Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZFHX3 Gene

Aliases for ZFHX3 Gene

  • Zinc Finger Homeobox 3 2 3 5
  • AT-Binding Transcription Factor 1 2 3 4
  • Zinc Finger Homeodomain Protein 3 3 4
  • AT Motif-Binding Factor 1 3 4
  • ATBF1 3 4
  • ZFH-3 3 4
  • Alpha-Fetoprotein Enhancer Binding Protein 3
  • Alpha-Fetoprotein Enhancer-Binding Protein 4
  • Zinc Finger Homeobox Protein 3 3
  • ZNF927 3
  • ATBT 3

External Ids for ZFHX3 Gene

Previous HGNC Symbols for ZFHX3 Gene

  • ATBF1

Previous GeneCards Identifiers for ZFHX3 Gene

  • GC16M071374
  • GC16M072816
  • GC16M058584

Summaries for ZFHX3 Gene

Entrez Gene Summary for ZFHX3 Gene

  • This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

GeneCards Summary for ZFHX3 Gene

ZFHX3 (Zinc Finger Homeobox 3) is a Protein Coding gene. Diseases associated with ZFHX3 include Prostate Cancer and Prostate Cancer Susceptibility. Among its related pathways are Circadian rythm related genes and Signaling pathways regulating pluripotency of stem cells. GO annotations related to this gene include nucleic acid binding and sequence-specific DNA binding. An important paralog of this gene is ZFHX4.

UniProtKB/Swiss-Prot for ZFHX3 Gene

  • Transcriptional regulator which can act as an activator or a repressor. Inhibits the enhancer element of the AFP gene by binding to its AT-rich core sequence. In concert with SMAD-dependent TGF-beta signaling can repress the transcription of AFP via its interaction with SMAD2/3 (PubMed:25105025). Regulates the circadian locomotor rhythms via transcriptional activation of neuropeptidergic genes which are essential for intercellular synchrony and rhythm amplitude in the suprachiasmatic nucleus (SCN) of the brain (By similarity). Regulator of myoblasts differentiation through the binding to the AT-rich sequence of MYF6 promoter and promoter repression (PubMed:11312261). Down-regulates the MUC5AC promoter in gastric cancer (PubMed:17330845). In association with RUNX3, upregulates CDKN1A promoter activity following TGF-beta stimulation (PubMed:20599712). Inhibits estrogen receptor (ESR1) function by selectively competing with coactivator NCOA3 for binding to ESR1 in ESR1-positive breast cancer cells (PubMed:20720010).

Gene Wiki entry for ZFHX3 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZFHX3 Gene

Genomics for ZFHX3 Gene

Regulatory Elements for ZFHX3 Gene

Enhancers for ZFHX3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16G072983 1.9 FANTOM5 Ensembl ENCODE dbSUPER 33.1 +71.1 71068 9.3 PKNOX1 FOXA2 ARID4B SIN3A YY1 SLC30A9 FOS ZHX2 MXD4 KAT8 ZFHX3 PIR36221 ENSG00000279757
GH16G072994 1.8 FANTOM5 Ensembl ENCODE dbSUPER 15.8 +63.1 63106 3.3 PKNOX1 SIN3A FOS ZHX2 PPARG ZNF592 ZNF579 MBD2 RCOR2 NBN ZFHX3 PIR36221 ENSG00000279757
GH16G073018 1.6 Ensembl ENCODE dbSUPER 16.3 +39.6 39624 3.0 PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 FEZF1 ZNF2 YY1 FOS ZFHX3 DHX38 ENSG00000279591 PIR53148
GH16G073035 1.6 Ensembl ENCODE dbSUPER 12.1 +22.3 22301 3.4 PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 FEZF1 YY1 ZNF143 ZNF207 DHX38 ZFHX3 PIR53148
GH16G073045 2.1 FANTOM5 Ensembl ENCODE dbSUPER 9 +0.7 708 26.2 MLX DMAP1 YBX1 FEZF1 YY1 ZNF548 ZNF263 SP3 MEF2D SSRP1 DHX38 C16orf47 ZFHX3 ENSG00000271009 TXNL4B PIR53148
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ZFHX3 on UCSC Golden Path with GeneCards custom track

Promoters for ZFHX3 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000087811 1198 3401 PKNOX1 ARNT SIN3A FEZF1 YBX1 ZNF2 ZNF48 YY1 GLIS2 ZNF548

Genomic Location for ZFHX3 Gene

Chromosome:
16
Start:
72,782,885 bp from pter
End:
73,059,698 bp from pter
Size:
276,814 bases
Orientation:
Minus strand

Genomic View for ZFHX3 Gene

Genes around ZFHX3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZFHX3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZFHX3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZFHX3 Gene

Proteins for ZFHX3 Gene

  • Protein details for ZFHX3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q15911-ZFHX3_HUMAN
    Recommended name:
    Zinc finger homeobox protein 3
    Protein Accession:
    Q15911
    Secondary Accessions:
    • D3DWS8
    • O15101
    • Q13719

    Protein attributes for ZFHX3 Gene

    Size:
    3703 amino acids
    Molecular mass:
    404419 Da
    Quaternary structure:
    • Interacts with FNBP3 (By similarity). Interacts with ALKBH4 and PIAS3. Interacts with ESR1. Interacts with RUNX3. Interacts with TRIM25. Interacts with SMAD2 and SMAD3.

    Three dimensional structures from OCA and Proteopedia for ZFHX3 Gene

    Alternative splice isoforms for ZFHX3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ZFHX3 Gene

Post-translational modifications for ZFHX3 Gene

  • Adult brain-derived ZFHX3 is sensitive, but embryonic brain-derived ZFHX3 is resistant to calpain 1-mediated proteolysis.
  • Nuclear localization is essential for its sumoylation.
  • Phosphorylation decreases its sensitivity to calpain-mediated proteolysis.
  • Ubiquitinated, leading to its proteasomal degradation.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ZFHX3 Gene

No data available for DME Specific Peptides for ZFHX3 Gene

Domains & Families for ZFHX3 Gene

Suggested Antigen Peptide Sequences for ZFHX3 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ZFHX3: view

No data available for UniProtKB/Swiss-Prot for ZFHX3 Gene

Function for ZFHX3 Gene

Molecular function for ZFHX3 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional regulator which can act as an activator or a repressor. Inhibits the enhancer element of the AFP gene by binding to its AT-rich core sequence. In concert with SMAD-dependent TGF-beta signaling can repress the transcription of AFP via its interaction with SMAD2/3 (PubMed:25105025). Regulates the circadian locomotor rhythms via transcriptional activation of neuropeptidergic genes which are essential for intercellular synchrony and rhythm amplitude in the suprachiasmatic nucleus (SCN) of the brain (By similarity). Regulator of myoblasts differentiation through the binding to the AT-rich sequence of MYF6 promoter and promoter repression (PubMed:11312261). Down-regulates the MUC5AC promoter in gastric cancer (PubMed:17330845). In association with RUNX3, upregulates CDKN1A promoter activity following TGF-beta stimulation (PubMed:20599712). Inhibits estrogen receptor (ESR1) function by selectively competing with coactivator NCOA3 for binding to ESR1 in ESR1-positive breast cancer cells (PubMed:20720010).

Gene Ontology (GO) - Molecular Function for ZFHX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001046 core promoter sequence-specific DNA binding ISS --
GO:0003676 nucleic acid binding IEA --
GO:0003677 DNA binding IEA --
GO:0003700 transcription factor activity, sequence-specific DNA binding NAS 1719379
GO:0003705 transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding TAS 1719379
genes like me logo Genes that share ontologies with ZFHX3: view
genes like me logo Genes that share phenotypes with ZFHX3: view

Animal Models for ZFHX3 Gene

MGI Knock Outs for ZFHX3:

Animal Model Products

CRISPR Products

miRNA for ZFHX3 Gene

miRTarBase miRNAs that target ZFHX3

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for ZFHX3

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ZFHX3 Gene

Localization for ZFHX3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ZFHX3 Gene

Nucleus. Cytoplasm. Note=Translocates from the cytoplasm to the nucleus following TGF-beta stimulation. Expressed in nuclear body (NB)-like dots in the nucleus some of which overlap or closely associate with PML body. {ECO:0000269 PubMed:20599712, ECO:0000269 PubMed:24651376}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ZFHX3 gene
Compartment Confidence
nucleus 5

Gene Ontology (GO) - Cellular Components for ZFHX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS 1719379
GO:0005654 nucleoplasm IDA,TAS --
GO:0005667 transcription factor complex IDA 10318867
GO:0005737 cytoplasm IDA,IEA 20599712
GO:0016604 nuclear body IDA 24651376
genes like me logo Genes that share ontologies with ZFHX3: view

Pathways & Interactions for ZFHX3 Gene

genes like me logo Genes that share pathways with ZFHX3: view

Pathways by source for ZFHX3 Gene

1 BioSystems pathway for ZFHX3 Gene

Gene Ontology (GO) - Biological Process for ZFHX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IGI 10318867
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated TAS 1719379
GO:0006366 transcription from RNA polymerase II promoter TAS 1719379
GO:0007050 cell cycle arrest IEA --
genes like me logo Genes that share ontologies with ZFHX3: view

No data available for SIGNOR curated interactions for ZFHX3 Gene

Drugs & Compounds for ZFHX3 Gene

(2) Drugs for ZFHX3 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with ZFHX3: view

Transcripts for ZFHX3 Gene

Unigene Clusters for ZFHX3 Gene

Zinc finger homeobox 3:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for ZFHX3

Alternative Splicing Database (ASD) splice patterns (SP) for ZFHX3 Gene

No ASD Table

Relevant External Links for ZFHX3 Gene

GeneLoc Exon Structure for
ZFHX3
ECgene alternative splicing isoforms for
ZFHX3

Expression for ZFHX3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ZFHX3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ZFHX3 Gene

This gene is overexpressed in Artery - Tibial (x5.2).

Protein differential expression in normal tissues from HIPED for ZFHX3 Gene

This gene is overexpressed in Colon muscle (28.6), Adrenal (26.4), and Pancreatic juice (9.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ZFHX3 Gene



NURSA nuclear receptor signaling pathways regulating expression of ZFHX3 Gene:

ZFHX3

SOURCE GeneReport for Unigene cluster for ZFHX3 Gene:

Hs.598297

mRNA Expression by UniProt/SwissProt for ZFHX3 Gene:

Q15911-ZFHX3_HUMAN
Tissue specificity: Not found in normal gastric mucosa but found in gastric carcinoma cells (at protein level). Expression is higher in ER-positive breast tumors than ER-negative breast tumors (at protein level).

Evidence on tissue expression from TISSUES for ZFHX3 Gene

  • Lung(4.5)
  • Liver(4.2)
  • Nervous system(3.2)
  • Eye(2.6)
  • Muscle(2)
genes like me logo Genes that share expression patterns with ZFHX3: view

Primer Products

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for ZFHX3 Gene

Orthologs for ZFHX3 Gene

This gene was present in the common ancestor of animals.

Orthologs for ZFHX3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ZFHX3 34 35
  • 98.67 (n)
dog
(Canis familiaris)
Mammalia ZFHX3 34 35
  • 92.65 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia ZFHX3 35
  • 92 (a)
OneToOne
cow
(Bos Taurus)
Mammalia ZFHX3 34 35
  • 91.35 (n)
mouse
(Mus musculus)
Mammalia Zfhx3 34 16 35
  • 89.93 (n)
rat
(Rattus norvegicus)
Mammalia Zfhx3 34
  • 89.9 (n)
oppossum
(Monodelphis domestica)
Mammalia ZFHX3 35
  • 89 (a)
OneToOne
chicken
(Gallus gallus)
Aves ZFHX3 34 35
  • 82.49 (n)
lizard
(Anolis carolinensis)
Reptilia ZFHX3 35
  • 80 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia zfhx3 34
  • 72.83 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.31945 34
zebrafish
(Danio rerio)
Actinopterygii zfhx3 34 35
  • 67.38 (n)
ZFHX3 (2 of 2) 35
  • 49 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta zfh2 35
  • 25 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea zfh-2 35
  • 33 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 32 (a)
ManyToMany
-- 35
  • 25 (a)
ManyToMany
Species where no ortholog for ZFHX3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ZFHX3 Gene

ENSEMBL:
Gene Tree for ZFHX3 (if available)
TreeFam:
Gene Tree for ZFHX3 (if available)

Paralogs for ZFHX3 Gene

Paralogs for ZFHX3 Gene

(2) SIMAP similar genes for ZFHX3 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with ZFHX3: view

Variants for ZFHX3 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for ZFHX3 Gene

ZFHX3_HUMAN-Q15911
Genetic variations in ZFHX3 are associated with atrial fibrillation and ischemic stroke in individuals of European ancestry.

Sequence variations from dbSNP and Humsavar for ZFHX3 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs727502780 Pathogenic 72,788,111(-) GCAGC(-/GGCAACTACAGCAGCAGCAGCAGC)AAAAA intron-variant, cds-indel
rs869312913 Likely pathogenic 72,795,832(-) CAACC(C/T)GAGTG intron-variant, reference, stop-gained
rs142939235 Likely benign 72,793,975(+) CTTGC(C/T)ATAAA intron-variant, reference, missense
rs1000007754 -- 72,810,231(+) CCCAG(A/C/G)CTGGA intron-variant
rs1000017442 -- 72,938,695(+) AGACA(C/T)GAATT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ZFHX3 Gene

Variant ID Type Subtype PubMed ID
dgv1367n106 CNV deletion 24896259
dgv487n67 CNV gain 20364138
dgv5187n54 CNV gain+loss 21841781
dgv5188n54 CNV gain 21841781
esv2672800 CNV deletion 23128226
esv29824 CNV loss 19812545
esv3302462 CNV tandem duplication 20981092
esv3304551 CNV mobile element insertion 20981092
esv3310457 CNV novel sequence insertion 20981092
esv3357926 CNV insertion 20981092
esv3367732 CNV insertion 20981092
esv3416014 CNV duplication 20981092
esv3639025 CNV loss 21293372
esv3639027 CNV loss 21293372
nsv1070357 CNV deletion 25765185
nsv1071294 CNV deletion 25765185
nsv1071295 CNV deletion 25765185
nsv1134562 CNV deletion 24896259
nsv1868 CNV deletion 18451855
nsv1869 CNV insertion 18451855
nsv572959 CNV loss 21841781
nsv572960 CNV gain 21841781
nsv572961 CNV gain+loss 21841781
nsv7285 OTHER inversion 18451855
nsv819379 CNV gain 19587683
nsv827733 CNV gain 20364138
nsv827734 CNV gain 20364138

Variation tolerance for ZFHX3 Gene

Residual Variation Intolerance Score: 0.259% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 16.21; 97.61% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ZFHX3 Gene

Human Gene Mutation Database (HGMD)
ZFHX3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ZFHX3

Disorders for ZFHX3 Gene

MalaCards: The human disease database

(3) MalaCards diseases for ZFHX3 Gene - From: OMIM, GeneTests, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
prostate cancer
  • prostate cancer, hereditary, 5
prostate cancer susceptibility
atrial fibrillation
  • a-fib
- elite association - COSMIC cancer census association via MalaCards
Search ZFHX3 in MalaCards View complete list of genes associated with diseases

Relevant External Links for ZFHX3

Genetic Association Database (GAD)
ZFHX3
Human Genome Epidemiology (HuGE) Navigator
ZFHX3
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ZFHX3
genes like me logo Genes that share disorders with ZFHX3: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ZFHX3 Gene

Publications for ZFHX3 Gene

  1. Cloning and characterization of an ATBF1 isoform that expresses in a neuronal differentiation-dependent manner. (PMID: 7592926) Miura Y. … Tamaoki T. (J. Biol. Chem. 1995) 2 3 4 22 64
  2. A human alpha-fetoprotein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. (PMID: 1719379) Morinaga T. … Tamaoki T. (Mol. Cell. Biol. 1991) 2 3 4 22 64
  3. A sequence variant in ZFHX3 on 16q22 associates with atrial fibrillation and ischemic stroke. (PMID: 19597491) Gudbjartsson D.F. … Stefansson K. (Nat. Genet. 2009) 3 4 46 64
  4. Variants in ZFHX3 are associated with atrial fibrillation in individuals of European ancestry. (PMID: 19597492) Benjamin E.J. … Witteman J.C.M. (Nat. Genet. 2009) 3 4 46 64
  5. Subcellular localization of ATBF1 regulates MUC5AC transcription in gastric cancer. (PMID: 17330845) Mori Y. … Joh T. (Int. J. Cancer 2007) 3 4 22 64

Products for ZFHX3 Gene

  • Addgene plasmids for ZFHX3

Sources for ZFHX3 Gene

Content
Loading form....