Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EIF1B Gene

Aliases for EIF1B Gene

  • Eukaryotic Translation Initiation Factor 1B 2 3
  • Protein Translation Factor SUI1 Homolog GC20 3 4
  • Translation Factor Sui1 Homolog 3
  • EIF1b 4
  • GC20 3

External Ids for EIF1B Gene

Previous GeneCards Identifiers for EIF1B Gene

  • GC03P040327
  • GC03P040351

Summaries for EIF1B Gene

GeneCards Summary for EIF1B Gene

EIF1B (Eukaryotic Translation Initiation Factor 1B) is a Protein Coding gene. Among its related pathways are RNA transport. GO annotations related to this gene include translation initiation factor activity. An important paralog of this gene is EIF1.

UniProtKB/Swiss-Prot for EIF1B Gene

  • Probably involved in translation

Gene Wiki entry for EIF1B Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EIF1B Gene

Genomics for EIF1B Gene

Regulatory Elements for EIF1B Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for EIF1B Gene

40,309,682 bp from pter
40,312,424 bp from pter
2,743 bases
Plus strand

Genomic View for EIF1B Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for EIF1B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EIF1B Gene

Proteins for EIF1B Gene

  • Protein details for EIF1B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Eukaryotic translation initiation factor 1b
    Protein Accession:
    Secondary Accessions:
    • Q9UQF8

    Protein attributes for EIF1B Gene

    113 amino acids
    Molecular mass:
    12824 Da
    Quaternary structure:
    No Data Available

neXtProt entry for EIF1B Gene

Proteomics data for EIF1B Gene at MOPED

Post-translational modifications for EIF1B Gene

  • Ubiquitination at Lys42 and Lys91
  • Modification sites at PhosphoSitePlus

Other Protein References for EIF1B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for EIF1B Gene

Domains for EIF1B Gene

Protein Domains for EIF1B Gene

Suggested Antigen Peptide Sequences for EIF1B Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • O60739
  • Belongs to the SUI1 family.
genes like me logo Genes that share domains with EIF1B: view

No data available for Gene Families for EIF1B Gene

Function for EIF1B Gene

Molecular function for EIF1B Gene

UniProtKB/Swiss-Prot Function: Probably involved in translation

Gene Ontology (GO) - Molecular Function for EIF1B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003743 translation initiation factor activity IEA --
GO:0044822 poly(A) RNA binding IDA 22681889
genes like me logo Genes that share ontologies with EIF1B: view

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for EIF1B Gene

Localization for EIF1B Gene

Subcellular locations from

Jensen Localization Image for EIF1B Gene COMPARTMENTS Subcellular localization image for EIF1B gene
Compartment Confidence
cytosol 2
nucleus 2
extracellular 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for EIF1B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
genes like me logo Genes that share ontologies with EIF1B: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for EIF1B Gene

Pathways for EIF1B Gene

SuperPathways for EIF1B Gene

Superpath Contained pathways
1 RNA transport
genes like me logo Genes that share pathways with EIF1B: view

Pathways by source for EIF1B Gene

1 KEGG pathway for EIF1B Gene

Gene Ontology (GO) - Biological Process for EIF1B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006413 translational initiation IEA --
GO:0006446 regulation of translational initiation NAS 7904817
genes like me logo Genes that share ontologies with EIF1B: view

Transcripts for EIF1B Gene

mRNA/cDNA for EIF1B Gene

Unigene Clusters for EIF1B Gene

Eukaryotic translation initiation factor 1B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for EIF1B

Primer Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for EIF1B Gene

No ASD Table

Relevant External Links for EIF1B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EIF1B Gene

mRNA expression in normal human tissues for EIF1B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for EIF1B Gene

This gene is overexpressed in Heart - Left Ventricle (4.5).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for EIF1B Gene

SOURCE GeneReport for Unigene cluster for EIF1B Gene Hs.315230

genes like me logo Genes that share expressions with EIF1B: view

In Situ Assay Products

No data available for mRNA Expression by UniProt/SwissProt for EIF1B Gene

Orthologs for EIF1B Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EIF1B Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia EIF1B 35
  • 99.71 (n)
  • 100 (a)
EIF1B 36
  • 100 (a)
(Bos Taurus)
Mammalia EIF1B 35
  • 98.23 (n)
  • 100 (a)
EIF1B 36
  • 100 (a)
(Canis familiaris)
Mammalia -- 36
  • 91 (a)
EIF1B 35
  • 96.46 (n)
  • 97.35 (a)
(Mus musculus)
Mammalia Eif1b 35
  • 92.33 (n)
  • 100 (a)
Eif1b 16
Eif1b 36
  • 100 (a)
(Monodelphis domestica)
Mammalia EIF1B 36
  • 100 (a)
(Ornithorhynchus anatinus)
Mammalia EIF1B 36
  • 90 (a)
(Rattus norvegicus)
Mammalia Eif1b 35
  • 92.92 (n)
  • 100 (a)
(Gallus gallus)
Aves EIF1B 35
  • 89.09 (n)
  • 98.23 (a)
EIF1B 36
  • 98 (a)
(Anolis carolinensis)
Reptilia EIF1B 36
  • 95 (a)
African clawed frog
(Xenopus laevis)
Amphibia gc20-pending-prov 35
tropical clawed frog
(Silurana tropicalis)
Amphibia eif1b 35
  • 89.97 (n)
  • 96.46 (a)
MGC75713 35
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8683 35
(Danio rerio)
Actinopterygii EIF1B 36
  • 96 (a)
zgc56676 35
zgc:56676 35
  • 82.89 (n)
  • 96.46 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG17737 36
  • 68 (a)
(Caenorhabditis elegans)
Secernentea eif-1 36
  • 55 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes SUI1 36
  • 59 (a)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.13155 35
thale cress
(Arabidopsis thaliana)
eudicotyledons AT4G27130 35
  • 65.7 (n)
  • 59.22 (a)
(Hordeum vulgare)
Liliopsida Hv.701 35
(Zea mays)
Liliopsida Zm.355 35
(Oryza sativa)
Liliopsida Os.7945 35
Os07g0529800 35
  • 65.15 (n)
  • 59.09 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.5488 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6142 36
  • 65 (a)
Species with no ortholog for EIF1B:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EIF1B Gene

Gene Tree for EIF1B (if available)
Gene Tree for EIF1B (if available)

Paralogs for EIF1B Gene

Paralogs for EIF1B Gene

Selected SIMAP similar genes for EIF1B Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with EIF1B: view

Variants for EIF1B Gene

Sequence variations from dbSNP and Humsavar for EIF1B Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type MAF
rs1470937 -- 40,311,768(+) TTTCT(G/T)TATAT intron-variant
rs3836541 -- 40,312,345(+) ACAAT(-/A)AAAAA utr-variant-3-prime
rs3836542 -- 40,312,492(+) TAGAG(-/GAGAACCTTATATCCAGTGCTA)GAGAA downstream-variant-500B
rs6804545 -- 40,312,549(+) TTCAT(C/G)TACTG downstream-variant-500B
rs11374095 -- 40,312,300(+) TTAAA(-/T)TTTTT utr-variant-3-prime

Structural Variations from Database of Genomic Variants (DGV) for EIF1B Gene

Variant ID Type Subtype PubMed ID
nsv834667 CNV Gain 17160897

Relevant External Links for EIF1B Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EIF1B Gene

Disorders for EIF1B Gene

No disorders were found for EIF1B Gene.

No data available for UniProtKB/Swiss-Prot for EIF1B Gene

Publications for EIF1B Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4
  2. Expressed sequence tags identify a human isolog of the suil translation initiation factor. (PMID: 7904817) Fields C.A. … Adams M.D. (Biochem. Biophys. Res. Commun. 1994) 2 3
  3. Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. (PMID: 10931946) Hu R.-M. … Chen J.-L. (Proc. Natl. Acad. Sci. U.S.A. 2000) 3 4
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3
  5. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. (PMID: 8125298) Maruyama K. … Sugano S. (Gene 1994) 3

Products for EIF1B Gene

Sources for EIF1B Gene

Back to Top
