Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZSWIM6 Gene

Aliases for ZSWIM6 Gene

  • Zinc Finger SWIM-Type Containing 6 2 3 5
  • Zinc Finger SWIM Domain-Containing Protein 6 3
  • Zinc Finger, SWIM Domain Containing 6 3
  • KIAA1577 4
  • AFND 3

External Ids for ZSWIM6 Gene

Previous GeneCards Identifiers for ZSWIM6 Gene

  • GC05P060783
  • GC05P060645
  • GC05P060663
  • GC05P060628
  • GC05P057585

Summaries for ZSWIM6 Gene

Entrez Gene Summary for ZSWIM6 Gene

  • The protein encoded by this gene contains a zinc finger SWI2/SNF2 and MuDR (SWIM) domain. Proteins with SWIM domains have been found in a diverse number of species and are predicted to interact with DNA or proteins. Mutations in this gene result in acromelic frontonasal dysostosis. [provided by RefSeq, Apr 2017]

GeneCards Summary for ZSWIM6 Gene

ZSWIM6 (Zinc Finger SWIM-Type Containing 6) is a Protein Coding gene. Diseases associated with ZSWIM6 include Acromelic Frontonasal Dysostosis and Dysostosis. An important paralog of this gene is ZSWIM5.

Additional gene information for ZSWIM6 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZSWIM6 Gene

Genomics for ZSWIM6 Gene

Regulatory Elements for ZSWIM6 Gene

Enhancers for ZSWIM6 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH05H061298 1.9 FANTOM5 Ensembl ENCODE dbSUPER 14.1 -29.4 -29389 9.5 PKNOX1 FOXA2 ATF1 ARID4B SIN3A DMAP1 ATF7 FOS DEK ZHX2 ZSWIM6 SMIM15 SMIM15-AS1 RNU6-913P ERCC8 LINC02057 GC05P061249
GH05H061327 1.7 FANTOM5 ENCODE dbSUPER 13.1 -0.7 -694 7.9 PKNOX1 FOXA2 ARID4B SIN3A FEZF1 ZNF2 YY1 ZNF143 FOS SP3 ZSWIM6 ELOVL7 LOC105378994 LOC105378993
GH05H060943 1.4 FANTOM5 ENCODE 13.6 -387.2 -387246 3.2 HDGF PKNOX1 ARID4B SIN3A ZNF2 YY1 ZNF766 ZNF548 FOS SP3 CAB39P1 ENSG00000248199 ZSWIM6 ELOVL7 ERCC8 NDUFAF2 LOC105378991
GH05H061290 1.2 Ensembl ENCODE dbSUPER 12.2 -40.1 -40091 3.2 PKNOX1 SIN3A RAD21 RFX5 CTBP1 ZNF207 SMARCE1 STAT1 USF2 MNT ZSWIM6 LINC02057 GC05P061249
GH05H061274 1.5 FANTOM5 Ensembl ENCODE dbSUPER 6.5 -55.8 -55785 3.3 CTCF ETV1 MAX RAD21 YY1 POLR2A SCRT2 FOS NFE2 FOXP2 ZSWIM6 ERCC8 LINC02057 ELOVL7 GC05P061249
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ZSWIM6 on UCSC Golden Path with GeneCards custom track

Promoters for ZSWIM6 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000181391 327 4801 ARID4B SIN3A FEZF1 ZNF2 YY1 ZNF143 FOS SP3 ZHX2 REST

Genomic Locations for ZSWIM6 Gene

Genomic Locations for ZSWIM6 Gene
213,900 bases
Plus strand

Genomic View for ZSWIM6 Gene

Genes around ZSWIM6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZSWIM6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZSWIM6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZSWIM6 Gene

Proteins for ZSWIM6 Gene

  • Protein details for ZSWIM6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Zinc finger SWIM domain-containing protein 6
    Protein Accession:

    Protein attributes for ZSWIM6 Gene

    1215 amino acids
    Molecular mass:
    133470 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ZSWIM6 Gene

Post-translational modifications for ZSWIM6 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ZSWIM6 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ZSWIM6 Gene

Domains & Families for ZSWIM6 Gene

Gene Families for ZSWIM6 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for ZSWIM6 Gene


Suggested Antigen Peptide Sequences for ZSWIM6 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ZSWIM6: view

No data available for UniProtKB/Swiss-Prot for ZSWIM6 Gene

Function for ZSWIM6 Gene

Phenotypes From GWAS Catalog for ZSWIM6 Gene

Gene Ontology (GO) - Molecular Function for ZSWIM6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008270 zinc ion binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with ZSWIM6: view

Phenotypes for ZSWIM6 Gene

GenomeRNAi human phenotypes for ZSWIM6:
genes like me logo Genes that share phenotypes with ZSWIM6: view

Human Phenotype Ontology for ZSWIM6 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ZSWIM6 Gene

Localization for ZSWIM6 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ZSWIM6 gene
Compartment Confidence
cytosol 3
nucleus 2
extracellular 1
mitochondrion 1
peroxisome 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for ZSWIM6 Gene

Pathways & Interactions for ZSWIM6 Gene

SuperPathways for ZSWIM6 Gene

No Data Available

Interacting Proteins for ZSWIM6 Gene

Gene Ontology (GO) - Biological Process for ZSWIM6 Gene


No data available for Pathways by source and SIGNOR curated interactions for ZSWIM6 Gene

Drugs & Compounds for ZSWIM6 Gene

No Compound Related Data Available

Transcripts for ZSWIM6 Gene

mRNA/cDNA for ZSWIM6 Gene

(2) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(50) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ZSWIM6 Gene

Zinc finger, SWIM-type containing 6:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ZSWIM6 Gene

No ASD Table

Relevant External Links for ZSWIM6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ZSWIM6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ZSWIM6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ZSWIM6 Gene

This gene is overexpressed in Liver, secretome (66.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ZSWIM6 Gene

Protein tissue co-expression partners for ZSWIM6 Gene

NURSA nuclear receptor signaling pathways regulating expression of ZSWIM6 Gene:


SOURCE GeneReport for Unigene cluster for ZSWIM6 Gene:


Evidence on tissue expression from TISSUES for ZSWIM6 Gene

  • Nervous system(4.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ZSWIM6 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • digestive
  • integumentary
  • nervous
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • eye
  • eyelid
  • face
  • head
  • lip
  • meninges
  • mouth
  • neck
  • nose
  • skull
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
  • hair
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with ZSWIM6: view

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for ZSWIM6 Gene

Orthologs for ZSWIM6 Gene

This gene was present in the common ancestor of animals.

Orthologs for ZSWIM6 Gene

Organism Taxonomy Gene Similarity Type Details
(Monodelphis domestica)
Mammalia ZSWIM6 34
  • 98 (a)
(Pan troglodytes)
Mammalia ZSWIM6 34
  • 98 (a)
(Bos Taurus)
Mammalia ZSWIM6 33 34
  • 95.79 (n)
(Canis familiaris)
Mammalia ZSWIM6 33 34
  • 95.04 (n)
(Mus musculus)
Mammalia Zswim6 33 16 34
  • 93.16 (n)
(Rattus norvegicus)
Mammalia Zswim6 33
  • 93 (n)
(Ornithorhynchus anatinus)
Mammalia ZSWIM6 34
  • 75 (a)
(Gallus gallus)
Aves -- 34
  • 94 (a)
-- 34
  • 94 (a)
  • 88.65 (n)
(Anolis carolinensis)
Reptilia ZSWIM6 34
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia zswim6 33
  • 84.75 (n)
(Danio rerio)
Actinopterygii zswim6 33 34
  • 75.42 (n)
Dr.28381 33
(Caenorhabditis elegans)
Secernentea ebax-1 34
  • 14 (a)
Species where no ortholog for ZSWIM6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ZSWIM6 Gene

Gene Tree for ZSWIM6 (if available)
Gene Tree for ZSWIM6 (if available)

Paralogs for ZSWIM6 Gene

Paralogs for ZSWIM6 Gene

(2) SIMAP similar genes for ZSWIM6 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with ZSWIM6: view

Variants for ZSWIM6 Gene

Sequence variations from dbSNP and Humsavar for ZSWIM6 Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs587777695 Pathogenic, Acromelic frontonasal dysostosis (AFND) [MIM:603671] 61,544,156(+) GTCCT(C/T)GGCAC reference, missense
rs528020839 Likely benign 61,332,354(+) CAGCA(-/GCG/GCGGCGGCGGCGGGGGCAGCAGCG)GCGGC upstream-variant-2KB, cds-indel
rs864309616 Uncertain significance 61,332,729(+) GCGGC(-/GGCGGC)TCCTC upstream-variant-2KB, cds-indel
rs864309617 Benign 61,332,341(+) GGCGG(-/CGGCGG)GGGCA upstream-variant-2KB, cds-indel
rs1000053656 -- 61,420,996(+) ATCAC(C/T)GCAAC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ZSWIM6 Gene

Variant ID Type Subtype PubMed ID
nsv980649 CNV duplication 23825009
nsv968179 CNV duplication 23825009
nsv950070 CNV duplication 24416366
nsv950069 CNV duplication 24416366
nsv950068 CNV deletion 24416366
nsv930487 CNV deletion 23359205
nsv823090 CNV loss 20364138
nsv823089 CNV gain 20364138
nsv598319 CNV loss 21841781
nsv598318 CNV gain+loss 21841781
nsv598315 CNV loss 21841781
nsv522826 CNV loss 19592680
nsv1144106 CNV deletion 24896259
nsv1073885 CNV deletion 25765185
esv3605213 CNV loss 21293372
esv2730245 CNV deletion 23290073
esv22368 CNV gain+loss 19812545
dgv9813n54 CNV loss 21841781
dgv9812n54 CNV gain 21841781

Variation tolerance for ZSWIM6 Gene

Gene Damage Index Score: 15.72; 97.32% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ZSWIM6 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ZSWIM6 Gene

Disorders for ZSWIM6 Gene

MalaCards: The human disease database

(3) MalaCards diseases for ZSWIM6 Gene - From: HGMD, OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
acromelic frontonasal dysostosis
  • afnd
  • dysostoses
corpus callosum agenesis
  • agenesis of the corpus callosum
- elite association - COSMIC cancer census association via MalaCards


  • Acromelic frontonasal dysostosis (AFND) [MIM:603671]: A rare variant form of frontonasal dysplasia, an array of abnormalities affecting the eyes, forehead and nose and linked to midfacial dysraphia. The clinical picture is highly variable. Major findings include true ocular hypertelorism, broadening of the nasal root, median facial cleft affecting the nose and/or upper lip and palate, unilateral or bilateral clefting of the alae nasi, lack of formation of the nasal tip, anterior cranium bifidum occultum, a V-shaped or widows peak frontal hairline. AFND is characterized by the association of frontonasal malformations with various combinations of polydactyly, tibial hypoplasia, epibulbar dermoid, encephalocoele, corpus callosum agenesis and Dandy-Walker malformation. {ECO:0000269 PubMed:25105228}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for ZSWIM6

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with ZSWIM6: view

No data available for Genatlas for ZSWIM6 Gene

Publications for ZSWIM6 Gene

  1. Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PMID: 10997877) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 2000) 2 3 4 60
  2. Exome sequencing identifies a recurrent de novo ZSWIM6 mutation associated with acromelic frontonasal dysostosis. (PMID: 25105228) Smith JD … Cunningham ML (American journal of human genetics 2014) 3 4 60
  3. Altered gene expression in the subdivisions of the amygdala of Fyn-deficient mice as revealed by laser capture microdissection and mKIAA cDNA array analysis. (PMID: 16427614) Kai N … Yuasa S (Brain research 2006) 2 3 60
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  5. Acromelic frontonasal dysostosis and ZSWIM6 mutation: phenotypic spectrum and mosaicism. (PMID: 26706854) Twigg SR … Wilkie AO (Clinical genetics 2016) 3 60

Products for ZSWIM6 Gene

Sources for ZSWIM6 Gene

Loading form....