Aliases for CENPF Gene
Aliases for CENPF Gene
External Ids for CENPF Gene
- HGNC: 1857
- Entrez Gene: 1063
- Ensembl: ENSG00000117724
- OMIM: 600236
- UniProtKB: P49454
Previous GeneCards Identifiers for CENPF Gene
- GC01P213428
- GC01P210596
- GC01P211392
- GC01P211833
- GC01P211165
- GC01P212843
- GC01P214776
- GC01P185450
Summaries for CENPF Gene
-
This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
GeneCards Summary for CENPF Gene
CENPF (Centromere Protein F) is a Protein Coding gene. Diseases associated with CENPF include Stromme Syndrome and Intestinal Atresia. Among its related pathways are Gastric Cancer Network 1 and FOXM1 transcription factor network. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and transcription factor binding.
UniProtKB/Swiss-Prot for CENPF Gene
-
Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.
Additional gene information for CENPF Gene
- Monarch Initiative
- Search for CENPF at DataMed
- Search for CENPF at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CENPF Gene
Genomics for CENPF Gene
GeneHancer (GH) Regulatory Elements for CENPF Gene
Regulatory Element Products
Genomic Locations for CENPF Gene
- chr1:214,603,179-214,664,588
- (GRCh38/hg38)
- Size:
- 61,410 bases
- Orientation:
- Plus strand
- chr1:214,776,532-214,837,931
- (GRCh37/hg19)
Genomic View for CENPF Gene
- Cytogenetic band:
-
- 1q41 by Ensembl
- 1q41 by Entrez Gene
- 1q41 by HGNC


RefSeq DNA sequence for CENPF Gene
Proteins for CENPF Gene
-
Protein details for CENPF Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P49454-CENPF_HUMAN
- Recommended name:
- Centromere protein F
- Protein Accession:
- P49454
- Q13171
- Q13246
- Q5VVM7
Protein attributes for CENPF Gene
- Size:
- 3210 amino acids
- Molecular mass:
- 367764 Da
- Quaternary structure:
-
- Interacts with and STX4 (via C-terminus) (By similarity). Interacts (via N-terminus) with RBL1, RBL2 and SNAP25 (By similarity). Self-associates. Interacts with CENP-E and BUBR1 (via C-terminus). Interacts (via C-terminus) with NDE1, NDEL1 and RB1.
Protein Expression for CENPF Gene
Post-translational modifications for CENPF Gene
- Hyperphosphorylated during mitosis.
- Ubiquitination at Lys19, posLast=223223, posLast=293293, Lys314, Lys356, Lys457, posLast=513513, posLast=527527, posLast=555555, posLast=697697, Lys770, Lys823, posLast=956956, posLast=10221022, Lys1088, Lys1341, posLast=14101410, posLast=19061906, Lys2132, and posLast=29402940
Other Protein References for CENPF Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Cell Signaling Technology (CST) Antibodies for CENPF (CENPF)
-
Custom Antibody ServicesOriGene Antibodies for CENPF
- Novus Biologicals Antibodies for CENPF
-
Abcam antibodies for CENPF
-
Cloud-Clone Corp. Antibodies for CENPF
- Invitrogen Antibodies for CENPF
- GeneTex CENPF antibody for CENPF
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for CENPF
- Origene Custom Protein Services for CENPF
- Novus Biologicals proteins for CENPF
-
Cloud-Clone Corp. Proteins for CENPF
- Search GeneTex for Proteins for CENPF
-
Abcam proteins for CENPF
Assay Products
-
Cloud-Clone Corp. Assay Kits for CENPF
No data available for DME Specific Peptides for CENPF Gene
Domains & Families for CENPF Gene
Gene Families for CENPF Gene
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Disease related genes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for CENPF Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for CENPF Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P49454- Family:
-
- Belongs to the centromere protein F family.
Function for CENPF Gene
Molecular function for CENPF Gene
- GENATLAS Biochemistry:
- centromere protein F,component of the outer kinetochore plate
- UniProtKB/Swiss-Prot Function:
- Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.
Phenotypes From GWAS Catalog for CENPF Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003682 | chromatin binding | NAS | 9891037 |
GO:0005515 | protein binding | IPI | 7651420 |
GO:0008022 | protein C-terminus binding | IPI | 7642639 |
GO:0008134 | transcription factor binding | IPI | 15677469 |
GO:0042803 | protein homodimerization activity | IPI,IEA | 7642639 |
Phenotypes for CENPF Gene
- MGI mutant phenotypes for CENPF:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for CENPF:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for CENPF
-
-
ViGene Biosciences lentiviral particle packaged cDNA for CENPF gene
-
ViGene Biosciences ready-to-package AAV shRNAs for CENPF gene
- Search ViGene Biosciences for CENPF
CRISPR Products
-
OriGene CRISPR knockouts for CENPF
- genomics-online: gRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- Applied Biological Materials CRISPR for CENPF
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for CENPF
- GenScript: Design CRISPR guide RNA sequences for CENPF
miRNA for CENPF Gene
- miRTarBase miRNAs that target CENPF
-
- hsa-mir-373-3p (MIRT002525)
- hsa-mir-375 (MIRT019840)
- hsa-mir-122-5p (MIRT023287)
- hsa-mir-1-3p (MIRT023780)
- hsa-mir-215-5p (MIRT024521)
- hsa-mir-192-5p (MIRT026480)
- hsa-mir-16-5p (MIRT031672)
- hsa-mir-1226-3p (MIRT036512)
- hsa-mir-877-5p (MIRT037353)
- hsa-mir-93-3p (MIRT038774)
- hsa-mir-148a-5p (MIRT732309)
- hsa-mir-205-5p (MIRT734380)
miRNA Products
- Search ViGene Biosciences for CENPF
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for CENPF
- Browse OriGene Inhibitory RNA Products For CENPF
- genomics-online: shRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for CENPF gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for CENPF
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CENPF
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for CENPF
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for CENPF
-
ViGene Biosciences adenoviral particle packaged cDNA for CENPF gene
-
ViGene Biosciences lentiviral particle packaged cDNA for CENPF gene
-
ViGene Biosciences ready-to-package AAV shRNAs for CENPF gene
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CENPF Gene
Localization for CENPF Gene
Subcellular locations from UniProtKB/Swiss-Prot for CENPF Gene
- Cytoplasm, perinuclear region. Nucleus matrix. Chromosome, centromere, kinetochore. Cytoplasm, cytoskeleton, spindle. Note=Relocalizes to the kinetochore/centromere (coronal surface of the outer plate) and the spindle during mitosis. Observed in nucleus during interphase but not in the nucleolus. At metaphase becomes localized to areas including kinetochore and mitotic apparatus as well as cytoplasm. By telophase, is concentrated within the intracellular bridge at either side of the mid-body.
- Nucleoplasm (3)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000775 | chromosome, centromeric region | IEA,IDA | 7542657 |
GO:0000776 | kinetochore | IDA,IEA | 7542657 |
GO:0000777 | condensed chromosome kinetochore | IEA | -- |
GO:0000785 | colocalizes_with chromatin | NAS | 9891037 |
GO:0000922 | spindle pole | IDA | 7542657 |
Pathways & Interactions for CENPF Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Cell Cycle, Mitotic |
.83
|
.60
|
2 | Regulation of PLK1 Activity at G2/M Transition |
.49
|
|
3 | Mitotic Metaphase and Anaphase |
.94
|
|
4 | Mitotic Prometaphase | ||
5 | Signaling by Rho GTPases |
Pathways by source for CENPF Gene
1 Cell Signaling Technology pathway for CENPF Gene
2 BioSystems pathways for CENPF Gene
15 Reactome pathways for CENPF Gene
Interacting Proteins for CENPF Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000278 | mitotic cell cycle | IMP | 7542657 |
GO:0001822 | kidney development | IMP | 25564561 |
GO:0007049 | cell cycle | IEA | -- |
GO:0007059 | chromosome segregation | NAS | 7542657 |
GO:0007062 | sister chromatid cohesion | TAS | -- |
No data available for SIGNOR curated interactions for CENPF Gene
Transcripts for CENPF Gene
mRNA/cDNA for CENPF Gene
- (3) REFSEQ mRNAs :
- (4) Additional mRNA sequences :
- (256) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for CENPF Gene
CRISPR Products
-
OriGene CRISPR knockouts for CENPF
- genomics-online: gRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- Applied Biological Materials CRISPR for CENPF
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for CENPF
- GenScript: Design CRISPR guide RNA sequences for CENPF
miRNA Products
- Search ViGene Biosciences for CENPF
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for CENPF
- Browse OriGene Inhibitory RNA Products For CENPF
- genomics-online: shRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for CENPF gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for CENPF
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CENPF
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for CENPF
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for CENPF Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Brain (Nervous System)
-
Testis (Reproductive System)
- Pre-Sertoli Cells Testis Cord
- XY Germ Cells Testis Cord
-
Gonad
- XX Germ Cells Ovigerous Cord
- XY Germ Cells Testis Cord
- Neural Tube (Nervous System)
- Blood (Hematopoietic System)
- Mesenchymal Stem Cells
- Umbilical Cord (Extraembryonic Tissues)
-
Kidney (Urinary System)
- Presumptive Podocytes Podocyte Layer
-
Epithelial Cells
- Presumptive Podocytes Podocyte Layer
-
Ovary (Reproductive System)
- XX Germ Cells Ovigerous Cord
-
Heart (Cardiovascular System)
mRNA differential expression in normal tissues according to GTEx for CENPF Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CENPF Gene
NURSA nuclear receptor signaling pathways regulating expression of CENPF Gene:
CENPFSOURCE GeneReport for Unigene cluster for CENPF Gene:
Hs.497741Evidence on tissue expression from TISSUES for CENPF Gene
- Liver(3.4)
Phenotype-based relationships between genes and organs from Gene ORGANizer for CENPF Gene
- ectoderm
- endoderm
- digestive
- endocrine
- integumentary
- nervous
- skeleton
- brain
- cerebellum
- cerebrospinal fluid
- chin
- ear
- eye
- face
- head
- jaw
- mandible
- maxilla
- meninges
- mouth
- nose
- outer ear
- skull
- biliary tract
- duodenum
- intestine
- liver
- pancreas
- small intestine
- stomach
- skin
Primer Products
-
OriGene qPCR primer pairs for CENPF
No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for CENPF Gene
Orthologs for CENPF Gene
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | CENPF 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | CENPF 33 34 |
|
||
dog (Canis familiaris) |
Mammalia | -- 34 |
|
OneToMany | |
CENPF 33 |
|
||||
-- 34 |
|
OneToMany | |||
rat (Rattus norvegicus) |
Mammalia | Cenpf 33 |
|
||
mouse (Mus musculus) |
Mammalia | Cenpf 33 16 34 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | CENPF 34 |
|
OneToOne | |
oppossum (Monodelphis domestica) |
Mammalia | CENPF 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | CENPF 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | CENPF 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | cenpf 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | cenpf 34 |
|
OneToOne | |
worm (Caenorhabditis elegans) |
Secernentea | C02F12.7 35 |
|
|
- Species where no ortholog for CENPF was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for CENPF Gene
No data available for Paralogs for CENPF Gene
Variants for CENPF Gene
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs144237457 | uncertain-significance, not specified, not provided | 214,641,955(+) | A/G | coding_sequence_variant, missense_variant | |
rs200976140 | pathogenic, Stromme syndrome | 214,641,072(+) | G/T | coding_sequence_variant, stop_gained | |
rs367624766 | pathogenic, Stromme syndrome | 214,640,082(+) | G/A/T | coding_sequence_variant, missense_variant, stop_gained | |
rs376767238 | pathogenic, Stromme syndrome | 214,620,653(+) | A/C | splice_acceptor_variant | |
rs757575602 | pathogenic, Stromme syndrome | 214,614,834(+) | TGAAAATGAAAAAACCGAGGGTACAAACCTGAAAA/TGAAAA | coding_sequence_variant, frameshift |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv574n100 | CNV | gain | 25217958 |
esv1007536 | CNV | insertion | 20482838 |
esv2145066 | CNV | deletion | 18987734 |
esv27146 | CNV | gain+loss | 19812545 |
esv2722628 | CNV | deletion | 23290073 |
esv29119 | CNV | loss | 19812545 |
esv3578422 | CNV | loss | 25503493 |
esv3588789 | CNV | loss | 21293372 |
nsv160230 | CNV | deletion | 16902084 |
nsv436780 | CNV | insertion | 17901297 |
nsv549181 | CNV | loss | 21841781 |
Additional Variant Information for CENPF Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CENPF Gene
Disorders for CENPF Gene

(5) MalaCards diseases for CENPF Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
stromme syndrome |
|
|
intestinal atresia |
|
|
ciliopathy |
|
|
graft-versus-host disease |
|
|
microcephaly |
|
|
UniProtKB/Swiss-Prot
CENPF_HUMAN- Stromme syndrome (STROMS) [MIM:243605]: An autosomal recessive congenital disorder characterized by intestinal atresia, ocular anomalies, microcephaly, and renal and cardiac abnormalities in some patients. The disease has features of a ciliopathy, and lethality in early childhood is observed in severe cases. {ECO:0000269 PubMed:25564561, ECO:0000269 PubMed:26820108}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for CENPF
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for CENPF Gene
Publications for CENPF Gene
- Mitosin/CENP-F is a conserved kinetochore protein subjected to cytoplasmic dynein-mediated poleward transport. (PMID: 12974617) Yang ZY … Zhu XL (Cell research 2003) 3 4 22 58
- Farnesyl transferase inhibitors block the farnesylation of CENP-E and CENP-F and alter the association of CENP-E with the microtubules. (PMID: 10852915) Ashar HR … Kirschmeier P (The Journal of biological chemistry 2000) 3 4 22 58
- CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. (PMID: 7542657) Liao H … Yen TJ (The Journal of cell biology 1995) 3 4 22 58
- Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression. (PMID: 7651420) Zhu X … Lee WH (Molecular and cellular biology 1995) 3 4 22 58
- Chromosomal localization of the genes encoding the kinetochore proteins CENPE and CENPF to human chromosomes 4q24-->q25 and 1q32-->q41, respectively, by fluorescence in situ hybridization. (PMID: 7851898) Testa JR … Yen TJ (Genomics 1994) 2 3 22 58
Products for CENPF Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for CENPF
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for CENPF
- Origene Custom Protein Services for CENPF
- Origene shrna, sirna, and RNAi products in human, mouse, rat for CENPF
- Browse OriGene Inhibitory RNA Products For CENPF
- OriGene qPCR primer pairs for CENPF
- OriGene CRISPR knockouts for CENPF
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For CENPF
- GenScript: Next-day shipping of latest version cDNA ORF clones for CENPF in any vector
- GenScript Custom Purified and Recombinant Proteins Services for CENPF
- GenScript Custom Assay Services for CENPF
- GenScript Custom overexpressing Cell Line Services for CENPF
- GenScript: Design CRISPR guide RNA sequences for CENPF
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for CENPF
- Cell Signaling Technology (CST) Antibodies for CENPF (CENPF)
- Search for Antibodies & Assays
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for CENPF
- Novus Biologicals proteins for CENPF
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for CENPF
- Abcam proteins for CENPF
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Cloud-Clone Corp. Antibodies for CENPF
- Cloud-Clone Corp. Proteins for CENPF
- Cloud-Clone Corp. Assay Kits for CENPF
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for CENPF
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for CENPF
- VectorBuilder custom plasmid, inducible vectors for CENPF
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CENPF
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 70 available CENPF Antibodies ranked by validation data
- Compare Top CENPF Antibodies
- antibodies-online: Search results for 25 available CENPF Elisa Kits ranked by validation data
- Compare Top CENPF Elisa Kits
- antibodies-online: Search results for 2 available CENPF Proteins ranked by validation data
- Compare Top CENPF Proteins
- GeneTex CENPF antibody for CENPF
- Search GeneTex for Proteins for CENPF
- ViGene Biosciences adenoviral particle packaged cDNA for CENPF gene
- ViGene Biosciences lentiviral particle packaged cDNA for CENPF gene
- ViGene Biosciences ready-to-package AAV shRNAs for CENPF gene
- Search ViGene Biosciences for CENPF
- Horizon Cell Lines for CENPF
- genomics-online: cdna clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- orf clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- genomics-online: gRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- genomics-online: primer clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
- genomics-online: shRNA clones - Search results for 52 available CENPF gene related products
- Overview of 52 available CENPF gene related products
Sources for CENPF Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew