Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FANCF Gene

Aliases for FANCF Gene

  • Fanconi Anemia Complementation Group F 2 3 5
  • Fanconi Anemia Group F Protein 3
  • Protein FACF 4
  • FAF 3

External Ids for FANCF Gene

Previous GeneCards Identifiers for FANCF Gene

  • GC11M024061
  • GC11M023445
  • GC11M022683
  • GC11M022608
  • GC11M022327

Summaries for FANCF Gene

Entrez Gene Summary for FANCF Gene

  • The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]

GeneCards Summary for FANCF Gene

FANCF (Fanconi Anemia Complementation Group F) is a Protein Coding gene. Diseases associated with FANCF include Fanconi Anemia, Complementation Group F and Fanconi Anemia, Complementation Group A. Among its related pathways are Fanconi anemia pathway and Chks in Checkpoint Regulation. GO annotations related to this gene include ubiquitin-protein transferase activity.

UniProtKB/Swiss-Prot for FANCF Gene

  • DNA repair protein that may operate in a postreplication repair or a cell cycle checkpoint function. May be implicated in interstrand DNA cross-link repair and in the maintenance of normal chromosome stability (By similarity).

Gene Wiki entry for FANCF Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FANCF Gene

Genomics for FANCF Gene

Regulatory Elements for FANCF Gene

Enhancers for FANCF Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11G022624 1.1 ENCODE 9.7 +1.3 1330 2.7 HDGF PKNOX1 CREB3L1 WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 FANCF GAS2 GC11M022507
GH11G022634 1.2 ENCODE dbSUPER 8.8 -8.5 -8531 1.8 FOXA2 ARID4B DMAP1 SP5 TBX21 KAT8 GLIS1 RCOR2 NBN KDM1A FANCF RNA5SP338
GH11G022645 0.7 dbSUPER 7.9 -19.7 -19717 1.2 HDGF KLF11 ZBED1 NR2F1 GATAD2B RAD51 IKZF1 NBN MLLT1 RELB FANCF GAS2 RNA5SP338
GH11G022701 1.5 FANTOM5 Ensembl ENCODE 1.8 -76.1 -76099 2.8 ELF3 FOXA2 INSM2 RAD21 RARA GATA2 ZNF366 ZSCAN5C FOS RELB GAS2 FANCF SLC17A6 RNA5SP338 GC11P022726
GH11G022340 0.8 FANTOM5 dbSUPER 1.7 +286.1 286070 0.2 POLR2A CHD1 CBX2 EZH2 SLC17A6 FANCF ENSG00000254768 ENSG00000254540
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FANCF on UCSC Golden Path with GeneCards custom track

Promoters for FANCF Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000037900 1187 2001 PKNOX1 CREB3L1 WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 FOS

Genomic Location for FANCF Gene

Chromosome:
11
Start:
22,622,519 bp from pter
End:
22,626,787 bp from pter
Size:
4,269 bases
Orientation:
Minus strand

Genomic View for FANCF Gene

Genes around FANCF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FANCF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FANCF Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FANCF Gene

Proteins for FANCF Gene

  • Protein details for FANCF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NPI8-FANCF_HUMAN
    Recommended name:
    Fanconi anemia group F protein
    Protein Accession:
    Q9NPI8
    Secondary Accessions:
    • Q52LM0

    Protein attributes for FANCF Gene

    Size:
    374 amino acids
    Molecular mass:
    42254 Da
    Quaternary structure:
    • Belongs to the multisubunit FA complex composed of FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL/PHF9 and FANCM. The complex is not found in FA patients. In complex with FANCA, FANCG and FANCL, but not with FANCC, nor FANCE, interacts with HES1; this interaction may be essential for the stability and nuclear localization of FA core complex proteins.

    Three dimensional structures from OCA and Proteopedia for FANCF Gene

neXtProt entry for FANCF Gene

Post-translational modifications for FANCF Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FANCF Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FANCF Gene

Domains & Families for FANCF Gene

Gene Families for FANCF Gene

Protein Domains for FANCF Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FANCF Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with FANCF: view

No data available for UniProtKB/Swiss-Prot for FANCF Gene

Function for FANCF Gene

Molecular function for FANCF Gene

GENATLAS Biochemistry:
putative RNA binding protein,highly homolog to the prokaryotic RNA-binding protein ROM,intronless
UniProtKB/Swiss-Prot Function:
DNA repair protein that may operate in a postreplication repair or a cell cycle checkpoint function. May be implicated in interstrand DNA cross-link repair and in the maintenance of normal chromosome stability (By similarity).

Gene Ontology (GO) - Molecular Function for FANCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IPI 11063725
GO:0061630 ubiquitin protein ligase activity IEA --
genes like me logo Genes that share ontologies with FANCF: view
genes like me logo Genes that share phenotypes with FANCF: view

Human Phenotype Ontology for FANCF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for FANCF Gene

Localization for FANCF Gene

Subcellular locations from UniProtKB/Swiss-Prot for FANCF Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FANCF gene
Compartment Confidence
nucleus 5
plasma membrane 1
extracellular 1
peroxisome 1
cytosol 1

Gene Ontology (GO) - Cellular Components for FANCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm TAS --
GO:0043240 Fanconi anaemia nuclear complex IDA 20347428
genes like me logo Genes that share ontologies with FANCF: view

Pathways & Interactions for FANCF Gene

genes like me logo Genes that share pathways with FANCF: view

Pathways by source for FANCF Gene

1 BioSystems pathway for FANCF Gene
2 Reactome pathways for FANCF Gene
1 KEGG pathway for FANCF Gene

SIGNOR curated interactions for FANCF Gene

Is activated by:

Gene Ontology (GO) - Biological Process for FANCF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001541 ovarian follicle development IEA --
GO:0006281 DNA repair IEA --
GO:0006974 cellular response to DNA damage stimulus IEA --
GO:0007283 spermatogenesis IEA --
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with FANCF: view

Drugs & Compounds for FANCF Gene

(1) Drugs for FANCF Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with FANCF: view

Transcripts for FANCF Gene

mRNA/cDNA for FANCF Gene

(1) REFSEQ mRNAs :
(12) Additional mRNA sequences :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FANCF Gene

Fanconi anemia, complementation group F:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FANCF Gene

No ASD Table

Relevant External Links for FANCF Gene

GeneLoc Exon Structure for
FANCF
ECgene alternative splicing isoforms for
FANCF

Expression for FANCF Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FANCF Gene

Protein differential expression in normal tissues from HIPED for FANCF Gene

This gene is overexpressed in Bone (35.6), Liver, secretome (13.2), Lung (11.2), and Plasma (6.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FANCF Gene



NURSA nuclear receptor signaling pathways regulating expression of FANCF Gene:

FANCF

SOURCE GeneReport for Unigene cluster for FANCF Gene:

Hs.632151

Evidence on tissue expression from TISSUES for FANCF Gene

  • Nervous system(4.7)
  • Skin(4.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FANCF Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • neck
  • nose
  • outer ear
  • pituitary gland
  • skull
Thorax:
  • breast
  • esophagus
  • heart
  • lung
  • rib
  • rib cage
Abdomen:
  • intestine
  • kidney
  • large intestine
  • liver
  • stomach
Pelvis:
  • anus
  • ovary
  • pelvis
  • penis
  • prostate
  • rectum
  • testicle
  • ureter
  • uterus
  • vagina
  • vulva
Limb:
  • arm
  • digit
  • finger
  • forearm
  • hand
  • radius
  • upper limb
General:
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • hair
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with FANCF: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for FANCF Gene

Orthologs for FANCF Gene

This gene was present in the common ancestor of chordates.

Orthologs for FANCF Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FANCF 34 35
  • 99.2 (n)
cow
(Bos Taurus)
Mammalia FANCF 34 35
  • 80.62 (n)
mouse
(Mus musculus)
Mammalia Fancf 34 16 35
  • 61.11 (n)
rat
(Rattus norvegicus)
Mammalia Fancf 34
  • 60.87 (n)
dog
(Canis familiaris)
Mammalia FANCF 35
  • 50 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia FANCF 35
  • 42 (a)
OneToOne
chicken
(Gallus gallus)
Aves FANCF 34 35
  • 53.12 (n)
lizard
(Anolis carolinensis)
Reptilia FANCF 35
  • 42 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia fancf 34
  • 43 (n)
zebrafish
(Danio rerio)
Actinopterygii fancf 34 35
  • 43.48 (n)
Species where no ortholog for FANCF was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FANCF Gene

ENSEMBL:
Gene Tree for FANCF (if available)
TreeFam:
Gene Tree for FANCF (if available)

Paralogs for FANCF Gene

(1) SIMAP similar genes for FANCF Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with FANCF: view

No data available for Paralogs for FANCF Gene

Variants for FANCF Gene

Sequence variations from dbSNP and Humsavar for FANCF Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs104894221 Pathogenic 22,625,795(-) TTCTG(C/G/T)AGCAC upstream-variant-2KB, reference, missense, stop-gained
rs104894222 Pathogenic 22,625,484(-) CGTTA(C/G)CACCT upstream-variant-2KB, reference, stop-gained
rs587778340 Pathogenic 22,625,326(-) ACTCT(-/CT)GATGA upstream-variant-2KB, reference, frameshift-variant
rs730880277 Pathogenic 22,625,559(-) TCCAG(-/TTCCGGGATTAGCGAACTTCCAG)GCCCT upstream-variant-2KB, reference, frameshift-variant
rs730880278 Pathogenic 22,625,416(-) TCTTT(-/CCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAG)CCTGG upstream-variant-2KB, reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for FANCF Gene

Variant ID Type Subtype PubMed ID
nsv1046773 CNV loss 25217958

Variation tolerance for FANCF Gene

Residual Variation Intolerance Score: 61.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.31; 41.26% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FANCF Gene

Human Gene Mutation Database (HGMD)
FANCF
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FANCF

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FANCF Gene

Disorders for FANCF Gene

MalaCards: The human disease database

(8) MalaCards diseases for FANCF Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
fanconi anemia, complementation group f
  • fanconi anemia complementation group f
fanconi anemia, complementation group a
  • fanconi's anemia
fancf-related fanconi anemia
fanconi anemia, complementation group e
  • fanconi anemia complementation group e
gnathodiaphyseal dysplasia
  • gdd, osteogenesis imperfecta with unusual skeletal lesions
- elite association - COSMIC cancer census association via MalaCards
Search FANCF in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

FANCF_HUMAN
  • Fanconi anemia complementation group F (FANCF) [MIM:603467]: A disorder affecting all bone marrow elements and resulting in anemia, leukopenia and thrombopenia. It is associated with cardiac, renal and limb malformations, dermal pigmentary changes, and a predisposition to the development of malignancies. At the cellular level it is associated with hypersensitivity to DNA-damaging agents, chromosomal instability (increased chromosome breakage) and defective DNA repair. {ECO:0000269 PubMed:10615118}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for FANCF

Genetic Association Database (GAD)
FANCF
Human Genome Epidemiology (HuGE) Navigator
FANCF
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FANCF
genes like me logo Genes that share disorders with FANCF: view

No data available for Genatlas for FANCF Gene

Publications for FANCF Gene

  1. Structural determinants of human FANCF protein that function in the assembly of a DNA damage signaling complex. (PMID: 17082180) Kowal P. … Ellenberger T. (J. Biol. Chem. 2007) 3 4 22 64
  2. The Fanconi anaemia gene FANCF encodes a novel protein with homology to ROM. (PMID: 10615118) de Winter J.P. … Joenje H. (Nat. Genet. 2000) 3 4 22 64
  3. The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. (PMID: 11063725) de Winter J.P. … Joenje H. (Hum. Mol. Genet. 2000) 3 4 22 64
  4. Comprehensive screen of genetic variation in DNA repair pathway genes and postmenopausal breast cancer risk. (PMID: 20496165) Monsees G.M. … Han J. (Breast Cancer Res. Treat. 2011) 3 46 64
  5. Evaluating new candidate SNPs as low penetrance risk factors in sporadic breast cancer: a two-stage Spanish case-control study. (PMID: 18950845) Vega A. … Carracedo A. (Gynecol. Oncol. 2009) 3 46 64

Products for FANCF Gene

Sources for FANCF Gene

Content
Loading form....