Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZFHX4 Gene

Aliases for ZFHX4 Gene

  • Zinc Finger Homeobox 4 2 3 5
  • Zinc-Finger Homeodomain Protein 4 3
  • Zinc Finger Homeodomain Protein 4 4
  • Zinc Finger Homeobox Protein 4 3
  • Zinc Finger Homeodomain 4 2
  • ZFH-4 4
  • ZFH4 3
  • ZHF4 3

External Ids for ZFHX4 Gene

Previous GeneCards Identifiers for ZFHX4 Gene

  • GC08P077778
  • GC08P077593
  • GC08P073079

Summaries for ZFHX4 Gene

GeneCards Summary for ZFHX4 Gene

ZFHX4 (Zinc Finger Homeobox 4) is a Protein Coding gene. Diseases associated with ZFHX4 include Ptosis, Hereditary Congenital 1 and Congenital Ptosis. Among its related pathways are Ectoderm Differentiation and Mesodermal Commitment Pathway. Gene Ontology (GO) annotations related to this gene include nucleic acid binding and actin binding. An important paralog of this gene is ZFHX3.

UniProtKB/Swiss-Prot for ZFHX4 Gene

  • May play a role in neural and muscle differentiation (By similarity). May be involved in transcriptional regulation.

Additional gene information for ZFHX4 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZFHX4 Gene

Genomics for ZFHX4 Gene

GeneHancer (GH) Regulatory Elements for ZFHX4 Gene

Promoters and enhancers for ZFHX4 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH08I076680 Promoter/Enhancer 2.7 UCNEbase EPDnew Ensembl ENCODE dbSUPER 550.8 +1.7 1673 5.3 PKNOX1 SIN3A FEZF1 ZNF2 YY1 GLIS2 ZNF143 RUNX3 ZNF202 RXRA ZFHX4-AS1 ZFHX4 HIGD1AP18
GH08I076672 Enhancer 1.9 UCNEbase FANTOM5 Ensembl ENCODE dbSUPER 2.2 -7.4 -7354 3.4 PKNOX1 MZF1 SIN3A BMI1 ZNF2 RAD21 YY1 ZNF335 ZNF366 ZNF391 ZFHX4 ZFHX4-AS1 MRPL9P1
GH08I076676 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 2.8 -3.2 -3151 3.8 PKNOX1 ZSCAN4 ZNF76 GLI4 RAD21 ZNF335 GLIS2 ZNF366 EGR2 RXRA ZFHX4-AS1 ZFHX4 MRPL9P1
GH08I076847 Enhancer 0.4 UCNEbase 6.8 +166.8 166784 0.4 ZFHX4 GC08P076864 GC08M076785
GH08I076685 Enhancer 1.9 VISTA UCNEbase Ensembl ENCODE dbSUPER 0.4 +5.9 5872 2.6 ZNF146 BACH1 FEZF1 ZNF664 CTBP1 ZSCAN5C ZNF10 ZNF398 ZNF843 OSR2 ZFHX4-AS1 ZFHX4 GC08P076707
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ZFHX4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ZFHX4 gene promoter:

Genomic Locations for ZFHX4 Gene

Genomic Locations for ZFHX4 Gene
chr8:76,681,219-76,867,285
(GRCh38/hg38)
Size:
186,067 bases
Orientation:
Plus strand
chr8:77,593,454-77,779,521
(GRCh37/hg19)

Genomic View for ZFHX4 Gene

Genes around ZFHX4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZFHX4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZFHX4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZFHX4 Gene

Proteins for ZFHX4 Gene

  • Protein details for ZFHX4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q86UP3-ZFHX4_HUMAN
    Recommended name:
    Zinc finger homeobox protein 4
    Protein Accession:
    Q86UP3
    Secondary Accessions:
    • G3V138
    • Q18PS0
    • Q6ZN20

    Protein attributes for ZFHX4 Gene

    Size:
    3567 amino acids
    Molecular mass:
    393730 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AK131408; Type=Frameshift; Positions=338; Evidence={ECO:0000305};

    Alternative splice isoforms for ZFHX4 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ZFHX4 Gene

Post-translational modifications for ZFHX4 Gene

No Post-translational modifications

No data available for DME Specific Peptides for ZFHX4 Gene

Domains & Families for ZFHX4 Gene

Gene Families for ZFHX4 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for ZFHX4 Gene

Graphical View of Domain Structure for InterPro Entry

Q86UP3

UniProtKB/Swiss-Prot:

ZFHX4_HUMAN :
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
Family:
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
genes like me logo Genes that share domains with ZFHX4: view

Function for ZFHX4 Gene

Molecular function for ZFHX4 Gene

UniProtKB/Swiss-Prot Function:
May play a role in neural and muscle differentiation (By similarity). May be involved in transcriptional regulation.

Phenotypes From GWAS Catalog for ZFHX4 Gene

Gene Ontology (GO) - Molecular Function for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0008270 zinc ion binding IEA --
GO:0043565 sequence-specific DNA binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with ZFHX4: view
genes like me logo Genes that share phenotypes with ZFHX4: view

Human Phenotype Ontology for ZFHX4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ZFHX4 Gene

Localization for ZFHX4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ZFHX4 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ZFHX4 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli fibrillar center (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with ZFHX4: view

Pathways & Interactions for ZFHX4 Gene

genes like me logo Genes that share pathways with ZFHX4: view

Pathways by source for ZFHX4 Gene

Interacting Proteins for ZFHX4 Gene

Gene Ontology (GO) - Biological Process for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with ZFHX4: view

No data available for SIGNOR curated interactions for ZFHX4 Gene

Drugs & Compounds for ZFHX4 Gene

No Compound Related Data Available

Transcripts for ZFHX4 Gene

Unigene Clusters for ZFHX4 Gene

Zinc finger homeobox 4:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ZFHX4 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11 ^ 12
SP1: - - - - - -
SP2: - -
SP3:
SP4:
SP5: -

Relevant External Links for ZFHX4 Gene

GeneLoc Exon Structure for
ZFHX4
ECgene alternative splicing isoforms for
ZFHX4

Expression for ZFHX4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ZFHX4 Gene

Protein differential expression in normal tissues from HIPED for ZFHX4 Gene

This gene is overexpressed in Plasma (59.7) and Heart (7.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ZFHX4 Gene



Protein tissue co-expression partners for ZFHX4 Gene

NURSA nuclear receptor signaling pathways regulating expression of ZFHX4 Gene:

ZFHX4

SOURCE GeneReport for Unigene cluster for ZFHX4 Gene:

Hs.458973

mRNA Expression by UniProt/SwissProt for ZFHX4 Gene:

Q86UP3-ZFHX4_HUMAN
Tissue specificity: Expressed in brain, skeletal muscle and liver. Very low expression in stomach.

Evidence on tissue expression from TISSUES for ZFHX4 Gene

  • Liver(4.7)
  • Kidney(4.2)
  • Nervous system(3.5)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ZFHX4 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
Organs:
Head and neck:
  • cranial nerve
  • eye
  • eyelid
  • face
  • head
General:
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with ZFHX4: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ZFHX4 Gene

Orthologs for ZFHX4 Gene

This gene was present in the common ancestor of animals.

Orthologs for ZFHX4 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ZFHX4 33 34
  • 99.43 (n)
dog
(Canis familiaris)
Mammalia ZFHX4 33 34
  • 92.04 (n)
oppossum
(Monodelphis domestica)
Mammalia ZFHX4 34
  • 92 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 91 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia ZFHX4 33 34
  • 89.76 (n)
rat
(Rattus norvegicus)
Mammalia Zfhx4 33
  • 88.85 (n)
mouse
(Mus musculus)
Mammalia Zfhx4 33 16 34
  • 88.73 (n)
chicken
(Gallus gallus)
Aves ZFHX4 33 34
  • 85.67 (n)
lizard
(Anolis carolinensis)
Reptilia -- 34
  • 92 (a)
OneToMany
-- 34
  • 90 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia zfhx4 33
  • 78.72 (n)
Str.9639 33
zebrafish
(Danio rerio)
Actinopterygii zfhx4 33 34
  • 71.87 (n)
Dr.29679 33
fruit fly
(Drosophila melanogaster)
Insecta zfh2 34
  • 25 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea zfh-2 34
  • 33 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 31 (a)
ManyToMany
-- 34
  • 25 (a)
ManyToMany
Species where no ortholog for ZFHX4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ZFHX4 Gene

ENSEMBL:
Gene Tree for ZFHX4 (if available)
TreeFam:
Gene Tree for ZFHX4 (if available)

Paralogs for ZFHX4 Gene

Paralogs for ZFHX4 Gene

genes like me logo Genes that share paralogs with ZFHX4: view

Variants for ZFHX4 Gene

Sequence variations from dbSNP and Humsavar for ZFHX4 Gene

SNP ID Clin Chr 08 pos Variation AA Info Type
rs1000008338 -- 76,735,907(+) G/A intron_variant
rs1000008547 -- 76,768,126(+) AAGATTGTGAACGAAGGCATGTAAATAATGGAGTAAG/AAG intron_variant
rs1000056715 -- 76,729,495(+) A/G intron_variant
rs1000067234 -- 76,820,279(+) G/A intron_variant
rs1000076388 -- 76,779,471(+) T/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ZFHX4 Gene

Variant ID Type Subtype PubMed ID
esv3891416 CNV gain 25118596
nsv478318 CNV novel sequence insertion 20440878

Variation tolerance for ZFHX4 Gene

Residual Variation Intolerance Score: 0.988% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.14; 90.33% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ZFHX4 Gene

Human Gene Mutation Database (HGMD)
ZFHX4
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ZFHX4

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ZFHX4 Gene

Disorders for ZFHX4 Gene

MalaCards: The human disease database

(5) MalaCards diseases for ZFHX4 Gene - From: HGMD, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
ptosis, hereditary congenital 1
  • ptos1
congenital ptosis
ptosis
  • blepharoptosis
chromosome 8q21.11 deletion syndrome
  • 8q21.11 microdeletion syndrome
sclerocornea
  • isolated congenital sclerocornea
- elite association - COSMIC cancer census association via MalaCards
Search ZFHX4 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ZFHX4_HUMAN
  • Note=A chromosomal aberration involving ZFHX4 is found in one patient with ptosis. Translocation t(1;8)(p34.3;q21.12). {ECO:0000269 PubMed:11935336}.

Additional Disease Information for ZFHX4

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ZFHX4: view

No data available for Genatlas for ZFHX4 Gene

Publications for ZFHX4 Gene

  1. A candidate gene for congenital bilateral isolated ptosis identified by molecular analysis of a de novo balanced translocation. (PMID: 11935336) McMullan TW … Robinson DO (Human genetics 2002) 2 3 4 58
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
  4. The role of height-associated loci identified in genome wide association studies in the determination of pediatric stature. (PMID: 20546612) Zhao J … Grant SF (BMC medical genetics 2010) 3 44 58
  5. Many sequence variants affecting diversity of adult human height. (PMID: 18391951) Gudbjartsson DF … Stefansson K (Nature genetics 2008) 3 44 58

Products for ZFHX4 Gene

Sources for ZFHX4 Gene

Content
Loading form....