from

Jensen Localization Image for FLT3LG Gene COMPARTMENTS Subcellular localization image for FLT3LG gene
Compartment Confidence
extracellular 5
plasma membrane 5
cytosol 2
nucleus 1

No data available for Gene Ontology (GO) - Cellular Components for FLT3LG Gene

Pathways & Interactions for FLT3LG Gene

genes like me logo Genes that share pathways with FLT3LG: view

Interacting Proteins for FLT3LG Gene

STRING Interaction Network Preview (showing 2 interactants - click image to see details)
Selected Interacting proteins: P49771-FLT3L_HUMAN ENSP00000468977 for FLT3LG Gene via I2D MINT STRING

SIGNOR curated interactions for FLT3LG Gene


Gene Ontology (GO) - Biological Process for FLT3LG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction TAS 8180375
GO:0030098 lymphocyte differentiation IEA --
GO:0030885 regulation of myeloid dendritic cell activation IEA --
GO:0032825 positive regulation of natural killer cell differentiation IEA --
GO:0045663 positive regulation of myoblast differentiation IEA --
genes like me logo Genes that share ontologies with FLT3LG: view

Drugs & Compounds for FLT3LG Gene

(4) Drugs for FLT3LG Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for FLT3LG Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with FLT3LG: view

Transcripts for FLT3LG Gene

mRNA/cDNA for FLT3LG Gene

(22) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(7) Selected AceView cDNA sequences:
(12) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FLT3LG Gene

Fms-related tyrosine kinase 3 ligand:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for FLT3LG Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b
SP1: - -
SP2: - -
SP3: -

Relevant External Links for FLT3LG Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FLT3LG Gene

mRNA expression in normal human tissues for FLT3LG Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FLT3LG Gene

This gene is overexpressed in Whole Blood (x5.9).

SOURCE GeneReport for Unigene cluster for FLT3LG Gene Hs.428

genes like me logo Genes that share expression patterns with FLT3LG: view

Primer Products

In Situ Assay Products

No data available for Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for FLT3LG Gene

Orthologs for FLT3LG Gene

This gene was present in the common ancestor of chordates.

Orthologs for FLT3LG Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia FLT3LG 35
  • 82.21 (n)
  • 79.78 (a)
  • 60 (a)
(Canis familiaris)
Mammalia FLT3LG 35
  • 85 (n)
  • 80.91 (a)
  • 62 (a)
(Mus musculus)
Mammalia Flt3l 35
  • 73.84 (n)
  • 72.2 (a)
Flt3l 16
Flt3l 36
  • 66 (a)
(Pan troglodytes)
Mammalia FLT3LG 35
  • 99.44 (n)
  • 99.44 (a)
  • 99 (a)
(Rattus norvegicus)
Mammalia LOC102547607 35
  • 74.84 (n)
  • 71.63 (a)
(Ornithorhynchus anatinus)
Mammalia FLT3LG 36
  • 40 (a)
(Anolis carolinensis)
Reptilia FLT3LG 36
  • 28 (a)
Species with no ortholog for FLT3LG:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for FLT3LG Gene

Gene Tree for FLT3LG (if available)
Gene Tree for FLT3LG (if available)

Paralogs for FLT3LG Gene

(4) SIMAP similar genes for FLT3LG Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with FLT3LG: view

No data available for Paralogs for FLT3LG Gene

Variants for FLT3LG Gene

Sequence variations from dbSNP and Humsavar for FLT3LG Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs1042120 -- 49,480,416(+) CTGGC(C/T)GCTGC intron-variant, nc-transcript-variant, reference, synonymous-codon, missense
rs3745307 -- 49,476,314(-) ggctg(A/G)ggact intron-variant
rs3833223 -- 49,476,339(-) ggctg(-/CTGGGTCTGAGGGAGGAGGGGCTGGGCCGGGGCTC)ctggg intron-variant
rs4352151 -- 49,482,228(+) TCAAG(C/T)GATTC intron-variant, downstream-variant-500B
rs4802610 -- 49,477,767(+) aaaag(C/G)ctggg intron-variant

Structural Variations from Database of Genomic Variants (DGV) for FLT3LG Gene

Variant ID Type Subtype PubMed ID
nsv9739 CNV Gain+Loss 18304495
nsv912261 CNV Loss 21882294
nsv912262 CNV Loss 21882294
nsv912264 CNV Loss 21882294
nsv833862 CNV Loss 17160897
nsv912265 CNV Loss 21882294
nsv833863 CNV Loss 17160897

Variation tolerance for FLT3LG Gene

Residual Variation Intolerance Score: 57.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.38; 8.28% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FLT3LG Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FLT3LG Gene

Disorders for FLT3LG Gene

MalaCards: The human disease database

(1) MalaCards diseases for FLT3LG Gene - From: Novoseek and GeneCards

Disorder Aliases PubMed IDs
aplastic anemia
  • pulmonary fibrosis, idiopathic
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for FLT3LG

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with FLT3LG: view

No data available for UniProtKB/Swiss-Prot and Genatlas for FLT3LG Gene

Publications for FLT3LG Gene

  1. Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. (PMID: 8145851) Hannum C. … Lee F. (Nature 1994) 2 3 4 67
  2. Human Flt-3-ligand-mobilized dendritic cells require additional activation to drive effective immune responses. (PMID: 17949888) Diener K.R. … Hayball J.D. (Exp. Hematol. 2008) 3 23
  3. Increased blood myeloid dendritic cells and dendritic cell-poietins in Langerhans cell histiocytosis. (PMID: 15728521) Rolland A. … Palucka A.K. (J. Immunol. 2005) 3 23
  4. Flt3 ligand enhances thymic-dependent and thymic-independent immune reconstitution. (PMID: 15226184) Fry T.J. … Mackall C.L. (Blood 2004) 3 23
  5. Antiapoptotic cytokine IL-3 + SCF + FLT3L influence on proliferation of gamma-irradiated AC133+/CD34+ progenitor cells. (PMID: 12002675) VA!vrovA! J. … Filip S. (Folia Biol. (Praha) 2002) 3 23

Products for FLT3LG Gene

Sources for FLT3LG Gene

Back to Top
