Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

ZFP82 Gene

protein-coding GIFtS: 43
GCID: GC19M036882

ZFP82 zinc finger protein

(Previous names: zinc finger protein 545, zinc finger protein 82 homolog...)
(Previous symbol: ZNF545)

Search for ZFP82
in

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
ZFP82 Zinc Finger Protein¹ ²		Zinc Finger Protein 82 Homolog (Mouse)¹
Zinc Finger Protein 545¹ ² ³		Zfp-82³
ZNF545¹ ² ³		Zinc Finger Protein 82 Homolog²
KIAA1948¹ ³		Zinc Finger Protein 85²
MGC45380¹		Zfp-82³
Zinc Finger Protein 82¹

External Ids:	HGNC: 28682¹	Entrez Gene: 284406²	Ensembl: ENSG00000181007⁷	UniProtKB: Q8N141³

Export aliases for ZFP82 gene to outside databases

Previous GC identifers: GC19M041577 GC19M036874 GC19M033351

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: ZFP82_HUMAN, Q8N141

Function: May be involved in transcriptional regulation

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000019.9 NC_018930.1 NT_011109.16

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the ZFP82 gene promoter:
Elk-1 Pax-5 Tal-1beta LCR-F1 Arnt CREB Pax-3 deltaCREB SEF-1 (1)
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: ZFP82 promoter sequence

Search SABiosciences Chromatin IP Primers for ZFP82

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZFP82

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.12 Ensembl cytogenetic band: 19q13.12 HGNC cytogenetic band: 19q13.13

ZFP82 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ZFP82 gene location

GeneLoc information about chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19M036882: view genomic region (about GC identifiers)

Start:	36,874,022 bp from pter	End:	36,909,558 bp from pter
Size:	35,537 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ZFP82_HUMAN, Q8N141 (See protein sequence)

Recommended Name: Zinc finger protein 82 homolog

Size: 532 amino acids; 62578 Da

Subcellular location: Nucleus (Probable)

Sequence caution: Sequence=BAB85534.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;

Sequence=BAB85534.1; Type=Miscellaneous discrepancy; Note=Probable cloning artifact;

Secondary accessions: Q8NC63 Q8TF53

Explore the universe of human proteins at neXtProt for ZFP82: NX_Q8N141

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q8N141

ZFP82 Protein expression data from MOPED and PaxDb: --

REFSEQ proteins: NP_597723.1

ENSEMBL proteins:

ENSP00000468212 ENSP00000431265 ENSP00000446080

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate: ZFP82 OriGene Custom Protein Services for ZFP82
	GenScript Custom Purified and Recombinant Proteins Services for ZFP82
	Novus Biologicals ZFP82 Protein Novus Biologicals ZFP82 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for ZFP82

Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005622	intracellular	--	--
GO:0005634	nucleus	IEA	--

ZFP82 for ontologies About GeneDecksing

ZFP82 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for ZFP82
	GenScript Custom Superior Antibodies Services for ZFP82
	Novus Biologicals ZFP82 Antibody
	Search for Antibodies for ZFP82 at Abcam
	Uscn Antibodies for ZFP82
	Search ThermoFisher Antibodies for ZFP82

Assay Products for ZFP82:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for ZFP82
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for ZFP82

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

ZFP82 for domains About GeneDecksing

4 InterPro domains/families:

IPR015880 Znf_C2H2-like

IPR001909 Krueppel-associated_box

IPR013087 Znf_C2H2/integrase_DNA-bd

IPR007087 Znf_C2H2

Graphical View of Domain Structure for InterPro Entry Q8N141

ProtoNet protein and cluster: Q8N141

1 Blocks protein family: IPB001909 KRAB box

UniProtKB/Swiss-Prot: ZFP82_HUMAN, Q8N141

Similarity: Belongs to the krueppel C2H2-type zinc-finger protein family

Similarity: Contains 13 C2H2-type zinc fingers

Similarity: Contains 1 KRAB domain

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: ZFP82_HUMAN, Q8N141

Function: May be involved in transcriptional regulation

miRNA Products:		OriGene 3'-UTR Clone: ZFP82 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZFP82
		8 QIAGEN miScript miRNA Assays for microRNAs that regulate ZFP82:
		hsa-miR-548p hsa-miR-181c hsa-miR-545 hsa-miR-181a hsa-miR-3918 hsa-miR-181d hsa-miR-181b hsa-miR-4262

		SwitchGear 3'UTR luciferase reporter plasmid: ZFP82 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZFP82 (see all 4) OriGene shRNA RFP: ZFP82 OriGene siRNA: ZFP82
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZFP82

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for ZFP82

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82 (see all 2) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: ZFP82 (NM_133466)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZFP82
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZFP82

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for ZFP82
		Search LifeMap BioReagents cell lines for ZFP82

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZFP82

Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003676	nucleic acid binding	--	--
GO:0003677	DNA binding	IEA	--
GO:0008270	zinc ion binding	IEA	--

ZFP82 for ontologies About GeneDecksing

1 GenomeRNAi human phenotype for ZFP82:

Increased gamma-H2AX phosphory

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for ZFP82

2 Interacting proteins for ZFP82 (Q8N141³) via UniProtKB, MINT, STRING, and/or I2D

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
CDX1	P47902³	I2D: score=1
EWSR1	Q01844³	I2D: score=1

About this table

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006351	transcription, DNA-dependent	IEA	--
GO:0006355	regulation of transcription, DNA-dependent	IEA	--

ZFP82 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for ZFP82
Search CenterWatch for drugs/clinical trials and news about ZFP82

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for ZFP82 gene:

NM_133466.2

Unigene Cluster for ZFP82:

ZFP82 zinc finger protein

Hs.558734 [show with all ESTs]

Unigene Representative Sequence: AB075828

4 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000445543 ENST00000590993 ENST00000392161(uc002ody.1) ENST00000392171

miRNA Products:		OriGene 3'-UTR Clone: ZFP82 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZFP82
		8 QIAGEN miScript miRNA Assays for microRNAs that regulate ZFP82:
		hsa-miR-548p hsa-miR-181c hsa-miR-545 hsa-miR-181a hsa-miR-3918 hsa-miR-181d hsa-miR-181b hsa-miR-4262

		SwitchGear 3'UTR luciferase reporter plasmid: ZFP82 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZFP82 (see all 4) OriGene shRNA RFP: ZFP82 OriGene siRNA: ZFP82
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZFP82

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82 (see all 2) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: ZFP82 (NM_133466)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZFP82
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZFP82

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZFP82 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat ZFP82
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZFP82
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZFP82

Additional cDNA sequence:

AB075828.1 AK074942.1 AK315709.1 AL834267.1 BC032577.2 GU388429.1

6 DOTS entries:

DT.91976293 DT.100033660 DT.430348 DT.92065518 DT.409430 DT.438951

24/67 AceView cDNA sequences (see all 67):

NM_133466 BE464428 AA485059 AA330257 BX281147 F05578 BX111412 BU147182

F05579 AL834267 AA580143 BU618382 BX491216 BM725016 BG533870 BF679498

F01845 BQ425401 AA682517 AW580908 BE072066 AA777644 AA927918 AI631652

GeneLoc Exon Structure

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

ZFP82 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: AGATATAATA

About this image
Genevestigator expression for ZFP82

SOURCE GeneReport for Unigene cluster: Hs.558734

SABiosciences Custom PCR Arrays for ZFP82

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZFP82 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat ZFP82
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZFP82
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZFP82

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZFP82

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

--

ENSEMBL Gene Tree for ZFP82 (if available)
TreeFam Gene Tree for ZFP82 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for ZFP82 gene

ZNF420² ZNF529² ZFP30² ZNF140² ZNF780A² ZNF383² ZNF790² ZNF582²

ZNF30² ZNF573² ZNF540² ZNF571² ZNF331² ZFP14² ZNF461² ZNF283²

ZNF404² ZNF829² ZNF607² ZNF565² ZNF566² ENSG00000267552²

18/497 SIMAP similar genes for ZFP82 using alignment to 4 protein entries: ZFP82_HUMAN (see all proteins) (see all similar genes):

ZFP30 ZNF818P ZFP14 kr-znf3 MGC12518 POM121C

ZFS-4 ZNF665 ZNF78L1 DKFZp686B16128 ZNF232 HZF36

ZNF107 ZNF721 DKFZp571N1833 DKFZp686H20223 ZFP3 ZNF23

ZFP82 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs116327494^1,2		--	36882390(+)	`TTTTTG/TAGACA`	1	--	int¹		0	--	--	--	--
rs73043866^1,2		--	36882532(+)	`CAGCTA/GATTTT`	1	--	int¹		0	--	--	--	--
rs190829276^1,2		--	36882663(+)	`CTCACC/TTGGTC`	1	--	int¹		0	--	--	--	--
rs181006398^1,2		--	36882781(+)	`GGCATA/TTCTAT`	1	--	int¹		0	--	--	--	--
rs2967517^1,2	C,F,A,H,	--	36882828(+)	`AAAAAG/TAAATA`	1	--	int¹		24		NS EA NA WA CSA	2227
rs5827957^1,2	C,F,	--	36882921(+)	`TGGGCC/-AGGGG`	1	--	ut3¹		4		NA	8
rs113849751^1,2	C	--	36882921(+)	`TTGGGC/GCAGGG`	1	--	ut3¹		0	--	--	--	--
rs186037688^1,2		--	36883095(+)	`CTCTAC/TGTAGT`	1	--	ut3¹		0	--	--	--	--
rs145937527^1,2	C,	--	36883258(+)	`CAGTC-/ACAGAGGGATGT AGATTCCTGTATACAACAGA`	1	--	ut3¹		0	--	--	--	--
rs115070659^1,2		--	36883313(+)	`CTTGAT/CTGAAA`	1	--	ut3¹		1		WA	118

HapMap Linkage Disequilibrium report for ZFP82 (36874022 - 36909558 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for ZFP82: --

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZFP82

DNA2.0 Custom Variant and Variant Library Synthesis for ZFP82

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for ZFP82 gene integrated from 9 sources:
(articles sorted by number of sources associating them with ZFP82)

Utopia: connect your pdf to the dynamic
world of online information

Prediction of the coding sequences of unidentified human genes. XXII. The complete sequences of 50 new cDNA clones which code for large proteins. (PubMed id 11853319)^{1, 2, 3} Nagase T.... Ohara O. (2001)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (2004)
Human POGZ modulates dissociation of HP1alpha from mi totic chromosome arms through Aurora B activation. (PubMed id 20562864)¹ Nozawa R.S....Obuse C. (2010)
The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)² Bechtel S.... Schupp I. (2007)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)¹ Strausberg R.L....Marra M.A. (2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 284406	HGNC: 28682	AceView: ZNF545	Ensembl:ENSG00000181007	euGenes: HUgn284406
ECgene: ZFP82	H-InvDB: ZFP82

(According to HUGE)
About This Section

HUGE: KIAA1948

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for ZFP82	Pharmacogenomics, SNPs, Pathways

Intellectual Property for ZFP82 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for ZFP82 gene:
Search GeneIP for patents involving ZFP82

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for ZFP82
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZFP82		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZFP82
	OriGene Protein Over-expression Lysate for ZFP82		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for ZFP82		OriGene 3'-UTR Clone for ZFP82
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZFP82
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for ZFP82		OriGene Custom Protein Services for ZFP82
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ZFP82
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZFP82
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZFP82
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZFP82
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZFP82
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZFP82

	GenScript Custom Purified and Recombinant Proteins Services for ZFP82		GenScript cDNA clones with any tag delivered in your preferred vector for ZFP82
	GenScript Custom Assay Services for ZFP82		GenScript Custom Superior Antibodies Services for ZFP82
	GenScript Custom overexpressing Cell Line Services for ZFP82		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in ZFP82 promoter
	Search Chromatin IP Primers for ZFP82
	RT² qPCR Primer Assay in human, mouse, rat ZFP82
	Search GNC Networks for ZFP82
	SABiosciences Custom PCR Arrays for ZFP82

Search Tocris compounds for ZFP82

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	ZFP82 antibodies
	ZFP82 proteins
	ZFP82 lysates

	Search for Antibodies for ZFP82 at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for ZFP82
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

ZFP82 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for ZFP82

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZFP82

	SwitchGear 3'UTR luciferase reporter plasmids for ZFP82
	SwitchGear Promoter luciferase reporter plasmids for ZFP82

Search ThermoFisher Antibodies for ZFP82

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZFP82

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes ZFP82 gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

ZFP82 Gene

ZFP82 zinc finger protein

Aliases
for ZFP82 gene

Summaries
for ZFP82 gene

Genomic Views
for ZFP82 gene

Proteins
for ZFP82 gene

Protein Domains /
Families
for ZFP82 gene

Function
for ZFP82 gene

Pathways & Interactions
for ZFP82 gene

Drugs & Compounds
for ZFP82 gene

Transcripts
for ZFP82 gene

Expression
for ZFP82 gene

Orthologs
for ZFP82 gene

Paralogs
for ZFP82 gene

Genomic Variants
for ZFP82 gene

Disorders / Diseases
for ZFP82 gene

Publications
for ZFP82 gene

External Searches for ZFP82 gene

Genome Databases showing ZFP82 gene

Other Databases showing ZFP82 gene

Specialized Databases showing ZFP82 gene

Intellectual Property
for ZFP82 gene

Products
for ZFP82 gene

View Random Gene

Advanced Search

Export list of displayed genes

ZFP82 Gene

ZFP82 zinc finger protein

Aliasesfor ZFP82 gene

Summariesfor ZFP82 gene

Genomic Viewsfor ZFP82 gene

Proteinsfor ZFP82 gene

Protein Domains /Familiesfor ZFP82 gene

Functionfor ZFP82 gene

Pathways & Interactionsfor ZFP82 gene

Drugs & Compoundsfor ZFP82 gene

Transcriptsfor ZFP82 gene

Expression for ZFP82 gene

Orthologsfor ZFP82 gene

Paralogsfor ZFP82 gene

Genomic Variantsfor ZFP82 gene

Disorders / Diseasesfor ZFP82 gene

Publicationsfor ZFP82 gene

External Searches for ZFP82 gene

Genome Databases showing ZFP82 gene

Other Databases showing ZFP82 gene

Specialized Databases showing ZFP82 gene

Intellectual Propertyfor ZFP82 gene

Productsfor ZFP82 gene

View Random Gene

Aliases
for ZFP82 gene

Summaries
for ZFP82 gene

Genomic Views
for ZFP82 gene

Proteins
for ZFP82 gene

Protein Domains /
Families
for ZFP82 gene

Function
for ZFP82 gene

Pathways & Interactions
for ZFP82 gene

Drugs & Compounds
for ZFP82 gene

Transcripts
for ZFP82 gene

Expression
for ZFP82 gene

Orthologs
for ZFP82 gene

Paralogs
for ZFP82 gene

Genomic Variants
for ZFP82 gene

Disorders / Diseases
for ZFP82 gene

Publications
for ZFP82 gene

Intellectual Property
for ZFP82 gene

Products
for ZFP82 gene