Free for academic non-profit institutions. Other users need a Commercial license

CENPF Gene(Protein Coding)

Centromere Protein F

GCID:
GC01P214603
GIFtS:
59
Genes Participants
UDN Logo

Aliases for CENPF Gene

Aliases for CENPF Gene

  • Centromere Protein F 2 3 5
  • Mitosin 2 3 4
  • Centromere Protein F, 350/400kDa 2 3
  • Kinetochore Protein CENPF 3 4
  • AH Antigen 3 4
  • Centromere Protein F, 350/400kDa (Mitosin) 2
  • Cell-Cycle-Dependent 350K Nuclear Protein 3
  • CENP-F Kinetochore Protein 3
  • PRO1779 3
  • CILD31 3
  • STROMS 3
  • CENP-F 4
  • Hcp-1 3
  • CENF 3

External Ids for CENPF Gene

Previous GeneCards Identifiers for CENPF Gene

  • GC01P213428
  • GC01P210596
  • GC01P211392
  • GC01P211833
  • GC01P211165
  • GC01P212843
  • GC01P214776
  • GC01P185450

Summaries for CENPF Gene

Entrez Gene Summary for CENPF Gene

  • This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

GeneCards Summary for CENPF Gene

CENPF (Centromere Protein F) is a Protein Coding gene. Diseases associated with CENPF include Ciliary Dyskinesia, Primary, 31 and Ciliopathy. Among its related pathways are FOXM1 transcription factor network and Regulation of PLK1 Activity at G2/M Transition. GO annotations related to this gene include protein homodimerization activity and transcription factor binding.

UniProtKB/Swiss-Prot for CENPF Gene

  • Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.

Gene Wiki entry for CENPF Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CENPF Gene

Genomics for CENPF Gene

Products:

  1. Regulatory Element

Regulatory Elements for CENPF Gene

Enhancers for CENPF Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G214437 2 FANTOM5 Ensembl ENCODE dbSUPER 11.1 -163.1 -163081 4.9 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 CENPF PTPN14 ABHD17AP3 SMYD2 GC01M214483 ENSG00000228470
GH01G214425 1.9 FANTOM5 Ensembl ENCODE dbSUPER 10.4 -175.0 -175020 5.9 HDGF PKNOX1 CREB3L1 ARNT ARID4B SIN3A DMAP1 YBX1 FEZF1 ZNF766 CENPF PTPN14 ABHD17AP3 SMYD2 PROX1 KCNK2 GC01M214483 ENSG00000228470
GH01G214569 1.1 ENCODE dbSUPER 11.3 -30.7 -30730 6.7 JUN ZSCAN4 RFX5 ZFHX2 ZNF316 GATA2 ZNF366 ZSCAN5C SCRT2 SMARCC2 PTPN14 CENPF
GH01G214602 1.1 ENCODE 8 +0.7 685 3.2 PKNOX1 CREB3L1 ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 SLC30A9 ZNF766 SMYD2 CENPF ABHD17AP3
GH01G214364 0.8 ENCODE dbSUPER 10 -238.6 -238567 0.2 FOSL1 SMARCA4 MTA2 ID3 ZSCAN29 REST ZNF24 CENPF ENSG00000228470 GC01M214483
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around CENPF on UCSC Golden Path with GeneCards custom track

Promoters for CENPF Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000019940 322 2200 PKNOX1 FOXA2 MLX CREB3L1 ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1

Transcription factor binding sites by QIAGEN in the CENPF gene promoter:

Genomic Location for CENPF Gene

Chromosome:
1
Start:
214,603,179 bp from pter
End:
214,664,588 bp from pter
Size:
61,410 bases
Orientation:
Plus strand

Genomic View for CENPF Gene

Genes around CENPF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CENPF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CENPF Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for CENPF Gene

Proteins for CENPF Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for CENPF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P49454-CENPF_HUMAN
    Recommended name:
    Centromere protein F
    Protein Accession:
    P49454
    Secondary Accessions:
    • Q13171
    • Q13246
    • Q5VVM7

    Protein attributes for CENPF Gene

    Size:
    3210 amino acids
    Molecular mass:
    367764 Da
    Quaternary structure:
    • Interacts with and STX4 (via C-terminus) (By similarity). Interacts (via N-terminus) with RBL1, RBL2 and SNAP25 (By similarity). Self-associates. Interacts with CENP-E and BUBR1 (via C-terminus). Interacts (via C-terminus) with NDE1, NDEL1 and RB1.

neXtProt entry for CENPF Gene

Protein Expression for CENPF Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for CENPF Gene

  • Hyperphosphorylated during mitosis.
  • Ubiquitination at Lys19, Lys223, posLast=293293, posLast=314314, Lys356, posLast=457457, Lys513, posLast=527527, posLast=555555, posLast=697697, Lys770, Lys823, Lys956, Lys1022, Lys1088, posLast=13411341, Lys1410, posLast=19061906, posLast=21322132, and Lys2940
  • Modification sites at PhosphoSitePlus

Other Protein References for CENPF Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for CENPF (CENPF)
  • Abcam antibodies for CENPF
  • Cloud-Clone Corp. Antibodies for CENPF

No data available for DME Specific Peptides for CENPF Gene

Domains & Families for CENPF Gene

Protein Domains for CENPF Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CENPF Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P49454

UniProtKB/Swiss-Prot:

CENPF_HUMAN :
  • Belongs to the centromere protein F family.
Family:
  • Belongs to the centromere protein F family.
genes like me logo Genes that share domains with CENPF: view

No data available for Gene Families for CENPF Gene

Function for CENPF Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line
  7. Flow Cytometry

Molecular function for CENPF Gene

GENATLAS Biochemistry:
centromere protein F,component of the outer kinetochore plate
UniProtKB/Swiss-Prot Function:
Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.

Gene Ontology (GO) - Molecular Function for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003682 chromatin binding NAS 9891037
GO:0005515 protein binding IPI 7651420
GO:0008022 protein C-terminus binding IPI 7642639
GO:0008134 transcription factor binding IPI 15677469
GO:0042803 protein homodimerization activity IPI 7642639
genes like me logo Genes that share ontologies with CENPF: view
genes like me logo Genes that share phenotypes with CENPF: view

Human Phenotype Ontology for CENPF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for CENPF Gene

Localization for CENPF Gene

Subcellular locations from UniProtKB/Swiss-Prot for CENPF Gene

Cytoplasm, perinuclear region. Nucleus matrix. Chromosome, centromere, kinetochore. Cytoplasm, cytoskeleton, spindle. Note=Relocalizes to the kinetochore/centromere (coronal surface of the outer plate) and the spindle during mitosis. Observed in nucleus during interphase but not in the nucleolus. At metaphase becomes localized to areas including kinetochore and mitotic apparatus as well as cytoplasm. By telophase, is concentrated within the intracellular bridge at either side of the mid-body.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CENPF gene
Compartment Confidence
cytoskeleton 5
nucleus 5
cytosol 5

Gene Ontology (GO) - Cellular Components for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000775 chromosome, centromeric region IDA,IEA 7542657
GO:0000776 kinetochore IEA,IDA 7542657
GO:0000777 condensed chromosome kinetochore IEA --
GO:0000785 colocalizes_with chromatin NAS 9891037
GO:0000922 spindle pole IDA 7542657
genes like me logo Genes that share ontologies with CENPF: view

Pathways & Interactions for CENPF Gene

genes like me logo Genes that share pathways with CENPF: view

Pathways by source for CENPF Gene

1 Cell Signaling Technology pathway for CENPF Gene
2 BioSystems pathways for CENPF Gene

Gene Ontology (GO) - Biological Process for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000278 mitotic cell cycle IMP 7542657
GO:0001822 kidney development IMP 25564561
GO:0007049 cell cycle IEA --
GO:0007059 chromosome segregation NAS 7542657
GO:0007062 sister chromatid cohesion TAS --
genes like me logo Genes that share ontologies with CENPF: view

No data available for SIGNOR curated interactions for CENPF Gene

Drugs & Compounds for CENPF Gene

Products:

  1. Drug

(4) Drugs for CENPF Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with CENPF: view

Transcripts for CENPF Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone
  5. Flow Cytometry

mRNA/cDNA for CENPF Gene

(3) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(256) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CENPF Gene

Centromere protein F, 350/400kDa:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for CENPF Gene

No ASD Table

Relevant External Links for CENPF Gene

GeneLoc Exon Structure for
CENPF
ECgene alternative splicing isoforms for
CENPF

Expression for CENPF Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CENPF Gene

mRNA expression in normal human tissues for CENPF Gene
mRNA expression by BioGPS for CENPF GenemRNA expression by GTEx for CENPF Gene

mRNA differential expression in normal tissues according to GTEx for CENPF Gene

This gene is overexpressed in Testis (x4.8) and Esophagus - Mucosa (x4.2).

Protein differential expression in normal tissues from HIPED for CENPF Gene

This gene is overexpressed in Nasal epithelium (43.0) and Bone marrow stromal cell (8.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CENPF Gene



NURSA nuclear receptor signaling pathways regulating expression of CENPF Gene:

CENPF

SOURCE GeneReport for Unigene cluster for CENPF Gene:

Hs.497741

Evidence on tissue expression from TISSUES for CENPF Gene

  • Liver(3.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CENPF Gene

Germ Layers:
  • ectoderm
  • endoderm
Systems:
  • digestive
  • endocrine
  • integumentary
  • nervous
  • skeleton
Organs:
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • chin
  • ear
  • eye
  • face
  • head
  • jaw
  • mandible
  • maxilla
  • meninges
  • mouth
  • nose
  • outer ear
  • skull
Abdomen:
  • biliary tract
  • duodenum
  • intestine
  • liver
  • pancreas
  • small intestine
  • stomach
General:
  • skin
genes like me logo Genes that share expression patterns with CENPF: view

Primer Products

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for CENPF Gene

Orthologs for CENPF Gene

This gene was present in the common ancestor of animals.

Orthologs for CENPF Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia CENPF 34 35
  • 99.28 (n)
cow
(Bos Taurus)
 Mammalia CENPF 34 35
  • 84.66 (n)
dog
(Canis familiaris)
 Mammalia -- 35
  • 84 (a)
 OneToMany
CENPF 34
  • 83.79 (n)
-- 35
  • 71 (a)
 OneToMany
rat
(Rattus norvegicus)
 Mammalia Cenpf 34
  • 77.45 (n)
mouse
(Mus musculus)
 Mammalia Cenpf 34 16 35
  • 75.67 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia CENPF 35
  • 54 (a)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia CENPF 35
  • 52 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves CENPF 34 35
  • 59.13 (n)
lizard
(Anolis carolinensis)
 Reptilia CENPF 35
  • 40 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia cenpf 34
  • 53.33 (n)
zebrafish
(Danio rerio)
 Actinopterygii cenpf 35
  • 29 (a)
 OneToOne
worm
(Caenorhabditis elegans)
 Secernentea C02F12.7 36
  • 21 (a)
Species where no ortholog for CENPF was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CENPF Gene

ENSEMBL:
Gene Tree for CENPF (if available)
TreeFam:
Gene Tree for CENPF (if available)

Paralogs for CENPF Gene

No data available for Paralogs for CENPF Gene

Variants for CENPF Gene

Sequence variations from dbSNP and Humsavar for CENPF Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs200976140 Pathogenic 214,641,072(+) AAAAA(G/T)AGCTG reference, stop-gained
rs367624766 Pathogenic 214,640,082(+) ACATT(A/G/T)AACAA reference, missense
rs376076886 Pathogenic 214,646,789(+) AAGAG(C/T)GAATA reference, stop-gained
rs376767238 Pathogenic 214,620,653(+) TCTAC(A/C)GAAAG splice-acceptor-variant
rs757575602 Pathogenic 214,614,834(+) TAGGT(-/TGAAAATGAAAAAACCGAGGGTACAAACC)TGAAA reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for CENPF Gene

Variant ID Type Subtype PubMed ID
dgv574n100 CNV gain 25217958
esv1007536 CNV insertion 20482838
esv2145066 CNV deletion 18987734
esv27146 CNV gain+loss 19812545
esv2722628 CNV deletion 23290073
esv29119 CNV loss 19812545
esv3578422 CNV loss 25503493
esv3588789 CNV loss 21293372
nsv160230 CNV deletion 16902084
nsv436780 CNV insertion 17901297
nsv549181 CNV loss 21841781

Variation tolerance for CENPF Gene

Residual Variation Intolerance Score: 98.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 20.93; 99.19% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for CENPF Gene

Human Gene Mutation Database (HGMD)
CENPF
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CENPF

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CENPF Gene

Disorders for CENPF Gene

MalaCards: The human disease database

(2) MalaCards diseases for CENPF Gene - From: OMIM, ClinVar, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
ciliary dyskinesia, primary, 31
  • stromme syndrome
ciliopathy
- elite association - COSMIC cancer census association via MalaCards
Search CENPF in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CENPF_HUMAN
  • Stromme syndrome (STROMS) [MIM:243605]: An autosomal recessive congenital disorder characterized by intestinal atresia, ocular anomalies, microcephaly, and renal and cardiac abnormalities in some patients. The disease has features of a ciliopathy, and lethality in early childhood is observed in severe cases. {ECO:0000269 PubMed:25564561, ECO:0000269 PubMed:26820108}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for CENPF

Genetic Association Database (GAD)
CENPF
Human Genome Epidemiology (HuGE) Navigator
CENPF
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
CENPF
genes like me logo Genes that share disorders with CENPF: view

No data available for Genatlas for CENPF Gene

Publications for CENPF Gene

  1. Mitosin/CENP-F is a conserved kinetochore protein subjected to cytoplasmic dynein-mediated poleward transport. (PMID: 12974617) Yang Z.Y. … Zhu X.L. (Cell Res. 2003) 3 4 22 64
  2. Farnesyl transferase inhibitors block the farnesylation of CENP-E and CENP-F and alter the association of CENP-E with the microtubules. (PMID: 10852915) Ashar H.R. … Kirschmeier P. (J. Biol. Chem. 2000) 3 4 22 64
  3. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. (PMID: 7542657) Liao H. … Yen T.J. (J. Cell Biol. 1995) 3 4 22 64
  4. Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression. (PMID: 7651420) Zhu X. … Lee W.-H. (Mol. Cell. Biol. 1995) 3 4 22 64
  5. Chromosomal localization of the genes encoding the kinetochore proteins CENPE and CENPF to human chromosomes 4q24-->q25 and 1q32-->q41, respectively, by fluorescence in situ hybridization. (PMID: 7851898) Testa J.R. … Yen T.J. (Genomics 1994) 2 3 22 64

Products for CENPF Gene

  • Cloud-Clone Corp. Antibodies for CENPF
  • Cloud-Clone Corp. Proteins for CENPF
  • Cloud-Clone Corp Assay Kits for CENPF

Sources for CENPF Gene

Content
Loading form....