Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LYST Gene

Aliases for LYST Gene

  • Lysosomal Trafficking Regulator 2 3
  • Chediak-Higashi Syndrome 1 2 3
  • Beige Homolog 3 4
  • CHS1 3 4
  • CHS 3 4
  • Lysosomal-Trafficking Regulator 3
  • CHS1, 6

External Ids for LYST Gene

Previous HGNC Symbols for LYST Gene

  • CHS1

Previous GeneCards Identifiers for LYST Gene

  • GC01M232151
  • GC01M233890
  • GC01M235824
  • GC01M206276

Summaries for LYST Gene

Entrez Gene Summary for LYST Gene

  • This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]

GeneCards Summary for LYST Gene

LYST (Lysosomal Trafficking Regulator) is a Protein Coding gene. Diseases associated with LYST include chediak-higashi syndrome and attenuated ch�diak-higashi syndrome. An important paralog of this gene is WDFY3.

UniProtKB/Swiss-Prot for LYST Gene

  • May be required for sorting endosomal resident proteins into late multivesicular endosomes by a mechanism involving microtubules

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LYST Gene

Genomics for LYST Gene

Regulatory Elements for LYST Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for LYST Gene

235,661,031 bp from pter
235,883,708 bp from pter
222,678 bases
Minus strand

Genomic View for LYST Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for LYST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LYST Gene

Proteins for LYST Gene

  • Protein details for LYST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Lysosomal-trafficking regulator
    Protein Accession:
    Secondary Accessions:
    • O43274
    • Q5T2U9
    • Q96TD7
    • Q96TD8
    • Q99709
    • Q9H133

    Protein attributes for LYST Gene

    3801 amino acids
    Molecular mass:
    429139 Da
    Quaternary structure:
    • Interacts with CENPJ, LIP8 and ZNF521.

    Alternative splice isoforms for LYST Gene


neXtProt entry for LYST Gene

Proteomics data for LYST Gene at MOPED

Post-translational modifications for LYST Gene

  • Ubiquitination at Lys1305 and Lys3191
  • Modification sites at PhosphoSitePlus

Other Protein References for LYST Gene

No data available for DME Specific Peptides for LYST Gene

Domains for LYST Gene

Gene Families for LYST Gene

Suggested Antigen Peptide Sequences for LYST Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 BEACH domain.
  • Contains 7 WD repeats.
  • Contains 1 BEACH domain.
  • Contains 7 WD repeats.
genes like me logo Genes that share domains with LYST: view

Function for LYST Gene

Molecular function for LYST Gene

GENATLAS Biochemistry:
putative lysosomal associated membrane protein,intracellular trafficking regulator,with two alternatively spliced isoforms,homologous to mouse beige and yeast VPS15
UniProtKB/Swiss-Prot Function:
May be required for sorting endosomal resident proteins into late multivesicular endosomes by a mechanism involving microtubules

Gene Ontology (GO) - Molecular Function for LYST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005488 binding --
GO:0005515 protein binding IPI 11984006
GO:0005543 phospholipid binding IBA --
genes like me logo Genes that share ontologies with LYST: view
genes like me logo Genes that share phenotypes with LYST: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for LYST

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for LYST Gene

Localization for LYST Gene

Subcellular locations from UniProtKB/Swiss-Prot for LYST Gene


Subcellular locations from

Jensen Localization Image for LYST Gene COMPARTMENTS Subcellular localization image for LYST gene
Compartment Confidence
cytoskeleton 5
cytosol 3
plasma membrane 3
endosome 2
lysosome 2
vacuole 2

Gene Ontology (GO) - Cellular Components for LYST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol IEA --
GO:0012505 endomembrane system IBA --
GO:0015630 microtubule cytoskeleton IDA 9606205
GO:0019898 extrinsic component of membrane IBA --
genes like me logo Genes that share ontologies with LYST: view

Pathways for LYST Gene

SuperPathways for LYST Gene

No Data Available

Gene Ontology (GO) - Biological Process for LYST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002446 neutrophil mediated immunity IEA --
GO:0002456 T cell mediated immunity IEA --
GO:0006644 phospholipid metabolic process IEA --
GO:0007017 microtubule-based process IEA --
GO:0007040 lysosome organization IEA --
genes like me logo Genes that share ontologies with LYST: view

No data available for Pathways by source for LYST Gene

Drugs for LYST Gene

(7) Novoseek inferred chemical compound relationships for LYST Gene

Compound -log(P) Hits PubMed IDs
chalcone 78.7 7
chitin 68 13
anthocyanin 44.3 1
flavonoid 29.3 1
histidine 10.2 1
genes like me logo Genes that share compounds with LYST: view

Transcripts for LYST Gene

Unigene Clusters for LYST Gene

Lysosomal trafficking regulator:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for LYST

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for LYST Gene

No ASD Table

Relevant External Links for LYST Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for LYST Gene

mRNA expression in normal human tissues for LYST Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for LYST Gene

This gene is overexpressed in Whole Blood (5.6).

Protein differential expression in normal tissues for LYST Gene

This gene is overexpressed in Bone marrow mesenchymal stem cell (17.2), Breast (13.6), and Peripheral blood mononuclear cells (8.1).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for LYST Gene

SOURCE GeneReport for Unigene cluster for LYST Gene Hs.532411

mRNA Expression by UniProt/SwissProt for LYST Gene

Tissue specificity: Abundantly expressed in adult and fetal thymus, peripheral blood leukocytes, bone marrow and several regions of the adult brain
genes like me logo Genes that share expressions with LYST: view

Primer Products

In Situ Assay Products

No data available for Expression partners for LYST Gene

Orthologs for LYST Gene

This gene was present in the common ancestor of animals.

Orthologs for LYST Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia LYST 35
  • 90.03 (n)
  • 90.54 (a)
  • 91 (a)
(Canis familiaris)
Mammalia LYST 35
  • 90.61 (n)
  • 90.84 (a)
  • 91 (a)
(Mus musculus)
Mammalia Lyst 35
  • 85.2 (n)
  • 85.64 (a)
Lyst 16
Lyst 36
  • 86 (a)
(Pan troglodytes)
Mammalia LYST 35
  • 99.43 (n)
  • 99.11 (a)
  • 99 (a)
(Rattus norvegicus)
Mammalia Lyst 35
  • 85.32 (n)
  • 85.51 (a)
(Monodelphis domestica)
Mammalia LYST 36
  • 79 (a)
(Ornithorhynchus anatinus)
Mammalia LYST 36
  • 74 (a)
(Gallus gallus)
Aves LYST 35
  • 73.17 (n)
  • 73.77 (a)
  • 73 (a)
(Anolis carolinensis)
Reptilia LYST 36
  • 71 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia lyst 35
  • 67.36 (n)
  • 65.36 (a)
(Danio rerio)
Actinopterygii lyst 35
  • 61.63 (n)
  • 63.44 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG42863 36
  • 25 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 53 (a)
Species with no ortholog for LYST:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for LYST Gene

Gene Tree for LYST (if available)
Gene Tree for LYST (if available)

Paralogs for LYST Gene

Paralogs for LYST Gene Pseudogenes for LYST Gene

genes like me logo Genes that share paralogs with LYST: view

Variants for LYST Gene

Sequence variations from dbSNP and Humsavar for LYST Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type MAF
rs80338667 Pathogenic 235,716,749(-) TCAGT(-/A)TAAAG frameshift-variant, reference
rs80338666 Pathogenic 235,724,114(-) TTCAC(-/TTCTTTCAGT)AAGCG reference, frameshift-variant
rs80338665 Pathogenic 235,728,076(-) TGCAG(-/GTAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCG)GTGAG frameshift-variant, reference
rs80338664 Pathogenic 235,733,859(-) GCTTG(A/G)CAGAA stop-gained, reference
rs80338652 Pathogenic 235,805,826(-) GTATA(C/T)GACTT reference, stop-gained

Structural Variations from Database of Genomic Variants (DGV) for LYST Gene

Variant ID Type Subtype PubMed ID
nsv832936 CNV Gain 17160897
esv2661819 CNV Deletion 23128226
nsv832947 CNV Gain 17160897
nsv508701 CNV Loss 20534489

Relevant External Links for LYST Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)
Locus Specific Mutation Databases (LSDB)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for LYST Gene

Disorders for LYST Gene

(1) OMIM Diseases for LYST Gene (606897)


  • Chediak-Higashi syndrome (CHS) [MIM:214500]: A rare autosomal recessive disorder characterized by hypopigmentation, severe immunologic deficiency, a bleeding tendency, neurologic abnormalities, abnormal intracellular transport to and from the lysosome, and giant inclusion bodies in a variety of cell types. Most patients die at an early age unless they receive an allogeneic hematopoietic stem cell transplant (SCT). {ECO:0000269 PubMed:11857544, ECO:0000269 PubMed:24521565}. Note=The disease is caused by mutations affecting the gene represented in this entry.

(2) Novoseek inferred disease relationships for LYST Gene

Disease -log(P) Hits PubMed IDs
chediak-higashi syndrome 95.7 12
tumors 3.9 1

Relevant External Links for LYST

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
genes like me logo Genes that share disorders with LYST: view

No data available for Genatlas for LYST Gene

Publications for LYST Gene

  1. Identification of the homologous beige and Chediak-Higashi syndrome genes. (PMID: 8717042) Barbosa M.D.F.S. … Kingsmore S.F. (Nature 1996) 2 3 4 23
  2. Apparent genotype-phenotype correlation in childhood, adolescent, and adult Chediak-Higashi syndrome. (PMID: 11857544) Karim M.A. … Spritz R.A. (Am. J. Med. Genet. 2002) 3 4 23
  3. The Chediak-Higashi protein interacts with SNARE complex and signal transduction proteins. (PMID: 11984006) Tchernev V.T. … Kingsmore S.F. (Mol. Med. 2002) 3 4 23
  4. Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome. (PMID: 8896560) Nagle D.L. … Moore K.J. (Nat. Genet. 1996) 2 3 4
  5. Digital quantification of human eye color highlights genetic association of three new loci. (PMID: 20463881) Liu F. … Kayser M. (PLoS Genet. 2010) 3 23

Products for LYST Gene

Sources for LYST Gene

Back to Top
