Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZMYND19 Gene

Aliases for ZMYND19 Gene

  • Zinc Finger MYND-Type Containing 19 2 3
  • Melanin-Concentrating Hormone Receptor 1-Interacting Zinc Finger Protein 3 4
  • MCH-R1-Interacting Zinc Finger Protein 3 4
  • Zinc Finger, MYND-Type Containing 19 3 5
  • MIZIP 3 4
  • Melanin-Concentrating Hormone Receptor 1 Interacting Zinc-Finger Protein 3
  • Zinc Finger, MYND Domain Containing 19 3

External Ids for ZMYND19 Gene

Previous GeneCards Identifiers for ZMYND19 Gene

  • GC09M133778
  • GC09M135695
  • GC09M137752
  • GC09M139596
  • GC09M140476
  • GC09M109938

Summaries for ZMYND19 Gene

Entrez Gene Summary for ZMYND19 Gene

  • ZMYND19 is a MYND zinc finger domain-containing protein that binds to the C terminus of melanin-concentrating hormone receptor-1 (MCHR1; MIM 601751) (Bachner et al., 2002 [PubMed 12208518]), and to the N termini of alpha-tubulin (TUBA1; MIM 191110), and beta-tubulin (TUBB; MIM 191130) (Francke et al., 2005 [PubMed 16039987]).[supplied by OMIM, Mar 2008]

GeneCards Summary for ZMYND19 Gene

ZMYND19 (Zinc Finger MYND-Type Containing 19) is a Protein Coding gene.

UniProtKB/Swiss-Prot for ZMYND19 Gene

  • May be involved as a regulatory molecule in GPR24/MCH-R1 signaling.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZMYND19 Gene

Genomics for ZMYND19 Gene

Regulatory Elements for ZMYND19 Gene

Promoters for ZMYND19 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around ZMYND19 on UCSC Golden Path with GeneCards custom track

Genomic Location for ZMYND19 Gene

Chromosome:
9
Start:
137,582,076 bp from pter
End:
137,590,490 bp from pter
Size:
8,415 bases
Orientation:
Minus strand

Genomic View for ZMYND19 Gene

Genes around ZMYND19 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZMYND19 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZMYND19 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZMYND19 Gene

Proteins for ZMYND19 Gene

  • Protein details for ZMYND19 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96E35-ZMY19_HUMAN
    Recommended name:
    Zinc finger MYND domain-containing protein 19
    Protein Accession:
    Q96E35
    Secondary Accessions:
    • Q5T366

    Protein attributes for ZMYND19 Gene

    Size:
    227 amino acids
    Molecular mass:
    26433 Da
    Quaternary structure:
    • Interacts with GPR24/MCH-R1.

neXtProt entry for ZMYND19 Gene

Proteomics data for ZMYND19 Gene at MOPED

Post-translational modifications for ZMYND19 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ZMYND19 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ZMYND19 Gene

Domains & Families for ZMYND19 Gene

Gene Families for ZMYND19 Gene

Protein Domains for ZMYND19 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for ZMYND19 Gene

Graphical View of Domain Structure for InterPro Entry

Q96E35

UniProtKB/Swiss-Prot:

ZMY19_HUMAN :
  • Contains 1 MYND-type zinc finger.
Similarity:
  • Contains 1 MYND-type zinc finger.
genes like me logo Genes that share domains with ZMYND19: view

Function for ZMYND19 Gene

Molecular function for ZMYND19 Gene

UniProtKB/Swiss-Prot Function:
May be involved as a regulatory molecule in GPR24/MCH-R1 signaling.

Gene Ontology (GO) - Molecular Function for ZMYND19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
genes like me logo Genes that share ontologies with ZMYND19: view

Phenotypes for ZMYND19 Gene

genes like me logo Genes that share phenotypes with ZMYND19: view

Animal Model Products

CRISPR Products

miRNA for ZMYND19 Gene

miRTarBase miRNAs that target ZMYND19

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for ZMYND19 Gene

Localization for ZMYND19 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ZMYND19 Gene

Cytoplasm. Cell membrane; Peripheral membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for ZMYND19 Gene COMPARTMENTS Subcellular localization image for ZMYND19 gene
Compartment Confidence
nucleus 3
plasma membrane 3
cytosol 2
golgi apparatus 2
extracellular 1
mitochondrion 1

Gene Ontology (GO) - Cellular Components for ZMYND19 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005886 plasma membrane IEA --
GO:0045202 synapse IEA --
genes like me logo Genes that share ontologies with ZMYND19: view

Pathways & Interactions for ZMYND19 Gene

SuperPathways for ZMYND19 Gene

No Data Available

Gene Ontology (GO) - Biological Process for ZMYND19 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for ZMYND19 Gene

Drugs & Compounds for ZMYND19 Gene

No Compound Related Data Available

Transcripts for ZMYND19 Gene

mRNA/cDNA for ZMYND19 Gene

Unigene Clusters for ZMYND19 Gene

Zinc finger, MYND-type containing 19:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ZMYND19 Gene

No ASD Table

Relevant External Links for ZMYND19 Gene

GeneLoc Exon Structure for
ZMYND19
ECgene alternative splicing isoforms for
ZMYND19

Expression for ZMYND19 Gene

mRNA expression in normal human tissues for ZMYND19 Gene

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for ZMYND19 Gene



SOURCE GeneReport for Unigene cluster for ZMYND19 Gene Hs.128096

mRNA Expression by UniProt/SwissProt for ZMYND19 Gene

Q96E35-ZMY19_HUMAN
Tissue specificity: Expressed in brain, testis, placenta, heart, liver, skeletal muscle, kidney and stomach.
genes like me logo Genes that share expression patterns with ZMYND19: view

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues and Protein tissue co-expression partners for ZMYND19 Gene

Orthologs for ZMYND19 Gene

This gene was present in the common ancestor of chordates.

Orthologs for ZMYND19 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ZMYND19 35
  • 94.12 (n)
  • 91.86 (a)
ZMYND19 36
  • 95 (a)
OneToOne
cow
(Bos Taurus)
Mammalia ZMYND19 36
  • 94 (a)
OneToOne
ZMYND19 35
  • 88.31 (n)
  • 94.79 (a)
dog
(Canis familiaris)
Mammalia ZMYND19 35
  • 88.63 (n)
  • 97.63 (a)
ZMYND19 36
  • 92 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Zmynd19 36
  • 100 (a)
OneToOne
Zmynd19 16
Zmynd19 35
  • 90.16 (n)
  • 100 (a)
oppossum
(Monodelphis domestica)
Mammalia ZMYND19 36
  • 97 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ZMYND19 36
  • 71 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Zmynd19 35
  • 89.43 (n)
  • 100 (a)
chicken
(Gallus gallus)
Aves ZMYND19 36
  • 94 (a)
OneToOne
ZMYND19 35
  • 83.99 (n)
  • 94.71 (a)
lizard
(Anolis carolinensis)
Reptilia ZMYND19 36
  • 84 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia Xl.12777 35
tropical clawed frog
(Silurana tropicalis)
Amphibia zmynd19 35
  • 75.62 (n)
  • 85.46 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.10614 35
zebrafish
(Danio rerio)
Actinopterygii zmynd19 36
  • 81 (a)
OneToOne
zmynd19 35
  • 71.95 (n)
  • 80.18 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.2680 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4875 36
  • 49 (a)
OneToOne
Species with no ortholog for ZMYND19:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ZMYND19 Gene

ENSEMBL:
Gene Tree for ZMYND19 (if available)
TreeFam:
Gene Tree for ZMYND19 (if available)

Paralogs for ZMYND19 Gene

Pseudogenes.org Pseudogenes for ZMYND19 Gene

genes like me logo Genes that share paralogs with ZMYND19: view

No data available for Paralogs for ZMYND19 Gene

Variants for ZMYND19 Gene

Sequence variations from dbSNP and Humsavar for ZMYND19 Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
rs7030525 -- 137,588,722(+) GTCTG(A/G)AAGTT intron-variant
rs6151226 -- 137,583,635(-) CAGTG(-/TCGCTCCAGGGCCTGTTCTGTACAGC)CACAT intron-variant
rs10120250 -- 137,585,446(+) AGGCA(A/G)GAGGA intron-variant
rs11137137 -- 137,588,721(+) GGTCT(A/G)GAAGT intron-variant
rs11137138 -- 137,591,882(+) cgagg(C/T)gggca upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for ZMYND19 Gene

Variant ID Type Subtype PubMed ID
nsv894387 CNV Gain 21882294
dgv8412n71 CNV Loss 21882294
nsv894502 CNV Loss 21882294
nsv831762 CNV Loss 17160897
nsv831763 CNV Loss 17160897
dgv8462n71 CNV Loss 21882294

Variation tolerance for ZMYND19 Gene

Residual Variation Intolerance Score: 26.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.45; 9.85% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ZMYND19 Gene

HapMap Linkage Disequilibrium report
ZMYND19

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ZMYND19 Gene

Disorders for ZMYND19 Gene

Relevant External Links for ZMYND19

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ZMYND19

No disorders were found for ZMYND19 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ZMYND19 Gene

Publications for ZMYND19 Gene

  1. MIZIP, a highly conserved, vertebrate specific melanin-concentrating hormone receptor 1 interacting zinc-finger protein. (PMID: 12208518) Baechner D. … Richter D. (FEBS Lett. 2002) 3 4 23 67
  2. MYND domain specific interaction of the melanin-concentrating hormone receptor 1 interacting zinc-finger protein with alpha- and beta-tubulin. (PMID: 16039987) Francke F. … BAochner D. (Biochem. Biophys. Res. Commun. 2005) 3 23
  3. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. Next-generation sequencing to generate interactome datasets. (PMID: 21516116) Yu H. … Vidal M. (Nat. Methods 2011) 3

Products for ZMYND19 Gene

Sources for ZMYND19 Gene

Back to Top

Content