Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

ZNF610 Gene

protein-coding GIFtS: 46
GCID: GC19P052839

Zinc Finger Protein 610

Search for ZNF610
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Zinc Finger Protein 610¹ ²
Zink Finger Protein²

External Ids:	HGNC: 26687¹	Entrez Gene: 162963²	Ensembl: ENSG00000167554⁷	UniProtKB: Q8N9Z0³

Export aliases for ZNF610 gene to outside databases

Previous GC identifers: GC19P057540 GC19P049169

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for ZNF610 Gene:

ZNF610 (zinc finger protein 610) is a protein-coding gene. Among its related super-pathways are Gene Expression. GO annotations related to this gene include DNA binding and zinc ion binding. An important paralog of this gene is ZNF534.

UniProtKB/Swiss-Prot: ZN610_HUMAN, Q8N9Z0

Function: May be involved in transcriptional regulation

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000019.9 NC_018930.2 NT_011109.16

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the ZNF610 gene promoter:
HTF ATF6
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: ZNF610 promoter sequence

Search SABiosciences Chromatin IP Primers for ZNF610

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF610

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.41 Ensembl cytogenetic band: 19q13.41 HGNC cytogenetic band: 19q13.41

ZNF610 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ZNF610 gene location

GeneLoc information about chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19P052839: view genomic region (about GC identifiers)

Start:	52,839,498 bp from pter	End:	52,871,031 bp from pter
Size:	31,534 bases	Orientation:	plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: ZN610_HUMAN, Q8N9Z0 (See protein sequence)

Recommended Name: Zinc finger protein 610

Size: 462 amino acids; 53489 Da

Subcellular location: Nucleus (Probable)

Secondary accessions: A8K4C3 Q86YH8 Q8NDS9

Alternative splicing: 2 isoforms: Q8N9Z0-1 Q8N9Z0-2 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ZNF610: NX_Q8N9Z0

Explore proteomics data for ZNF610 at MOPED

Post-translational modifications:

View modification sites using PhosphoSitePlus

View neXtProt modification sites for NX_Q8N9Z0

ZNF610 Protein expression data from MOPED¹, PaxDb² and MAXQB³ : About this image

REFSEQ proteins (4 alternative transcripts):

NP_001154897.1 NP_001154898.1 NP_001154899.1 NP_775801.2

ENSEMBL proteins:

ENSP00000324441 ENSP00000383922 ENSP00000471021 ENSP00000469935 ENSP00000327597

Reactome Protein details: Q8N9Z0
Human Recombinant Protein Products for ZNF610:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells Browse OriGene Protein Over-expression Lysates OriGene Custom MassSpec OriGene Custom Protein Services for ZNF610
	GenScript Custom Purified and Recombinant Proteins Services for ZNF610
	Novus Biologicals ZNF610 Protein
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for ZNF610

Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005622	intracellular	--	--
GO:0005634	nucleus	IEA	--

ZNF610 for ontologies About GeneDecksing

ZNF610 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for ZNF610
	GenScript Custom Superior Antibodies Services for ZNF610
	Novus Biologicals ZNF610 Antibodies
	Abcam antibodies for ZNF610
	Cloud-Clone Corp. Antibodies for ZNF610
	Search ThermoFisher Antibodies for ZNF610
	LSBio Antibodies in human, mouse, rat for ZNF610

Assay Products for ZNF610:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for ZNF610
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for ZNF610
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for ZNF610 Cloud-Clone Corp. CLIAs for ZNF610

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

HGNC Gene Families:

ZNF: Zinc fingers, C2H2-type

4 InterPro protein domains:

IPR015880 Znf_C2H2-like

IPR001909 Krueppel-associated_box

IPR013087 Znf_C2H2/integrase_DNA-bd

IPR007087 Znf_C2H2

Graphical View of Domain Structure for InterPro Entry Q8N9Z0

ProtoNet protein and cluster: Q8N9Z0

2 Blocks protein domains:

IPB001909 KRAB box

IPB007086 C2H2-type zinc finger signature

UniProtKB/Swiss-Prot: ZN610_HUMAN, Q8N9Z0

Similarity: Belongs to the krueppel C2H2-type zinc-finger protein family

Similarity: Contains 9 C2H2-type zinc fingers

Similarity: Contains 1 KRAB domain

ZNF610 for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: ZN610_HUMAN, Q8N9Z0

Function: May be involved in transcriptional regulation

Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003676	nucleic acid binding	--	--
GO:0003677	DNA binding	IEA	--
GO:0008270	zinc ion binding	--	--
GO:0046872	metal ion binding	IEA	--

ZNF610 for ontologies About GeneDecksing

Animal Models:

inGenious Targeting Laboratory - Custom generated mouse model solutions for ZNF610

inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ZNF610

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ZNF610

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ZNF610

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF610
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF610
		Browse SwitchGear 3'UTR luciferase reporter plasmids

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for ZNF610
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF610

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for ZNF610
			Sirion Biotech Customized adenovirus for overexpression of ZNF610

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene clones in human, mouse for ZNF610 (see all 23) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 4): ZNF610 (NM_173530)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF610
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZNF610
		Sirion Biotech Customized lentivirus for stable overexpression of ZNF610 Customized lentivirus expression plasmids for stable overexpression of ZNF610

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for ZNF610
		Search LifeMap BioReagents cell lines for ZNF610

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF610

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section

SuperPaths for ZNF610 About

See pathways by source

SuperPath

Contained pathways About

Generic Transcription Pathway

Generic Transcription Pathway

0.47

Gene Expression

0.47

Pathways by source See SuperPaths
Show all pathways

2 Reactome Pathways for ZNF610

	Generic Transcription Pathway
	Gene Expression

ZNF610 for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for ZNF610

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006351	transcription, DNA-dependent	IEA	--
GO:0006355	regulation of transcription, DNA-dependent	IEA	--

ZNF610 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for ZNF610 (ZN610)

Search CenterWatch for drugs/clinical trials and news about ZNF610 / ZN610

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for ZNF610 gene (4 alternative transcripts):

NM_001161425.1 NM_001161426.1 NM_001161427.1 NM_173530.2

Unigene Cluster for ZNF610:

Zinc finger protein 610

Hs.147025 [show with all ESTs]

Unigene Representative Sequence: BC039903

7 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000321287(uc002pyz.4) ENST00000599508 ENST00000403906(uc002pyx.4 uc002pyy.4)

ENST00000601151 ENST00000594919 ENST00000593698 ENST00000327920(uc002pza.3)

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZNF610
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ZNF610
		Browse SwitchGear 3'UTR luciferase reporter plasmids

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for ZNF610
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF610

Clone Products:		OriGene clones in human, mouse for ZNF610 (see all 23) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 4): ZNF610 (NM_173530)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF610
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZNF610
		Sirion Biotech Customized lentivirus for stable overexpression of ZNF610 Customized lentivirus expression plasmids for stable overexpression of ZNF610

Primer Products:		OriGene qPCR primer pairs and template standards for ZNF610 OriGene qSTAR qPCR primer pairs in human, mouse for ZNF610
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat ZNF610
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF610
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF610

Additional mRNA sequence:

AK093359.1 AK290888.1 AL831871.1 BC039903.2 BC105967.1

6 DOTS entries:

DT.100754443 DT.206155 DT.121450832 DT.91872979 DT.100795739 DT.121450828

24/32 AceView cDNA sequences (see all 32):

BQ787421 BQ437307 AI160765 CA397023 BQ437257 AI031846 CD642256 AX748076

AL831871 BQ217234 AK093359 AA973137 BX111252 AI334229 H84134 AA584209

BX509697 BU070401 BV188958 AA774749 AA758974 BC039903 NM_173530 AI471112

GeneLoc Exon Structure

3 Alternative Splicing Database (ASD) splice patterns (SP) for ZNF610 About this scheme

ExUns:	1a	·	1b	^	2	^	3	^	4a	·	4b	^	5a	·	5b
SP1:			-
SP2:									-		-
SP3:

ECgene alternative splicing isoforms for ZNF610

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

ZNF610 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: TTTTAAGTAA

About this image

See ZNF610 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for ZNF610

SOURCE GeneReport for Unigene cluster: Hs.147025

SABiosciences Custom PCR Arrays for ZNF610

Primer Products:		OriGene qPCR primer pairs and template standards for ZNF610 OriGene qSTAR qPCR primer pairs in human, mouse for ZNF610
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat ZNF610
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF610
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF610

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF610

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of mammals.

Orthologs for ZNF610 gene from 1/2 species (see all 2) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
oppossum (Monodelphis domestica)	Mammalia	--	Uncharacterized protein	14(a)	1 → many	3(499651101-499749292)

ENSEMBL Gene Tree for ZNF610 (if available)
TreeFam Gene Tree for ZNF610 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for ZNF610 gene

ZNF534² ZNF321P² ZNF468² ZNF578² ZNF880² ZNF766² ZNF320² ZNF525²

ZNF860² ZNF415² ZNF28² ZNF528² ZNF611² ZNF677² ZNF83² ZNF816²

ZNF701² ZNF765² ZNF480² ZNF813²

18/499 SIMAP similar genes for ZNF610 using alignment to 2 protein entries: ZN610_HUMAN (see all proteins) (see all similar genes):

ZNF880 kr-znf3 ZNF766 ZNF528 ZNF721 ZNF83

ZNF78L1 ZNF534 ZNF616 ZNF677 ZNF480 ZNF836

ZNF320 HZF30 ZFS-6 ZNF611 DKFZp686M04222 DKFZp762K012

ZNF610 for paralogs About GeneDecksing

2 Pseudogenes.org Pseudogenes for ZNF610
PGOHUM00000234752 PGOHUM00000238039

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs189105945^1,2		--	52837549(+)	`GATCAA/CGAGGT`	3	--	us2k¹		0	--	--	--	--
rs71180442^1,2	C	--	52837637(-)	`AGGCA-/AAGTTTTGTATTTT/CGTGCCACCATGCCTGGC TAAGTTTTGTATTTT/TGGCTAAGTTTTGTATTTTCGTGC`	6	--	us2k¹ cds¹		1		NA	2
rs181489273^1,2	C	--	52837654(+)	`CCAGCC/TACTCG`	3	--	us2k¹		0	--	--	--	--
rs184261657^1,2		--	52837658(+)	`CTACTC/TGGGAG`	3	--	us2k¹		0	--	--	--	--
rs321924^1,2	C,F,H	--	52837682(-)	`ttcaaG/Ccaatt`	3	--	us2k¹		2		NA	4
rs321923^1,2	C,F,H	--	52837722(-)	`gtggcA/Gcaatc`	3	--	us2k¹		3		NA	6
rs321922^1,2	C,F,H	--	52837759(-)	`agacaG/Aagtct`	3	--	us2k¹		3		NA WA	6
rs145352931^1,2	C	--	52837767(+)	`TCTCA-/AAAAT AAAAT`	3	--	us2k¹		0	--	--	--	--
rs7256570^1,2	C,A,H	--	52837800(+)	`AAATTC/AAATGA`	3	--	us2k¹		8		NA WA CSA EA	367
rs181224224^1,2		--	52837813(+)	`ATTGAC/TTGGAA`	3	--	us2k¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for ZNF610 (52839498 - 52871031 bp)

Structural Variations
Database of Genomic Variants (DGV) 9 variations for ZNF610: About this table

Variant ID	Type	Subtype	PubMed ID
esv2600634	CNV	Deletion	19546169
esv2671354	CNV	Deletion	23128226
esv2660483	CNV	Deletion	23128226
nsv458742	CNV	Loss	19166990
dgv3979n71	CNV	Loss	21882294
dgv3978n71	CNV	Loss	21882294
nsv2536	CNV	Loss	18451855
nsv833873	CNV	Gain	17160897
esv21813	CNV	Gain	19812545

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF610

DNA2.0 Custom Variant and Variant Library Synthesis for ZNF610

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for ZNF610 gene integrated from 9 sources:
(articles sorted by number of sources associating them with ZNF610)

Utopia: connect your pdf to the dynamic
world of online information

The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (2004)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)^{1, 3} Strausberg R.L....Marra M.A. (2002)
Methods for quantification of in vivo changes in prote in ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)¹ Udeshi N.D....Carr S.A. (2012)
A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)¹ Wagner S.A....Choudhary C. (2011)
The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)² Bechtel S.... Schupp I. (2007)
Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)¹ Kimura K.... Sugano S. (2006)
The DNA sequence and biology of human chromosome 19. (PubMed id 15057824)² Grimwood J.... Lucas S.M. (2004)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 162963	HGNC: 26687	AceView: ZNF610	Ensembl:ENSG00000167554	euGenes: HUgn162963
ECgene: ZNF610	H-InvDB: ZNF610

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for ZNF610	Pharmacogenomics, SNPs, Pathways

Intellectual Property for ZNF610 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for ZNF610 gene:
Search GeneIP for patents involving ZNF610

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Protease Activity Assays and Reagents		Browse Recombinant/Natural Proteins
	Browse Stem Cell Products		Browse Tocris Biochemicals & Compounds
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	Browse OriGene Antibodies		OriGene RNAi products in human, mouse, rat for ZNF610
	OriGene qPCR primer pairs and template standards for ZNF610		Browse OriGene Protein Over-expression Lysates
	OriGene Custom Mass Spec		OriGene clones in human, mouse for ZNF610
	OriGene qSTAR qPCR primer pairs in human, mouse for ZNF610		Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
	Browse OriGene ORF clones		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for ZNF610		OriGene Custom Protein Services for ZNF610

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ZNF610
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZNF610
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZNF610
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZNF610
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZNF610
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZNF610

	GenScript Custom Purified and Recombinant Proteins Services for ZNF610		GenScript cDNA clones with any tag delivered in your preferred vector for ZNF610
	GenScript Custom Assay Services for ZNF610		GenScript Custom Superior Antibodies Services for ZNF610
	GenScript Custom overexpressing Cell Line Services for ZNF610		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in ZNF610 promoter
	Search Chromatin IP Primers for ZNF610
	RT² qPCR Primer Assay in human, mouse / rat ZNF610
	Search GNC Networks for ZNF610
	SABiosciences Custom PCR Arrays for ZNF610

Search Tocris compounds for ZNF610 (ZN610)

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	ZNF610 antibodies
	ZNF610 proteins

	Antibodies for ZNF610
	See all of Abcam's Antibodies, Kits and Proteins for ZNF610
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for ZNF610
	Antibodies for ZNF610
	ELISAs for ZNF610
	CLIAs for ZNF610

Search LifeMap BioReagents cell lines for ZNF610

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF610

	Browse SwitchGear 3'UTR luciferase reporter plasmids for ZNF610
	SwitchGear Promoter luciferase reporter plasmids for ZNF610

Search ThermoFisher Antibodies for ZNF610

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZNF610

	inGenious Targeting Laboratory - Custom generated mouse model solutions for ZNF610
	inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ZNF610

Customized:

	lentivirus for stable overexpression of ZNF610
	lentivirus expression plasmids for stable overexpression of ZNF610
	adenovirus for overexpression of ZNF610

LSBio Antibodies in human, mouse, rat for ZNF610

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category			TGFB1 (GIFtS: 73) transforming growth factor, beta 1
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes ZNF610 gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

ZNF610 Gene

Zinc Finger Protein 610

Aliases
for ZNF610 gene

Summaries
for ZNF610 gene

Genomic Views
for ZNF610 gene

Proteins
for ZNF610 gene

Protein Domains /
Families
for ZNF610 gene

Function
for ZNF610 gene

Pathways & Interactions
for ZNF610 gene

Drugs & Compounds
for ZNF610 gene

Transcripts
for ZNF610 gene

Expression
for ZNF610 gene

Orthologs
for ZNF610 gene

Paralogs
for ZNF610 gene

Genomic Variants
for ZNF610 gene

Disorders / Diseases
for ZNF610 gene

Publications
for ZNF610 gene

External Searches for ZNF610 gene

Genome Databases showing ZNF610 gene

Other Databases showing ZNF610 gene

Specialized Databases showing ZNF610 gene

Intellectual Property
for ZNF610 gene

Products
for ZNF610 gene

View Random Gene

Advanced Search

Export list of displayed genes

ZNF610 Gene

Zinc Finger Protein 610

Aliasesfor ZNF610 gene

Summariesfor ZNF610 gene

Genomic Viewsfor ZNF610 gene

Proteinsfor ZNF610 gene

Protein Domains /Familiesfor ZNF610 gene

Functionfor ZNF610 gene

Pathways & Interactionsfor ZNF610 gene

Drugs & Compoundsfor ZNF610 gene

Transcriptsfor ZNF610 gene

Expression for ZNF610 gene

Orthologsfor ZNF610 gene

Paralogsfor ZNF610 gene

Genomic Variantsfor ZNF610 gene

Disorders / Diseasesfor ZNF610 gene

Publicationsfor ZNF610 gene

External Searches for ZNF610 gene

Genome Databases showing ZNF610 gene

Other Databases showing ZNF610 gene

Specialized Databases showing ZNF610 gene

Intellectual Propertyfor ZNF610 gene

Productsfor ZNF610 gene

View Random Gene

Aliases
for ZNF610 gene

Summaries
for ZNF610 gene

Genomic Views
for ZNF610 gene

Proteins
for ZNF610 gene

Protein Domains /
Families
for ZNF610 gene

Function
for ZNF610 gene

Pathways & Interactions
for ZNF610 gene

Drugs & Compounds
for ZNF610 gene

Transcripts
for ZNF610 gene

Expression
for ZNF610 gene

Orthologs
for ZNF610 gene

Paralogs
for ZNF610 gene

Genomic Variants
for ZNF610 gene

Disorders / Diseases
for ZNF610 gene

Publications
for ZNF610 gene

Intellectual Property
for ZNF610 gene

Products
for ZNF610 gene