Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ZNF730 Gene

protein-coding   GIFtS: 35
GCID: GC19P023299          (predicted)

zinc finger protein 730

  Search for ZNF730
in our new
 Human Malady Compendium 
Biological research products
for ZNF730
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Zinc Finger Protein 7301 2

External Ids:    HGNC: 324701   Entrez Gene: 1001295432   Ensembl: ENSG000001838507   UniProtKB: Q6ZMV83   
ORGUL members:         
NONCODE:n383439    

Export aliases for ZNF730 gene to outside databases

Previous GC identifers: GC19P023093 GC19P022840


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8
Function: May be involved in transcriptional regulation (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000019.9  NT_011295.11  NC_018930.1  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ZNF730 gene promoter:
         HOXA9   Nkx3-1   SRF   Nkx3-1 v4   p53   SRF (504 AA)   Nkx3-1 v1   AREB6   Nkx3-1 v2   Nkx3-1 v3   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for ZNF730

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF730


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p12   Ensembl cytogenetic band:  19p12   HGNC cytogenetic band: 19p12

ZNF730 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ZNF730 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P023299:  view genomic region     (about GC identifiers)

Start:
23,299,777 bp from pter      End:
23,332,763 bp from pter
Size:
32,987 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8 (See protein sequence)
Recommended Name: Putative zinc finger protein 730  
Size: 503 amino acids; 59040 Da
Subcellular location: Nucleus (By similarity)

Explore the universe of human proteins at neXtProt for ZNF730: NX_Q6ZMV8

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q6ZMV8

  • ZNF730 Protein expression data from MOPED and PaxDb:    About this image 
    ZNF730 Protein Expression

    ENSEMBL proteins: 
     ENSP00000329365  
    Reactome Protein details: Q6ZMV8
    Human Recombinant Protein Products for ZNF730: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for ZNF730 
    GenScript Custom Purified and Recombinant Proteins Services for ZNF730
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for ZNF730

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--

    ZNF730 for ontologies           About GeneDecksing



    ZNF730 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ZNF730 
    GenScript Custom Superior Antibodies Services for ZNF730
    Search for Antibodies for ZNF730 at Abcam  
    Uscn Antibodies for ZNF730
    Search ThermoFisher Antibodies for ZNF730

    Assay Products for ZNF730: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ZNF730
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for ZNF730


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ZNF730 for domains           About GeneDecksing

    4 InterPro domains/families:
     IPR015880 Znf_C2H2-like
     IPR001909 Krueppel-associated_box
     IPR013087 Znf_C2H2/integrase_DNA-bd
     IPR007087 Znf_C2H2

    Graphical View of Domain Structure for InterPro Entry Q6ZMV8

    ProtoNet protein and cluster: Q6ZMV8

    1 Blocks protein family: IPB001909 KRAB box

    UniProtKB/Swiss-Prot: ZN730_HUMAN, Q6ZMV8
    Similarity: Belongs to the krueppel C2H2-type zinc-finger protein family
    Similarity: Contains 12 C2H2-type zinc fingers
    Similarity: Contains 1 KRAB domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ZN730_HUMAN, Q6ZMV8
    Function: May be involved in transcriptional regulation (By similarity)

         Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003677DNA binding IEA--
    GO:0008270zinc ion binding IEA--
         
    ZNF730 for ontologies           About GeneDecksing


    Animal Models:
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ZNF730 

    miRNA
    Products:
        
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF730
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF730
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    Browse OriGene 29mer shRNA kits
    Browse OriGene siRNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
    Sirion Biotech Custom design and validation of potent shRNA sequences against ZNF730 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ZNF730
    Sirion Biotech Customized adenovirus for overexpression of ZNF730 
    Sirion Biotech Customized adenovirus for potent knockdown of ZNF730

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ZNF730 (XM_001715065)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF730
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ZNF730
    Search LifeMap BioReagents cell lines for ZNF730
    Sirion Biotech Customized stable knockdown cell line services for ZNF730 
    Sirion Biotech Customized inducible knockdown cell line services for ZNF730
    Sirion Biotech Customized stable overexpressing cell line services for ZNF730
    Sirion Biotech Customized inducible overexpressing cell line services for ZNF730

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Generic Transcription Pathway
    Generic Transcription Pathway1.00
    Gene Expression0.46

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    2        Reactome Pathways for ZNF730
        Generic Transcription Pathway
    Gene Expression



    ZNF730 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for ZNF730

    Gene Ontology (GO): 2 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006351transcription, DNA-dependent IEA--
    GO:0006355regulation of transcription, DNA-dependent IEA--

    ZNF730 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ZNF730
    Search CenterWatch for drugs/clinical trials and news about ZNF730 / ZN730 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    Unigene Cluster for ZNF730:

    Zinc finger protein 730
    Hs.427120  [show with all ESTs]
    Unigene Representative Sequence: AK131472
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000327867(uc002nrb.1)

    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF730
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF730
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    Browse OriGene 29mer shRNA kits
    Browse OriGene siRNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
    Sirion Biotech Custom design and validation of potent shRNA sequences against ZNF730 
    Clone
    Products:
         
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ZNF730 (XM_001715065)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF730
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730 
    Primer
    Products:
        
    Browse OriGene genome-wide validated SYBR primer pairs
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat ZNF730
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730

    Additional cDNA sequence: AK131472.1 

    5 DOTS entries:

    DT.40117682  DT.121501756  DT.91894434  DT.121501706  DT.40197164 

    GeneLoc Exon Structure

    3 Alternative Splicing Database (ASD) splice patterns (SP) for ZNF730    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b · 4c
    SP1:              -                           
    SP2:                                          
    SP3:              -     -                     


    ECgene alternative splicing isoforms for ZNF730

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ZNF730 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: --
    ZNF730 Expression
    About this image
    See ZNF730 Protein Expression from SPIRE MOPED and PaxDB
    SOURCE GeneReport for Unigene cluster: Hs.427120
        SABiosciences Custom PCR Arrays for ZNF730

    Primer
    Products:
    Browse OriGene genome-wide validated SYBR primer pairs
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat ZNF730
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for ZNF730 gene from 1/4 species (see all 4)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    (see all 7)
    --
    41(a)
    39(a)
    (see all 7)
    many ↔ many
    many ↔ many
    (see all 7)
    GL343330.1(1093706-1292239)
    AAWZ02037240(11818-13836)


    ENSEMBL Gene Tree for ZNF730 (if available)
    TreeFam Gene Tree for ZNF730 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ZNF730 gene
    ZNF852  ZNF4932  ZNF4862  ZNF1002  ZNF922  ZNF7322  ZNF1382  ZNF6752  
    ZNF5062  ZNF2732  ZNF66P2  ZNF6952  ZNF6262  ZNF6802  ZNF2532  ZNF4792  
    ZNF932  ZNF4922  ZNF6822  ZNF6762  ZNF1412  ZNF6812  ZNF6792  ZNF2572  
    ZNF2542  ZNF7372  ZNF724P2  ZNF982  ZNF849P2  ZNF7162  ZNF7142  ZNF4292  
    ZNF4302  ZNF6782  ZNF1172  ZNF7082  ZNF1072  ZNF4312  ZNF902  
    18/494 SIMAP similar genes for ZNF730 using alignment to 3 protein entries:     ZN730_HUMAN (see all proteins) (see all similar genes):
    MGC12518    ZNF738    ZNF273    ZNF492    ZNF78L1    ZNF98
    ZNF254    ZFS-5    ZFS-6    ZNF429    ZNF431    ZNF626
    DKFZp686M04222    DKFZp762K012    ZNF724P    ZNF66P    HZF30    ZNF430

    ZNF730 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/423 NCBI SNPs in ZNF730 are shown (see all 423    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs790948941,2
    F--22839628(+) GCTCCA/CTAAAG 1 -- us2k11Minor allele frequency- C:0.03WA 118
    rs764988871,2
    F--22839947(+) ACCAGA/GTAGTG 1 -- us2k11Minor allele frequency- G:0.04WA 118
    rs730294521,2
    C,F--22840517(+) CCCGAA/GAAGGC 1 -- us2k12Minor allele frequency- G:0.04WA NA 238
    rs730294531,2
    C,F--22840578(+) TCACTC/GAGGGC 1 -- us2k11Minor allele frequency- G:0.05NA 120
    rs711634481,2
    C--22840597(+) CGGGG-/CCTTAAACGTTATCCAA
    TCGGGGACACTGGGCGGGG
    GGCCG
    1 -- us2k11Minor allele frequency- CCTTAAACGTTATCCAATCGGGGACACTGGGCGGGG:0.00NA 2
    rs621229711,2
    --22840644(+) TTCCGG/TGATTT 1 -- ut514Minor allele frequency- T:0.07NA WA EA 360
    rs763340921,2
    F--22841681(+) TAACTG/CTGTCT 1 -- int11Minor allele frequency- C:0.50NA 4
    rs288845221,2
    --22841734(+) AATGCC/TAACTT 1 -- int10--------
    rs621229721,2
    --22842158(+) GGTCAT/ATTTCT 1 -- int14Minor allele frequency- A:0.07NA WA EA 360
    rs621229731,2
    --22842921(+) AATAAT/CTTTGT 1 -- int14Minor allele frequency- C:0.06NA WA EA 360

    HapMap Linkage Disequilibrium report for ZNF730 (23299777 - 23332763 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for ZNF730: --

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF730
    DNA2.0 Custom Variant and Variant Library Synthesis for ZNF730

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
      --

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed article for ZNF730 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with ZNF730)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)2 Ota T.... Sugano S. (2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 100129543 HGNC: 32470 Ensembl:ENSG00000183850 euGenes: HUgn100129543 ECgene: ZNF730
    H-InvDB: ZNF730

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ZNF730 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ZNF730 gene:
    Search GeneIP for patents involving ZNF730

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   Browse OriGene shRNA RFPs  
     Browse OriGene 29mer shRNA kits in GFP-retroviral vector   Browse OriGene genome-wide validated SYBR primer pairs  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     Browse OriGene siRNAs   Browse 3'-UTR reporter clones for miRNA target validation  
     Browse OriGene untagged cDNA clones in CMV expression vector   Browse OriGene Myc/DDK tagged cDNA clones in CMV expression vector  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ZNF730   OriGene Custom Protein Services for ZNF730  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ZNF730
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF730
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF730
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF730
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF730
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF730
     GenScript Custom Purified and Recombinant Proteins Services for ZNF730 GenScript cDNA clones with any tag delivered in your preferred vector for ZNF730
     GenScript Custom Assay Services for ZNF730 GenScript Custom Superior Antibodies Services for ZNF730
     GenScript Custom overexpressing Cell Line Services for ZNF730 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ZNF730 promoter
     Search Chromatin IP Primers for ZNF730
     RT2 qPCR Primer Assay in human, mouse / rat ZNF730
     Search GNC Networks for ZNF730
     SABiosciences Custom PCR Arrays for ZNF730
     Search Tocris compounds for ZNF730
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Biologicals
     Novus Tissue Slides
     Search for Antibodies for ZNF730 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for ZNF730
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     ZNF730 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for ZNF730
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF730
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ZNF730
     Browse SwitchGear Promoter luciferase reporter plasmids for ZNF730
     Search ThermoFisher Antibodies for ZNF730
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat ZNF730
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ZNF730
    Sirion Biotech Customized:
     stable knockdown cell line services for ZNF730
     inducible knockdown cell line services for ZNF730
     design and validation of potent shRNA sequences against ZNF730
     adenovirus for potent knockdown of ZNF730
     adenovirus for overexpression of ZNF730
     stable overexpressing cell line services for ZNF730
     inducible overexpressing cell line services for ZNF730
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ZNF730 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4