Free for academic non-profit institutions. Other users need a Commercial license

Aliases for EIF1B Gene

Aliases for EIF1B Gene

  • Eukaryotic Translation Initiation Factor 1B 2 3 5
  • Protein Translation Factor SUI1 Homolog GC20 3 4
  • Translation Factor Sui1 Homolog 3
  • EIF1b 4
  • GC20 3

External Ids for EIF1B Gene

Previous GeneCards Identifiers for EIF1B Gene

  • GC03P040327
  • GC03P040351

Summaries for EIF1B Gene

GeneCards Summary for EIF1B Gene

EIF1B (Eukaryotic Translation Initiation Factor 1B) is a Protein Coding gene. Diseases associated with EIF1B include acquired thrombocytopenia. Among its related pathways are RNA transport. GO annotations related to this gene include poly(A) RNA binding and translation initiation factor activity. An important paralog of this gene is EIF1.

UniProtKB/Swiss-Prot for EIF1B Gene

  • Probably involved in translation.

Gene Wiki entry for EIF1B Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for EIF1B Gene

Genomics for EIF1B Gene

Regulatory Elements for EIF1B Gene

Enhancers for EIF1B Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around EIF1B on UCSC Golden Path with GeneCards custom track

Promoters for EIF1B Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around EIF1B on UCSC Golden Path with GeneCards custom track

Genomic Location for EIF1B Gene

40,309,682 bp from pter
40,312,424 bp from pter
2,743 bases
Plus strand

Genomic View for EIF1B Gene

Genes around EIF1B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
EIF1B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for EIF1B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EIF1B Gene

Proteins for EIF1B Gene

  • Protein details for EIF1B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Eukaryotic translation initiation factor 1b
    Protein Accession:
    Secondary Accessions:
    • Q9UQF8

    Protein attributes for EIF1B Gene

    113 amino acids
    Molecular mass:
    12824 Da
    Quaternary structure:
    No Data Available

neXtProt entry for EIF1B Gene

Proteomics data for EIF1B Gene at MOPED

Post-translational modifications for EIF1B Gene

  • Ubiquitination at Lys 91
  • Modification sites at PhosphoSitePlus

Other Protein References for EIF1B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for EIF1B Gene

Domains & Families for EIF1B Gene

Protein Domains for EIF1B Gene

Suggested Antigen Peptide Sequences for EIF1B Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SUI1 family.
  • Belongs to the SUI1 family.
genes like me logo Genes that share domains with EIF1B: view

No data available for Gene Families for EIF1B Gene

Function for EIF1B Gene

Molecular function for EIF1B Gene

UniProtKB/Swiss-Prot Function:
Probably involved in translation.

Phenotypes for EIF1B Gene

genes like me logo Genes that share phenotypes with EIF1B: view

Animal Model Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for EIF1B Gene

Localization for EIF1B Gene

Subcellular locations from

Jensen Localization Image for EIF1B Gene COMPARTMENTS Subcellular localization image for EIF1B gene
Compartment Confidence
cytosol 2
nucleus 2
extracellular 1
peroxisome 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for EIF1B Gene

Pathways & Interactions for EIF1B Gene

SuperPathways for EIF1B Gene

Superpath Contained pathways
1 RNA transport
genes like me logo Genes that share pathways with EIF1B: view

Pathways by source for EIF1B Gene

1 KEGG pathway for EIF1B Gene

Gene Ontology (GO) - Biological Process for EIF1B Gene


No data available for SIGNOR curated interactions for EIF1B Gene

Drugs & Compounds for EIF1B Gene

No Compound Related Data Available

Transcripts for EIF1B Gene

Unigene Clusters for EIF1B Gene

Eukaryotic translation initiation factor 1B:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for EIF1B Gene

No ASD Table

Relevant External Links for EIF1B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EIF1B Gene

mRNA expression in normal human tissues for EIF1B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for EIF1B Gene

This gene is overexpressed in Heart - Left Ventricle (x4.5).

Protein differential expression in normal tissues from HIPED for EIF1B Gene

This gene is overexpressed in Peripheral blood mononuclear cells (19.5), Fetal ovary (10.6), Fetal heart (8.4), and Testis (7.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for EIF1B Gene

SOURCE GeneReport for Unigene cluster for EIF1B Gene Hs.315230

genes like me logo Genes that share expression patterns with EIF1B: view

Primer Products

In Situ Assay Products

No data available for mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for EIF1B Gene

Orthologs for EIF1B Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for EIF1B Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia EIF1B 35
  • 98.23 (n)
  • 100 (a)
EIF1B 36
  • 100 (a)
(Canis familiaris)
Mammalia EIF1B 35
  • 96.46 (n)
  • 97.35 (a)
-- 36
  • 91 (a)
(Mus musculus)
Mammalia Eif1b 35
  • 92.33 (n)
  • 100 (a)
Eif1b 16
Eif1b 36
  • 100 (a)
(Pan troglodytes)
Mammalia EIF1B 35
  • 99.71 (n)
  • 100 (a)
EIF1B 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Eif1b 35
  • 92.92 (n)
  • 100 (a)
(Monodelphis domestica)
Mammalia EIF1B 36
  • 100 (a)
(Ornithorhynchus anatinus)
Mammalia EIF1B 36
  • 90 (a)
(Gallus gallus)
Aves EIF1B 35
  • 89.09 (n)
  • 98.23 (a)
EIF1B 36
  • 98 (a)
(Anolis carolinensis)
Reptilia EIF1B 36
  • 95 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia eif1b 35
  • 89.97 (n)
  • 96.46 (a)
MGC75713 35
African clawed frog
(Xenopus laevis)
Amphibia gc20-pending-prov 35
(Danio rerio)
Actinopterygii zgc56676 35
zgc:56676 35
  • 82.89 (n)
  • 96.46 (a)
EIF1B 36
  • 96 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8683 35
fruit fly
(Drosophila melanogaster)
Insecta CG17737 36
  • 68 (a)
(Caenorhabditis elegans)
Secernentea eif-1 36
  • 55 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes SUI1 36
  • 59 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT4G27130 35
  • 65.7 (n)
  • 59.22 (a)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.13155 35
(Hordeum vulgare)
Liliopsida Hv.701 35
(Oryza sativa)
Liliopsida Os.7945 35
Os07g0529800 35
  • 65.15 (n)
  • 59.09 (a)
(Zea mays)
Liliopsida Zm.355 35
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.5488 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6142 36
  • 65 (a)
Species with no ortholog for EIF1B:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EIF1B Gene

Gene Tree for EIF1B (if available)
Gene Tree for EIF1B (if available)

Paralogs for EIF1B Gene

Paralogs for EIF1B Gene

(3) SIMAP similar genes for EIF1B Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with EIF1B: view

Variants for EIF1B Gene

Sequence variations from dbSNP and Humsavar for EIF1B Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type
rs1470937 -- 40,311,768(+) TTTCT(G/T)TATAT intron-variant
rs11374095 -- 40,312,300(+) TTAAA(-/T)TTTTT utr-variant-3-prime
rs11541151 -- 40,312,091(+) ATGAT(C/G/T)CCCTG utr-variant-3-prime
rs3836541 -- 40,312,345(+) ACAAT(-/A/AA)AAAAA utr-variant-3-prime
rs3836542 -- 40,312,492(+) TAGAG(-/GAGAACCTTATATCCAGTGCTA)GAGAA downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for EIF1B Gene

Variant ID Type Subtype PubMed ID
nsv834667 CNV Gain 17160897

Variation tolerance for EIF1B Gene

Residual Variation Intolerance Score: 53.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.04; 0.86% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for EIF1B Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EIF1B Gene

Disorders for EIF1B Gene

MalaCards: The human disease database

(1) MalaCards diseases for EIF1B Gene - From: DISEASES

Disorder Aliases PubMed IDs
acquired thrombocytopenia
  • secondary thrombocytopenia
- elite association - COSMIC cancer census association via MalaCards
Search EIF1B in MalaCards View complete list of genes associated with diseases

Relevant External Links for EIF1B

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with EIF1B: view

No data available for UniProtKB/Swiss-Prot and Genatlas for EIF1B Gene

Publications for EIF1B Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 67
  2. Expressed sequence tags identify a human isolog of the suil translation initiation factor. (PMID: 7904817) Fields C.A. … Adams M.D. (Biochem. Biophys. Res. Commun. 1994) 2 3
  3. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C. … Emili A. (Nature 2015) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. Development and application of a DNA microarray-based yeast two-hybrid system. (PMID: 23275563) Suter B. … Wanker E.E. (Nucleic Acids Res. 2013) 3

Products for EIF1B Gene

Sources for EIF1B Gene
