Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZFHX4 Gene

Aliases for ZFHX4 Gene

  • Zinc Finger Homeobox 4 2 3 5
  • Zinc-Finger Homeodomain Protein 4 3
  • Zinc Finger Homeodomain Protein 4 4
  • Zinc Finger Homeobox Protein 4 3
  • Zinc Finger Homeodomain 4 2
  • ZFH-4 4
  • ZFH4 3
  • ZHF4 3

External Ids for ZFHX4 Gene

Previous GeneCards Identifiers for ZFHX4 Gene

  • GC08P077778
  • GC08P077593
  • GC08P073079

Summaries for ZFHX4 Gene

GeneCards Summary for ZFHX4 Gene

ZFHX4 (Zinc Finger Homeobox 4) is a Protein Coding gene. Diseases associated with ZFHX4 include Ptosis, Congenital and Ptosis. Among its related pathways are Mesodermal Commitment Pathway and Ectoderm Differentiation. GO annotations related to this gene include nucleic acid binding and actin binding. An important paralog of this gene is ZFHX3.

UniProtKB/Swiss-Prot for ZFHX4 Gene

  • May play a role in neural and muscle differentiation (By similarity). May be involved in transcriptional regulation.

Additional gene information for ZFHX4 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZFHX4 Gene

Genomics for ZFHX4 Gene

Regulatory Elements for ZFHX4 Gene

Enhancers for ZFHX4 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH08H076672 2.7 FANTOM5 Ensembl ENCODE dbSUPER 2.2 -7.4 -7386 3.3 PKNOX1 BMI1 ZNF2 RAD21 YY1 ZNF366 ZNF391 ETV6 EGR2 REST ZFHX4 MRPL9P1
GH08H076676 1.6 FANTOM5 Ensembl ENCODE dbSUPER 2.8 -3.2 -3152 3.8 CTCF PKNOX1 TAF1 ZSCAN4 ZNF76 GLI4 RAD21 BCL11B GLIS2 ZNF316 ZFHX4-AS1 ZFHX4 MRPL9P1
GH08H076680 2.4 Ensembl ENCODE dbSUPER 0.7 +1.7 1674 5.3 PKNOX1 ZSCAN4 INSM2 ZNF76 FEZF1 ZNF2 RAD21 YY1 GLIS2 ZNF366 HIGD1AP18 ZFHX4 ZFHX4-AS1
GH08H076819 0.3 FANTOM5 3.8 +137.9 137939 0 ZFHX4 GC08M076785 GC08P076864
GH08H076668 1.6 dbSUPER 0.4 -11.7 -11653 2.2 PKNOX1 JUNB ETV6 RUNX3 BATF CREM ZFHX4 MRPL9P1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ZFHX4 on UCSC Golden Path with GeneCards custom track

Promoters for ZFHX4 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000226046 1181 3201 PKNOX1 ZSCAN4 INSM2 ZNF76 FEZF1 ZNF2 RAD21 YY1 GLIS2 ZNF366

Genomic Locations for ZFHX4 Gene

Genomic Locations for ZFHX4 Gene
186,067 bases
Plus strand

Genomic View for ZFHX4 Gene

Genes around ZFHX4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZFHX4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZFHX4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZFHX4 Gene

Proteins for ZFHX4 Gene

  • Protein details for ZFHX4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Zinc finger homeobox protein 4
    Protein Accession:
    Secondary Accessions:
    • G3V138
    • Q18PS0
    • Q6ZN20

    Protein attributes for ZFHX4 Gene

    3567 amino acids
    Molecular mass:
    393730 Da
    Quaternary structure:
    No Data Available
    • Sequence=AK131408; Type=Frameshift; Positions=338; Evidence={ECO:0000305};

    Alternative splice isoforms for ZFHX4 Gene


neXtProt entry for ZFHX4 Gene

Post-translational modifications for ZFHX4 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for ZFHX4 Gene

Domains & Families for ZFHX4 Gene

Gene Families for ZFHX4 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for ZFHX4 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the krueppel C2H2-type zinc-finger protein family.
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
genes like me logo Genes that share domains with ZFHX4: view

Function for ZFHX4 Gene

Molecular function for ZFHX4 Gene

UniProtKB/Swiss-Prot Function:
May play a role in neural and muscle differentiation (By similarity). May be involved in transcriptional regulation.

Phenotypes From GWAS Catalog for ZFHX4 Gene

Gene Ontology (GO) - Molecular Function for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0008270 zinc ion binding IEA --
GO:0043565 sequence-specific DNA binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with ZFHX4: view
genes like me logo Genes that share phenotypes with ZFHX4: view

Human Phenotype Ontology for ZFHX4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ZFHX4 Gene

Localization for ZFHX4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ZFHX4 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ZFHX4 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli fibrillar center (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with ZFHX4: view

Pathways & Interactions for ZFHX4 Gene

genes like me logo Genes that share pathways with ZFHX4: view

Pathways by source for ZFHX4 Gene

Interacting Proteins for ZFHX4 Gene

Gene Ontology (GO) - Biological Process for ZFHX4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with ZFHX4: view

No data available for SIGNOR curated interactions for ZFHX4 Gene

Drugs & Compounds for ZFHX4 Gene

No Compound Related Data Available

Transcripts for ZFHX4 Gene

Unigene Clusters for ZFHX4 Gene

Zinc finger homeobox 4:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ZFHX4 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11 ^ 12
SP1: - - - - - -
SP2: - -
SP5: -

Relevant External Links for ZFHX4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ZFHX4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ZFHX4 Gene

Protein differential expression in normal tissues from HIPED for ZFHX4 Gene

This gene is overexpressed in Plasma (59.7) and Heart (7.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ZFHX4 Gene

Protein tissue co-expression partners for ZFHX4 Gene

NURSA nuclear receptor signaling pathways regulating expression of ZFHX4 Gene:


SOURCE GeneReport for Unigene cluster for ZFHX4 Gene:


mRNA Expression by UniProt/SwissProt for ZFHX4 Gene:

Tissue specificity: Expressed in brain, skeletal muscle and liver. Very low expression in stomach.

Evidence on tissue expression from TISSUES for ZFHX4 Gene

  • Liver(4.7)
  • Kidney(4.2)
  • Nervous system(3.5)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ZFHX4 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • integumentary
Head and neck:
  • cranial nerve
  • eye
  • eyelid
  • face
  • head
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with ZFHX4: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ZFHX4 Gene

Orthologs for ZFHX4 Gene

This gene was present in the common ancestor of animals.

Orthologs for ZFHX4 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ZFHX4 33 34
  • 99.43 (n)
(Canis familiaris)
Mammalia ZFHX4 33 34
  • 92.04 (n)
(Monodelphis domestica)
Mammalia ZFHX4 34
  • 92 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 91 (a)
(Bos Taurus)
Mammalia ZFHX4 33 34
  • 89.76 (n)
(Rattus norvegicus)
Mammalia Zfhx4 33
  • 88.85 (n)
(Mus musculus)
Mammalia Zfhx4 33 16 34
  • 88.73 (n)
(Gallus gallus)
Aves ZFHX4 33 34
  • 85.67 (n)
(Anolis carolinensis)
Reptilia -- 34
  • 92 (a)
-- 34
  • 90 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia zfhx4 33
  • 78.72 (n)
Str.9639 33
(Danio rerio)
Actinopterygii zfhx4 33 34
  • 71.87 (n)
Dr.29679 33
fruit fly
(Drosophila melanogaster)
Insecta zfh2 34
  • 25 (a)
(Caenorhabditis elegans)
Secernentea zfh-2 34
  • 33 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 31 (a)
-- 34
  • 25 (a)
Species where no ortholog for ZFHX4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ZFHX4 Gene

Gene Tree for ZFHX4 (if available)
Gene Tree for ZFHX4 (if available)

Paralogs for ZFHX4 Gene

Paralogs for ZFHX4 Gene

genes like me logo Genes that share paralogs with ZFHX4: view

Variants for ZFHX4 Gene

Sequence variations from dbSNP and Humsavar for ZFHX4 Gene

SNP ID Clin Chr 08 pos Sequence Context AA Info Type
rs1000008338 -- 76,735,907(+) GATTA(A/G)GATAG intron-variant
rs1000008547 -- 76,768,126(+) GAGGG(-/AAGATTGTGAACGAAGGCATGTAAATAATGGAGT)AAGTT intron-variant
rs1000056715 -- 76,729,495(+) TTTTC(A/G)TGGTT intron-variant
rs1000067234 -- 76,820,279(+) TTACC(A/G)TATAT intron-variant
rs1000076388 -- 76,779,471(+) GCCAG(A/T)TGGAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ZFHX4 Gene

Variant ID Type Subtype PubMed ID
nsv478318 CNV novel sequence insertion 20440878
esv3891416 CNV gain 25118596

Variation tolerance for ZFHX4 Gene

Residual Variation Intolerance Score: 0.988% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.14; 90.33% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ZFHX4 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ZFHX4 Gene

Disorders for ZFHX4 Gene

MalaCards: The human disease database

(5) MalaCards diseases for ZFHX4 Gene - From: HGMD, OMIM, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
ptosis, congenital
  • congenital ptosis
  • blepharoptosis
chromosome 8q21.11 deletion syndrome
  • 8q21.11 microdeletion syndrome
  • isolated congenital sclerocornea
pineal gland cancer
  • malignant pineal region tumor
- elite association - COSMIC cancer census association via MalaCards
Search ZFHX4 in MalaCards View complete list of genes associated with diseases


  • Note=A chromosomal aberration involving ZFHX4 is found in one patient with ptosis. Translocation t(1;8)(p34.3;q21.12). {ECO:0000269 PubMed:11935336}.

Relevant External Links for ZFHX4

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with ZFHX4: view

No data available for Genatlas for ZFHX4 Gene

Publications for ZFHX4 Gene

  1. A candidate gene for congenital bilateral isolated ptosis identified by molecular analysis of a de novo balanced translocation. (PMID: 11935336) McMullan TW … Robinson DO (Human genetics 2002) 2 3 4 60
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 45 60
  3. The role of height-associated loci identified in genome wide association studies in the determination of pediatric stature. (PMID: 20546612) Zhao J … Grant SF (BMC medical genetics 2010) 3 45 60
  4. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 45 60
  5. Many sequence variants affecting diversity of adult human height. (PMID: 18391951) Gudbjartsson DF … Stefansson K (Nature genetics 2008) 3 45 60

Products for ZFHX4 Gene

Sources for ZFHX4 Gene

Loading form....