Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

ZNF730 Gene

protein-coding GIFtS: 35
GCID: GC19P023299 (predicted)

zinc finger protein 730

Search for ZNF730
in

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Zinc Finger Protein 730¹ ²

External Ids:	HGNC: 32470¹	Entrez Gene: 100129543²	Ensembl: ENSG00000183850⁷	UniProtKB: Q6ZMV8³

ORGUL members:
	NONCODE:n383439

Export aliases for ZNF730 gene to outside databases

Previous GC identifers: GC19P023093 GC19P022840

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8

Function: May be involved in transcriptional regulation (By similarity)

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000019.9 NT_011295.11 NC_018930.1

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the ZNF730 gene promoter:
HOXA9 Nkx3-1 SRF Nkx3-1 v4 p53 SRF (504 AA) Nkx3-1 v1 AREB6 Nkx3-1 v2 Nkx3-1 v3
Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids

Search SABiosciences Chromatin IP Primers for ZNF730

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF730

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p12 Ensembl cytogenetic band: 19p12 HGNC cytogenetic band: 19p12

ZNF730 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ZNF730 gene location

GeneLoc information about chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19P023299: view genomic region (about GC identifiers)

Start:	23,299,777 bp from pter	End:	23,332,763 bp from pter
Size:	32,987 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8 (See protein sequence)

Recommended Name: Putative zinc finger protein 730

Size: 503 amino acids; 59040 Da

Subcellular location: Nucleus (By similarity)

Explore the universe of human proteins at neXtProt for ZNF730: NX_Q6ZMV8

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q6ZMV8

ZNF730 Protein expression data from MOPED and PaxDb: About this image

ENSEMBL proteins:

ENSP00000329365

Reactome Protein details: Q6ZMV8
Human Recombinant Protein Products for ZNF730:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells Browse OriGene Protein Over-expression Lysates OriGene Custom Protein Services for ZNF730
	GenScript Custom Purified and Recombinant Proteins Services for ZNF730
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for ZNF730

Gene Ontology (GO): 1 cellular component term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	IEA	--

ZNF730 for ontologies About GeneDecksing

ZNF730 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for ZNF730
	GenScript Custom Superior Antibodies Services for ZNF730
	Search for Antibodies for ZNF730 at Abcam
	Uscn Antibodies for ZNF730
	Search ThermoFisher Antibodies for ZNF730

Assay Products for ZNF730:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for ZNF730
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for ZNF730

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

ZNF730 for domains About GeneDecksing

4 InterPro domains/families:

IPR015880 Znf_C2H2-like

IPR001909 Krueppel-associated_box

IPR013087 Znf_C2H2/integrase_DNA-bd

IPR007087 Znf_C2H2

Graphical View of Domain Structure for InterPro Entry Q6ZMV8

ProtoNet protein and cluster: Q6ZMV8

1 Blocks protein family: IPB001909 KRAB box

UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8

Similarity: Belongs to the krueppel C2H2-type zinc-finger protein family

Similarity: Contains 12 C2H2-type zinc fingers

Similarity: Contains 1 KRAB domain

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: ZN730_HUMAN, Q6ZMV8

Function: May be involved in transcriptional regulation (By similarity)

Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003677	DNA binding	IEA	--
GO:0008270	zinc ion binding	IEA	--

ZNF730 for ontologies About GeneDecksing

Animal Models:

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ZNF730

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF730
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF730
		Browse SwitchGear 3'UTR luciferase reporter plasmids

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		Browse OriGene 29mer shRNA kits Browse OriGene siRNA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
		Sirion Biotech Custom design and validation of potent shRNA sequences against ZNF730

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for ZNF730
			Sirion Biotech Customized adenovirus for overexpression of ZNF730 Sirion Biotech Customized adenovirus for potent knockdown of ZNF730

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		Browse OriGene untagged/tagged cDNA clones in CMV expression vector OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): ZNF730 (XM_001715065)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF730
		Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for ZNF730
		Search LifeMap BioReagents cell lines for ZNF730
		Sirion Biotech Customized stable knockdown cell line services for ZNF730 Sirion Biotech Customized inducible knockdown cell line services for ZNF730 Sirion Biotech Customized stable overexpressing cell line services for ZNF730 Sirion Biotech Customized inducible overexpressing cell line services for ZNF730

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Generic Transcription Pathway

Generic Transcription Pathway

1.00

Gene Expression

0.46

Pathway sources
See GeneCards unified pathways
Show all pathways

2 Reactome Pathways for ZNF730

	Generic Transcription Pathway
	Gene Expression

ZNF730 for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for ZNF730

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006351	transcription, DNA-dependent	IEA	--
GO:0006355	regulation of transcription, DNA-dependent	IEA	--

ZNF730 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for ZNF730
Search CenterWatch for drugs/clinical trials and news about ZNF730 / ZN730

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

Unigene Cluster for ZNF730:

Zinc finger protein 730

Hs.427120 [show with all ESTs]

Unigene Representative Sequence: AK131472

1 Ensembl transcript including schematic representation, and UCSC links where relevant:

ENST00000327867(uc002nrb.1)

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF730
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF730
		Browse SwitchGear 3'UTR luciferase reporter plasmids

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		Browse OriGene 29mer shRNA kits Browse OriGene siRNA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
		Sirion Biotech Custom design and validation of potent shRNA sequences against ZNF730

Clone Products:		Browse OriGene untagged/tagged cDNA clones in CMV expression vector OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): ZNF730 (XM_001715065)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF730
		Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730

Primer Products:		Browse OriGene genome-wide validated SYBR primer pairs Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat ZNF730
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730

Additional cDNA sequence: AK131472.1

5 DOTS entries:

DT.40117682 DT.121501756 DT.91894434 DT.121501706 DT.40197164

GeneLoc Exon Structure

3 Alternative Splicing Database (ASD) splice patterns (SP) for ZNF730 About this scheme

ExUns:	1a	·	1b	^	2	^	3	^	4a	·	4b	·	4c
SP1:					-
SP2:
SP3:					-		-

ECgene alternative splicing isoforms for ZNF730

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

ZNF730 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: --

About this image
See ZNF730 Protein Expression from SPIRE MOPED and PaxDB
SOURCE GeneReport for Unigene cluster: Hs.427120
SABiosciences Custom PCR Arrays for ZNF730

Primer Products:		Browse OriGene genome-wide validated SYBR primer pairs Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat ZNF730
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of chordates.

Orthologs for ZNF730 gene from 1/4 species (see all 4) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
lizard (Anolis carolinensis)	Reptilia	-- -- (see all 7)	--	41(a) 39(a) (see all 7)	many ↔ many many ↔ many (see all 7)	GL343330.1(1093706-1292239) AAWZ02037240(11818-13836)

ENSEMBL Gene Tree for ZNF730 (if available)
TreeFam Gene Tree for ZNF730 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for ZNF730 gene

ZNF85² ZNF493² ZNF486² ZNF100² ZNF92² ZNF732² ZNF138² ZNF675²

ZNF506² ZNF273² ZNF66P² ZNF695² ZNF626² ZNF680² ZNF253² ZNF479²

ZNF93² ZNF492² ZNF682² ZNF676² ZNF141² ZNF681² ZNF679² ZNF257²

ZNF254² ZNF737² ZNF724P² ZNF98² ZNF849P² ZNF716² ZNF714² ZNF429²

ZNF430² ZNF678² ZNF117² ZNF708² ZNF107² ZNF431² ZNF90²

18/494 SIMAP similar genes for ZNF730 using alignment to 3 protein entries: ZN730_HUMAN (see all proteins) (see all similar genes):

MGC12518 ZNF738 ZNF273 ZNF492 ZNF78L1 ZNF98

ZNF254 ZFS-5 ZFS-6 ZNF429 ZNF431 ZNF626

DKFZp686M04222 DKFZp762K012 ZNF724P ZNF66P HZF30 ZNF430

ZNF730 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs79094894^1,2	F	--	22839628(+)	`GCTCCA/CTAAAG`	1	--	us2k¹		1		WA	118
rs76498887^1,2	F	--	22839947(+)	`ACCAGA/GTAGTG`	1	--	us2k¹		1		WA	118
rs73029452^1,2	C,F	--	22840517(+)	`CCCGAA/GAAGGC`	1	--	us2k¹		2		WA NA	238
rs73029453^1,2	C,F	--	22840578(+)	`TCACTC/GAGGGC`	1	--	us2k¹		1		NA	120
rs71163448^1,2	C	--	22840597(+)	`CGGGG-/CCTTAAACGTTATCCAA TCGGGGACACTGGGCGGGGGGCCG`	1	--	us2k¹		1		NA	2
rs62122971^1,2		--	22840644(+)	`TTCCGG/TGATTT`	1	--	ut5¹		4		NA WA EA	360
rs76334092^1,2	F	--	22841681(+)	`TAACTG/CTGTCT`	1	--	int¹		1		NA	4
rs28884522^1,2		--	22841734(+)	`AATGCC/TAACTT`	1	--	int¹		0	--	--	--	--
rs62122972^1,2		--	22842158(+)	`GGTCAT/ATTTCT`	1	--	int¹		4		NA WA EA	360
rs62122973^1,2		--	22842921(+)	`AATAAT/CTTTGT`	1	--	int¹		4		NA WA EA	360

HapMap Linkage Disequilibrium report for ZNF730 (23299777 - 23332763 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for ZNF730: --

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF730

DNA2.0 Custom Variant and Variant Library Synthesis for ZNF730

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed article for ZNF730 gene integrated from 9 sources:
(articles sorted by number of sources associating them with ZNF730)

Utopia: connect your pdf to the dynamic
world of online information

Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)² Ota T.... Sugano S. (2004)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 100129543	HGNC: 32470	Ensembl:ENSG00000183850	euGenes: HUgn100129543	ECgene: ZNF730
H-InvDB: ZNF730

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for ZNF730	Pharmacogenomics, SNPs, Pathways

Intellectual Property for ZNF730 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for ZNF730 gene:
Search GeneIP for patents involving ZNF730

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		Browse OriGene shRNA RFPs
	Browse OriGene 29mer shRNA kits in GFP-retroviral vector		Browse OriGene genome-wide validated SYBR primer pairs
	Browse OriGene Protein Over-expression Lysates		Browse OriGene Fluorogenic Cell Assay Kits
	Browse OriGene siRNAs		Browse 3'-UTR reporter clones for miRNA target validation
	Browse OriGene untagged cDNA clones in CMV expression vector		Browse OriGene Myc/DDK tagged cDNA clones in CMV expression vector
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for ZNF730		OriGene Custom Protein Services for ZNF730
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ZNF730
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF730
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF730
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730

	GenScript Custom Purified and Recombinant Proteins Services for ZNF730		GenScript cDNA clones with any tag delivered in your preferred vector for ZNF730
	GenScript Custom Assay Services for ZNF730		GenScript Custom Superior Antibodies Services for ZNF730
	GenScript Custom overexpressing Cell Line Services for ZNF730		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in ZNF730 promoter
	Search Chromatin IP Primers for ZNF730
	RT² qPCR Primer Assay in human, mouse / rat ZNF730
	Search GNC Networks for ZNF730
	SABiosciences Custom PCR Arrays for ZNF730

Search Tocris compounds for ZNF730

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Biologicals
	Novus Tissue Slides

	Search for Antibodies for ZNF730 at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for ZNF730
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

ZNF730 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for ZNF730

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730

	Browse SwitchGear 3'UTR luciferase reporter plasmids for ZNF730
	Browse SwitchGear Promoter luciferase reporter plasmids for ZNF730

Search ThermoFisher Antibodies for ZNF730

Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ZNF730

Sirion Biotech Customized:

	stable knockdown cell line services for ZNF730
	inducible knockdown cell line services for ZNF730
	design and validation of potent shRNA sequences against ZNF730
	adenovirus for potent knockdown of ZNF730
	adenovirus for overexpression of ZNF730
	stable overexpressing cell line services for ZNF730
	inducible overexpressing cell line services for ZNF730

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes ZNF730 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

ZNF730 Gene

zinc finger protein 730

Aliases
for ZNF730 gene

Summaries
for ZNF730 gene

Genomic Views
for ZNF730 gene

Proteins
for ZNF730 gene

Protein Domains /
Families
for ZNF730 gene

Function
for ZNF730 gene

Pathways & Interactions
for ZNF730 gene

Drugs & Compounds
for ZNF730 gene

Transcripts
for ZNF730 gene

Expression
for ZNF730 gene

Orthologs
for ZNF730 gene

Paralogs
for ZNF730 gene

Genomic Variants
for ZNF730 gene

Disorders / Diseases
for ZNF730 gene

Publications
for ZNF730 gene

External Searches for ZNF730 gene

Genome Databases showing ZNF730 gene

Other Databases showing ZNF730 gene

Specialized Databases showing ZNF730 gene

Intellectual Property
for ZNF730 gene

Products
for ZNF730 gene

View Random Gene

Advanced Search

Export list of displayed genes

ZNF730 Gene

zinc finger protein 730

Aliasesfor ZNF730 gene

Summariesfor ZNF730 gene

Genomic Viewsfor ZNF730 gene

Proteinsfor ZNF730 gene

Protein Domains /Familiesfor ZNF730 gene

Functionfor ZNF730 gene

Pathways & Interactionsfor ZNF730 gene

Drugs & Compoundsfor ZNF730 gene

Transcriptsfor ZNF730 gene

Expression for ZNF730 gene

Orthologsfor ZNF730 gene

Paralogsfor ZNF730 gene

Genomic Variantsfor ZNF730 gene

Disorders / Diseasesfor ZNF730 gene

Publicationsfor ZNF730 gene

External Searches for ZNF730 gene

Genome Databases showing ZNF730 gene

Other Databases showing ZNF730 gene

Specialized Databases showing ZNF730 gene

Intellectual Propertyfor ZNF730 gene

Productsfor ZNF730 gene

View Random Gene

Aliases
for ZNF730 gene

Summaries
for ZNF730 gene

Genomic Views
for ZNF730 gene

Proteins
for ZNF730 gene

Protein Domains /
Families
for ZNF730 gene

Function
for ZNF730 gene

Pathways & Interactions
for ZNF730 gene

Drugs & Compounds
for ZNF730 gene

Transcripts
for ZNF730 gene

Expression
for ZNF730 gene

Orthologs
for ZNF730 gene

Paralogs
for ZNF730 gene

Genomic Variants
for ZNF730 gene

Disorders / Diseases
for ZNF730 gene

Publications
for ZNF730 gene

Intellectual Property
for ZNF730 gene

Products
for ZNF730 gene