ZNF610 Gene

Aliases
for ZNF610 gene

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Previous GC identifers: GC19P057540 GC19P049169

Summaries
for ZNF610 gene

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Genomic Views
for ZNF610 gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:

NC_000019.9  NC_018930.2  NT_011109.17  

SwitchGear Promoter luciferase reporter plasmid: ZNF610 promoter sequence

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ZNF610

ZNF610 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)


GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P052839:  view genomic region     (about GC identifiers)

Proteins
for ZNF610 gene

(According to ¹UniProtKB, HORDE, ²neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

Explore the universe of human proteins at neXtProt for ZNF610: NX_Q8N9Z0

Explore proteomics data for ZNF610 at MOPED

Post-translational modifications: 

ZNF610 Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells Browse OriGene Protein Over-expression Lysates OriGene Custom MassSpec OriGene Custom Protein Services for ZNF610
	GenScript Custom Purified and Recombinant Proteins Services for ZNF610
	Novus Biologicals ZNF610 Protein
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for ZNF610
	Search eBioscience for Proteins for ZNF610
	Search GeneTex for Proteins for ZNF610
	antibodies-online proteins for ZNF610
	antibodies-online peptides for ZNF610

ZNF610 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for ZNF610
	Novus Biologicals ZNF610 Antibodies
	Abcam antibodies for ZNF610
	Cloud-Clone Corp. Antibodies for ZNF610
	Search ThermoFisher Antibodies for ZNF610
	antibodies-online antibodies for ZNF610 (6 products)

ZNF610 Assay Products:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for ZNF610
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for ZNF610
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for ZNF610 Cloud-Clone Corp. CLIAs for ZNF610
	Search eBioscience for ELISAs for ZNF610
	antibodies-online kits for ZNF610 (2 products)

Domains /
Families
for ZNF610 gene

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
About This Section

ProtoNet protein and cluster: Q8N9Z0

Find genes that share domains with ZNF610           About GenesLikeMe

Function
for ZNF610 gene

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

     Gene Ontology (GO): 3 molecular function terms:    About this table

genOway: Develop your customized and physiologically relevant rodent model for ZNF610

miRNA Products:		Block miRNA regulation of human, mouse, rat ZNF610 using miScript Target Protectors
		Search for qRT-PCR Assays for microRNAs that regulate ZNF610
		Browse SwitchGear 3'UTR luciferase reporter plasmids

Inhib. RNA Products:		OriGene RNAi products in human, mouse, rat for ZNF610
		Predesigned siRNA for gene silencing in human, mouse, rat ZNF610

Gene Editing Products:

DNA2.0 Custom Protein Engineering Service for ZNF610

Clone Products:		OriGene clones in human, mouse for ZNF610 (see all 21) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 4): ZNF610 (NM_173530)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZNF610
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZNF610

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for ZNF610
		Browse ESI BIO Cell Lines and PureStem Progenitors for ZNF610

In Situ Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF610

Localization
for ZNF610 gene

(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

Subcellular locations from COMPARTMENTS: 

Compartment	Confidence
nucleus	4
cytosol	1
endoplasmic reticulum	1
mitochondrion	1
peroxisome	1

About this image

Gene Ontology (GO): 2 cellular component terms:    About this table

Pathways & Interactions
for ZNF610 gene

(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

SuperPaths for ZNF610 About     See pathways by source

Powered by

	SuperPath	Contained pathways About
1	Gene Expression	Generic Transcription Pathway 0.40 Gene Expression 0.40

1 Reactome Pathway for ZNF610

Generic Transcription Pathway

Gene Ontology (GO): 2 biological process terms:    About this table

Drugs & Compounds
for ZNF610 gene

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
About This Section

Transcripts
for ZNF610 gene

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
About This Section

Expression
for ZNF610 gene

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

ZNF610 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: TTTTAAGTAA

About this image

Primer Products:		OriGene qPCR primer pairs and template standards for ZNF610 OriGene qSTAR qPCR primer pairs in human, mouse for ZNF610
		Pre-validated RT2 qPCR Primer Assay in human, mouse / rat ZNF610
		QuantiTect SYBR Green Assays in human, mouse, rat ZNF610
		QuantiFast Probe-based Assays in human, mouse, rat ZNF610

In Situ Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZNF610

Orthologs
for ZNF610 gene

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

Paralogs
for ZNF610 gene

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68,Sets of similar genes according to GenesLikeMe)
About This Section

Paralogs for ZNF610 gene

ZNF534²  ZNF321P²  ZNF468²  ZNF578²  ZNF880²  ZNF766²  ZNF320²  ZNF525²  

ZNF860²  ZNF415²  ZNF600²  ZNF28²  ZNF528²  ZNF611²  ZNF677²  ZNF83²  

ZNF816²  ZNF701²  ZNF765²  ZNF480²  ZNF813²  

Selected SIMAP similar genes for ZNF610 using alignment to 2 protein entries:     ZN610_HUMAN (see all proteins) (see all similar genes):

ZNF880    kr-znf3    ZNF766    ZNF528    ZNF721    ZNF83

ZNF78L1    ZNF616    ZNF534    ZNF677    ZNF480    ZNF320

HZF30    ZFS-6    ZNF836    ZNF611    DKFZp686M04222    DKFZp762K012

Find genes that share paralogs with ZNF610           About GenesLikeMe


2 Pseudogenes.org Pseudogenes for ZNF610
PGOHUM00000234752 PGOHUM00000238039

Genomic Variants
for ZNF610 gene

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

Selected SNPs for ZNF610 (see all 841)    About this table

Genomic Data					Transcription Related Data				Allele Frequencies
SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
-1st2nd3rd	-1st2nd3rd	-1st2nd3rd	-1st2nd3rd	--	--	--	-1st2nd3rd	--	--	-1st2nd3rd	-1st2nd3rd	-1st2nd3rd
rs1891059451,2		--	52837549(+)	GATCAA/CGAGGT	3	--	us2k1		0	--	--	--	--
rs711804421,2	C	--	52837637(-)	AGGCA-/AAGTTTTGTATTTT/CGTGCCACCATGCCTGGC TAAGTTTTGTATTTT/TGGCTAAGTTTTGTATTTTCGTGC	6	--	us2k1 cds1		1		NA	2
rs1814892731,2	C	--	52837654(+)	CCAGCC/TACTCG	3	--	us2k1		0	--	--	--	--
rs1842616571,2		--	52837658(+)	CTACTC/TGGGAG	3	--	us2k1		0	--	--	--	--
rs3219241,2	C,F,H	--	52837682(-)	ttcaaG/Ccaatt	3	--	us2k1		2		NA	4
rs3219231,2	C,F,H	--	52837722(-)	gtggcA/Gcaatc	3	--	us2k1		3		NA	6
rs3219221,2	C,F,H	--	52837759(-)	agacaG/Aagtct	3	--	us2k1		3		NA WA	6
rs1453529311,2	C	--	52837767(+)	TCTCA-/AAAAT          AAAAT	3	--	us2k1		0	--	--	--	--
rs72565701,2	C,A,H	--	52837800(+)	AAATTC/AAATGA	3	--	us2k1		8		NA WA CSA EA	367
rs1812242241,2		--	52837813(+)	ATTGAC/TTGGAA	3	--	us2k1		0	--	--	--	--

HapMap Linkage Disequilibrium report for ZNF610 (52839498 - 52871031 bp)

Structural Variations
     Database of Genomic Variants (DGV) 9 variations for ZNF610:    About this table    

Variant ID	Type	Subtype	PubMed ID
esv2600634	CNV	Deletion	19546169
esv2671354	CNV	Deletion	23128226
esv2660483	CNV	Deletion	23128226
nsv458742	CNV	Loss	19166990
dgv3979n71	CNV	Loss	21882294
dgv3978n71	CNV	Loss	21882294
nsv2536	CNV	Loss	18451855
nsv833873	CNV	Gain	17160897
esv21813	CNV	Gain	19812545

Site Specific Mutation Identification with PCR Assays

SeqTarget long-range PCR primers for resequencing ZNF610

DNA2.0 Custom Variant and Variant Library Synthesis for ZNF610

Disorders / Diseases
for ZNF610 gene

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB, Sets of similar genes according to GenesLikeMe)
About This Section

Publications
for ZNF610 gene

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S.... Malek J. (Genome Res. 2004)
2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (Nat. Genet. 2004)
3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)^{1, 3} Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
4. Pathway Analysis of ChIP-Seq-Based NRF1 Target Genes Suggests a Logical Hypothesis of their Involvement in the Pathogenesis of Neurodegenerative Diseases. (PubMed id 24250222)¹ Satoh J....Yamamoto Y. (Gene Regul Syst Bio 2013)
5. Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)¹ Udeshi N.D....Carr S.A. (amp 2012)
6. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. (PubMed id 21890473)¹ Wagner S.A....Choudhary C. (amp 2011)
7. The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)² Bechtel S.... Schupp I. (BMC Genomics 2007)
8. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)¹ Kimura K.... Sugano S. (Genome Res. 2006)
9. The DNA sequence and biology of human chromosome 19. (PubMed id 15057824)² Grimwood J.... Lucas S.M. (Nature 2004)

External Searches for ZNF610 gene

Genome Databases showing ZNF610 gene

Other Databases showing ZNF610 gene

Specialized Databases showing ZNF610 gene

Products
for ZNF610 gene

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, GeneTex, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from genOway)
About This Section