Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CTCF Gene

Aliases for CTCF Gene

  • CCCTC-Binding Factor 2 3 4
  • CCCTC-Binding Factor (Zinc Finger Protein) 2 3 5
  • 11 Zinc Finger Transcriptional Repressor 2 3
  • 11-Zinc Finger Protein 3 4
  • CTCFL Paralog 3 4
  • MRD21 3

External Ids for CTCF Gene

Previous GeneCards Identifiers for CTCF Gene

  • GC16P058290
  • GC16P067974
  • GC16P067331
  • GC16P067373
  • GC16P067374
  • GC16P066153
  • GC16P067596
  • GC16P053469

Summaries for CTCF Gene

Entrez Gene Summary for CTCF Gene

  • This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

GeneCards Summary for CTCF Gene

CTCF (CCCTC-Binding Factor) is a Protein Coding gene. Diseases associated with CTCF include mental retardation, autosomal dominant 21 and intellectual disability-feeding difficulties-developmental delay-microcephaly syndrome. Among its related pathways are Developmental Biology and SIDS Susceptibility Pathways. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and chromatin binding. An important paralog of this gene is RREB1.

UniProtKB/Swiss-Prot for CTCF Gene

  • Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription. When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of IGF2/H19.

Gene Wiki entry for CTCF Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CTCF Gene

Genomics for CTCF Gene

Regulatory Elements for CTCF Gene

Promoters for CTCF Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around CTCF on UCSC Golden Path with GeneCards custom track

Genomic Location for CTCF Gene

67,562,407 bp from pter
67,639,185 bp from pter
76,779 bases
Plus strand

Genomic View for CTCF Gene

Genes around CTCF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CTCF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CTCF Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CTCF Gene

Proteins for CTCF Gene

  • Protein details for CTCF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transcriptional repressor CTCF
    Protein Accession:
    Secondary Accessions:
    • B5MC38
    • Q53XI7
    • Q59EL8

    Protein attributes for CTCF Gene

    727 amino acids
    Molecular mass:
    82785 Da
    Quaternary structure:
    • Interacts with CHD8.
    • More than 1300 CTCF-binding sites in potential insulators were identified in the human genome.
    • Sequence=BAD93030.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for CTCF Gene

    Alternative splice isoforms for CTCF Gene


neXtProt entry for CTCF Gene

Proteomics data for CTCF Gene at MOPED

Post-translational modifications for CTCF Gene

  • Sumoylated on Lys-74 and Lys-689; sumoylation of CTCF contributes to the repressive function of CTCF on the MYC P2 promoter.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CTCF Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for CTCF (CTCF)

No data available for DME Specific Peptides for CTCF Gene

Domains & Families for CTCF Gene

Gene Families for CTCF Gene

Protein Domains for CTCF Gene

Suggested Antigen Peptide Sequences for CTCF Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The 11 zinc fingers are highly conserved among vertebrates, exhibiting almost identical amino acid sequences. Different subsets or combination of individual zinc fingers gives the ability to CTCF to recognize multiple DNA target sites.
  • Belongs to the CTCF zinc-finger protein family.
  • Contains 11 C2H2-type zinc fingers.
  • The 11 zinc fingers are highly conserved among vertebrates, exhibiting almost identical amino acid sequences. Different subsets or combination of individual zinc fingers gives the ability to CTCF to recognize multiple DNA target sites.
  • Belongs to the CTCF zinc-finger protein family.
  • Contains 11 C2H2-type zinc fingers.
genes like me logo Genes that share domains with CTCF: view

Function for CTCF Gene

Molecular function for CTCF Gene

GENATLAS Biochemistry:
Myc regulatory factor,expressed in cells of multiple lineages,in the chromosomal region deleted in sporadic breast and prostate carcinomas (see TSG16A)
UniProtKB/Swiss-Prot Function:
Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers and silencers. Acts as transcriptional repressor binding to promoters of vertebrate MYC gene and BAG1 gene. Also binds to the PLK and PIM1 promoters. Acts as a transcriptional activator of APP. Regulates APOA1/C3/A4/A5 gene cluster and controls MHC class II gene expression. Plays an essential role in oocyte and preimplantation embryo development by activating or repressing transcription. Seems to act as tumor suppressor. Plays a critical role in the epigenetic regulation. Participates in the allele-specific gene expression at the imprinted IGF2/H19 gene locus. On the maternal allele, binding within the H19 imprinting control region (ICR) mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to IGF2. Plays a critical role in gene silencing over considerable distances in the genome. Preferentially interacts with unmethylated DNA, preventing spreading of CpG methylation and maintaining methylation-free zones. Inversely, binding to target sites is prevented by CpG methylation. Plays a important role in chromatin remodeling. Can dimerize when it is bound to different DNA sequences, mediating long-range chromatin looping. Mediates interchromosomal association between IGF2/H19 and WSB1/NF1 and may direct distant DNA segments to a common transcription factory. Causes local loss of histone acetylation and gain of histone methylation in the beta-globin locus, without affecting transcription. When bound to chromatin, it provides an anchor point for nucleosomes positioning. Seems to be essential for homologous X-chromosome pairing. May participate with Tsix in establishing a regulatable epigenetic switch for X chromosome inactivation. May play a role in preventing the propagation of stable methylation at the escape genes from X- inactivation. Involved in sister chromatid cohesion. Associates with both centromeres and chromosomal arms during metaphase and required for cohesin localization to CTCF sites. Regulates asynchronous replication of IGF2/H19.

Gene Ontology (GO) - Molecular Function for CTCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 19505873
GO:0043035 chromatin insulator sequence binding IDA 17827499
genes like me logo Genes that share ontologies with CTCF: view
genes like me logo Genes that share phenotypes with CTCF: view

Human Phenotype Ontology for CTCF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CTCF Gene

MGI Knock Outs for CTCF:

Animal Model Products

Targeted motifs for CTCF Gene
HOMER Transcription Factor Regulatory Elements motif CTCF
  • Consensus sequence: ATAGTGCCACCTGGTGGCCA Submotif: canonical Cell Type: CD4+

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for CTCF Gene

Localization for CTCF Gene

Subcellular locations from UniProtKB/Swiss-Prot for CTCF Gene

Nucleus, nucleoplasm. Chromosome. Chromosome, centromere. Note=May translocate to the nucleolus upon cell differentiation. Associates with both centromeres and chromosomal arms during metaphase. Associates with the H19 ICR in mitotic chromosomes. May be preferentially excluded from heterochromatin during interphase.

Subcellular locations from

Jensen Localization Image for CTCF Gene COMPARTMENTS Subcellular localization image for CTCF gene
Compartment Confidence
nucleus 5
cytosol 2

No data available for Gene Ontology (GO) - Cellular Components for CTCF Gene

Pathways & Interactions for CTCF Gene

genes like me logo Genes that share pathways with CTCF: view

Gene Ontology (GO) - Biological Process for CTCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007059 chromosome segregation IEA --
GO:0016568 chromatin modification IEA --
GO:0031060 regulation of histone methylation IEA --
GO:0040030 regulation of molecular function, epigenetic IMP 16815976
genes like me logo Genes that share ontologies with CTCF: view

No data available for SIGNOR curated interactions for CTCF Gene

Drugs & Compounds for CTCF Gene

(2) Drugs for CTCF Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for CTCF Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CTCF: view

Transcripts for CTCF Gene

Unigene Clusters for CTCF Gene

CCCTC-binding factor (zinc finger protein):
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CTCF Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c
SP1: - - - -
SP2: -
SP3: -

Relevant External Links for CTCF Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CTCF Gene

mRNA expression in normal human tissues for CTCF Gene

Protein differential expression in normal tissues from HIPED for CTCF Gene

This gene is overexpressed in Blymphocyte (12.6), Peripheral blood mononuclear cells (11.3), and NK cells (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for CTCF Gene

SOURCE GeneReport for Unigene cluster for CTCF Gene Hs.368367

mRNA Expression by UniProt/SwissProt for CTCF Gene

Tissue specificity: Ubiquitous. Absent in primary spermatocytes.
genes like me logo Genes that share expression patterns with CTCF: view

Protein tissue co-expression partners for CTCF Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for CTCF Gene

Orthologs for CTCF Gene

This gene was present in the common ancestor of animals.

Orthologs for CTCF Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia CTCF 35
  • 94.31 (n)
  • 99.45 (a)
  • 99 (a)
(Canis familiaris)
Mammalia CTCF 35
  • 94.18 (n)
  • 99.59 (a)
  • 99 (a)
(Mus musculus)
Mammalia Ctcf 35
  • 90.97 (n)
  • 97.11 (a)
Ctcf 16
Ctcf 36
  • 98 (a)
(Pan troglodytes)
Mammalia CTCF 35
  • 99.91 (n)
  • 100 (a)
  • 100 (a)
(Rattus norvegicus)
Mammalia Ctcf 35
  • 91.98 (n)
  • 98.49 (a)
(Monodelphis domestica)
Mammalia CTCF 36
  • 95 (a)
(Ornithorhynchus anatinus)
Mammalia CTCF 36
  • 84 (a)
(Gallus gallus)
Aves CTCF 35
  • 83.65 (n)
  • 93.25 (a)
  • 92 (a)
(Anolis carolinensis)
Reptilia CTCF 36
  • 92 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ctcf 35
  • 76.35 (n)
  • 83.82 (a)
Str.970 35
African clawed frog
(Xenopus laevis)
Amphibia MGC68419 35
(Danio rerio)
Actinopterygii ctcf 35
  • 71.78 (n)
  • 78.8 (a)
ctcf 36
  • 71 (a)
fruit fly
(Drosophila melanogaster)
Insecta CTCF 37
  • 34 (a)
  • 24 (a)
Species with no ortholog for CTCF:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CTCF Gene

Gene Tree for CTCF (if available)
Gene Tree for CTCF (if available)

Paralogs for CTCF Gene

Paralogs for CTCF Gene

(3) SIMAP similar genes for CTCF Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with CTCF: view

Variants for CTCF Gene

Sequence variations from dbSNP and Humsavar for CTCF Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
VAR_013141 A Wilms tumor
VAR_013142 A breast tumor
VAR_013143 A prostate tumor
VAR_013144 A Wilms tumor
VAR_070776 Mental retardation, autosomal dominant 21 (MRD21)

Structural Variations from Database of Genomic Variants (DGV) for CTCF Gene

Variant ID Type Subtype PubMed ID
nsv524363 CNV Loss 19592680
nsv522852 CNV Gain 19592680
nsv833266 CNV Loss 17160897
nsv827711 CNV Gain 20364138
esv26764 CNV Loss 19812545
esv2668512 CNV Deletion 23128226
esv2714650 CNV Deletion 23290073
dgv2890n71 CNV Loss 21882294

Variation tolerance for CTCF Gene

Residual Variation Intolerance Score: 4.07% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.35; 7.84% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CTCF Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CTCF Gene

Disorders for CTCF Gene

MalaCards: The human disease database

(5) MalaCards diseases for CTCF Gene - From: OMIM, ClinVar, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search CTCF in MalaCards View complete list of genes associated with diseases


  • Mental retardation, autosomal dominant 21 (MRD21) [MIM:615502]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. Additional MRD21 features include short stature, microcephaly, and developmental delay. {ECO:0000269 PubMed:23746550}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for CTCF

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with CTCF: view

No data available for Genatlas for CTCF Gene

Publications for CTCF Gene

  1. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. (PMID: 8649389) Filippova G.N. … Lobanenkov V.V. (Mol. Cell. Biol. 1996) 2 3 4 23 67
  2. CTCF physically links cohesin to chromatin. (PMID: 18550811) Rubio E.D. … Krumm A. (Proc. Natl. Acad. Sci. U.S.A. 2008) 2 3 23
  3. CTCF is a DNA methylation-sensitive positive regulator of the INK/ARF locus. (PMID: 20051228) Rodriguez C. … Piette J. (Biochem. Biophys. Res. Commun. 2010) 3 23
  4. Epigenetic regulation of the human p53 gene promoter by the CTCF transcription factor in transformed cell lines. (PMID: 20101205) Soto-Reyes E. … Recillas-Targa F. (Oncogene 2010) 3 23
  5. NF-kappaB subtypes regulate CCCTC binding factor affecting corneal epithelial cell fate. (PMID: 20110362) Lu L. … Wang J. (J. Biol. Chem. 2010) 3 23

Products for CTCF Gene

Sources for CTCF Gene

Back to Top
