Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ZC3H14 Gene

Aliases for ZC3H14 Gene

  • Zinc Finger CCCH-Type Containing 14 2 3 5
  • Mammalian Suppressor Of Tau Pathology-2 3 4
  • Renal Carcinoma Antigen NY-REN-37 3 4
  • MSUT-2 3 4
  • Zinc Finger CCCH Domain-Containing Protein 14 3
  • Nuclear Protein UKp68 3
  • NY-REN-37 3
  • MRT56 3
  • UKp68 3
  • SUT2 3

External Ids for ZC3H14 Gene

Previous GeneCards Identifiers for ZC3H14 Gene

  • GC14P088100
  • GC14P089029
  • GC14P069199

Summaries for ZC3H14 Gene

Entrez Gene Summary for ZC3H14 Gene

  • The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]

GeneCards Summary for ZC3H14 Gene

ZC3H14 (Zinc Finger CCCH-Type Containing 14) is a Protein Coding gene. Diseases associated with ZC3H14 include Mental Retardation, Autosomal Recessive 56 and Autosomal Recessive Non-Syndromic Intellectual Disability. Gene Ontology (GO) annotations related to this gene include poly(A) binding.

UniProtKB/Swiss-Prot for ZC3H14 Gene

  • Involved in poly(A) tail length control in neuronal cells. Binds the polyadenosine RNA oligonucleotides.

Additional gene information for ZC3H14 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ZC3H14 Gene

Genomics for ZC3H14 Gene

GeneHancer (GH) Regulatory Elements for ZC3H14 Gene

Promoters and enhancers for ZC3H14 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I088562 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 +0.5 471 2.4 ATF1 FOXA2 ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZNF48 GTF3C2 ZNF121 ZC3H14 FAM35CP ENSG00000278576 GC14M092125
GH14I088594 Promoter 0.6 EPDnew 550.3 +31.5 31492 0.1 USF1 ZC3H14 PTPN21 ENSG00000278576 PIR31268 GC14M092125
GH14I089414 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 13.9 +854.2 854211 4.7 HDGF PKNOX1 ATF1 FOXA2 SMAD1 ARID4B SIN3A FEZF1 DMAP1 ZNF48 FOXN3 FOXN3-AS1 ZC3H14 NRDE2 ENSG00000252655 LOC105370614 ENSG00000258380 ENSG00000259053
GH14I087989 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.2 -569.6 -569559 8.1 HDGF FOXA2 SMAD1 SIN3A IRF4 YY1 CBX5 ZNF207 ZNF143 SP3 GALC GPR65 FAM35CP ZC3H14 RNU6-835P
GH14I089032 Enhancer 0.7 FANTOM5 29.6 +469.3 469340 0.2 USF1 MAX ZBTB40 E4F1 ZNF507 DIDO1 PHF20 CBFA2T2 PRDM10 L3MBTL2 ZC3H14 LOC105370615 PIR56234
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ZC3H14 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ZC3H14 gene promoter:

Genomic Locations for ZC3H14 Gene

Genomic Locations for ZC3H14 Gene
chr14:88,562,909-88,627,596
(GRCh38/hg38)
Size:
64,688 bases
Orientation:
Plus strand
chr14:89,029,253-89,079,853
(GRCh37/hg19)

Genomic View for ZC3H14 Gene

Genes around ZC3H14 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ZC3H14 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ZC3H14 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ZC3H14 Gene

Proteins for ZC3H14 Gene

  • Protein details for ZC3H14 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6PJT7-ZC3HE_HUMAN
    Recommended name:
    Zinc finger CCCH domain-containing protein 14
    Protein Accession:
    Q6PJT7
    Secondary Accessions:
    • A8MY46
    • B4DXU8
    • B4DZW7
    • B4E2H4
    • G3V5R4
    • Q6MZU4
    • Q6PJ32
    • Q6PUI6
    • Q6PUI8
    • Q86TQ5
    • Q86TW0
    • Q86TW1
    • Q8NCT6
    • Q8NCZ3
    • Q8TDE2
    • Q9HAC9
    • Q9Y5A0

    Protein attributes for ZC3H14 Gene

    Size:
    736 amino acids
    Molecular mass:
    82876 Da
    Quaternary structure:
    • Interacts with HOOK2 (PubMed:19273536). Interacts with ZFC3H1 in a RNase-sensitive manner (PubMed:27871484).
    Miscellaneous:
    • ZC3H14 can functionally substitute for Nab2 in fly neurons and can rescue defects in development and locomotion that are present in dNab2 null flies.
    SequenceCaution:
    • Sequence=AAL83289.1; Type=Miscellaneous discrepancy; Note=Several sequencing errors.; Evidence={ECO:0000305}; Sequence=AAS90302.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305}; Sequence=AAS90302.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305}; Sequence=AK021868; Type=Frameshift; Positions=199; Evidence={ECO:0000305}; Sequence=CAE45933.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305};

    Alternative splice isoforms for ZC3H14 Gene

neXtProt entry for ZC3H14 Gene

Post-translational modifications for ZC3H14 Gene

  • Ubiquitination at posLast=9999, posLast=139139, isoforms=10, 11, 2, 3, 4, 5, 9245, isoforms=10, 11, 2, 3, 4, 5, 9283, posLast=368368, isoforms=10, 11, 2, 3, 4, 5, 9378, posLast=489489, and posLast=728728

No data available for DME Specific Peptides for ZC3H14 Gene

Domains & Families for ZC3H14 Gene

Gene Families for ZC3H14 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for ZC3H14 Gene

Suggested Antigen Peptide Sequences for ZC3H14 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q6PJT7

UniProtKB/Swiss-Prot:

ZC3HE_HUMAN :
  • Belongs to the ZC3H14 family.
Family:
  • Belongs to the ZC3H14 family.
genes like me logo Genes that share domains with ZC3H14: view

Function for ZC3H14 Gene

Molecular function for ZC3H14 Gene

UniProtKB/Swiss-Prot Function:
Involved in poly(A) tail length control in neuronal cells. Binds the polyadenosine RNA oligonucleotides.

Phenotypes From GWAS Catalog for ZC3H14 Gene

Gene Ontology (GO) - Molecular Function for ZC3H14 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IPI 19273536
GO:0008143 poly(A) binding IBA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with ZC3H14: view
genes like me logo Genes that share phenotypes with ZC3H14: view

Human Phenotype Ontology for ZC3H14 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ZC3H14 Gene

MGI Knock Outs for ZC3H14:

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ZC3H14 Gene

Localization for ZC3H14 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ZC3H14 Gene

Nucleus speckle. Note=Colocalizes with poly(A) RNA in nuclear speckles. {ECO:0000250 UniProtKB:Q7TMD5}.
Isoform 1: Nucleus speckle.
Isoform 3: Nucleus speckle.
Isoform 6: Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ZC3H14 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear speckles (4)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ZC3H14 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 19303045
GO:0005730 nucleolus IDA --
GO:0005737 cytoplasm IBA --
GO:0016607 nuclear speck IDA --
GO:0030529 intracellular ribonucleoprotein complex IDA 28793261
genes like me logo Genes that share ontologies with ZC3H14: view

Pathways & Interactions for ZC3H14 Gene

SuperPathways for ZC3H14 Gene

No Data Available

Gene Ontology (GO) - Biological Process for ZC3H14 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0043488 regulation of mRNA stability IBA --
GO:1900364 negative regulation of mRNA polyadenylation IBA --
genes like me logo Genes that share ontologies with ZC3H14: view

No data available for Pathways by source and SIGNOR curated interactions for ZC3H14 Gene

Drugs & Compounds for ZC3H14 Gene

No Compound Related Data Available

Transcripts for ZC3H14 Gene

Unigene Clusters for ZC3H14 Gene

Zinc finger CCCH-type containing 14:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ZC3H14 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b · 8c · 8d · 8e ^ 9 ^ 10 ^ 11a · 11b · 11c ^ 12a · 12b ^ 13 ^
SP1: - - - - - -
SP2: - - - - -
SP3: - - - - - - -
SP4: - - -
SP5:
SP6: - - -
SP7: - - -
SP8: - -
SP9: -
SP10:
SP11: - - - -
SP12: - - - -
SP13: -
SP14:
SP15: - - -
SP16:
SP17:
SP18: - -
SP19:
SP20:
SP21: -

ExUns: 14a · 14b · 14c · 14d ^ 15a · 15b ^ 16a · 16b ^ 17a · 17b · 17c · 17d ^ 18 ^ 19 ^ 20a · 20b · 20c
SP1: - -
SP2: - - - - - - - -
SP3: - - - - - - - -
SP4: - -
SP5: - - - - - - - -
SP6: - -
SP7:
SP8:
SP9: - - - - - - - -
SP10: - - - - - -
SP11:
SP12:
SP13:
SP14: - - -
SP15: -
SP16: -
SP17: -
SP18:
SP19:
SP20:
SP21:

Relevant External Links for ZC3H14 Gene

GeneLoc Exon Structure for
ZC3H14
ECgene alternative splicing isoforms for
ZC3H14

Expression for ZC3H14 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ZC3H14 Gene

mRNA differential expression in normal tissues according to GTEx for ZC3H14 Gene

This gene is overexpressed in Testis (x4.2).

Protein differential expression in normal tissues from HIPED for ZC3H14 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (16.6), Testis (9.5), and Breast (8.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ZC3H14 Gene



Protein tissue co-expression partners for ZC3H14 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ZC3H14 Gene:

ZC3H14

SOURCE GeneReport for Unigene cluster for ZC3H14 Gene:

Hs.686171

mRNA Expression by UniProt/SwissProt for ZC3H14 Gene:

Q6PJT7-ZC3HE_HUMAN
Tissue specificity: Isoform 1 and isoform 6 are expressed in fetal and adult brain. Isoform 1 and isoform 6 are expressed in fetal and adult temporal lobe.

Evidence on tissue expression from TISSUES for ZC3H14 Gene

  • Liver(4.3)
  • Skin(4.3)
  • Muscle(4.2)
  • Nervous system(4)
  • Lung(2.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ZC3H14 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Organs:
Head and neck:
  • brain
  • cerebellum
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • skull
  • tooth
Thorax:
  • chest wall
  • heart
Abdomen:
  • abdominal wall
Limb:
  • foot
  • lower limb
General:
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
genes like me logo Genes that share expression patterns with ZC3H14: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for ZC3H14 Gene

Orthologs for ZC3H14 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for ZC3H14 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ZC3H14 33 34
  • 99.82 (n)
dog
(Canis familiaris)
Mammalia ZC3H14 33 34
  • 93.88 (n)
mouse
(Mus musculus)
Mammalia Zc3h14 33 16 34
  • 90.61 (n)
rat
(Rattus norvegicus)
Mammalia Zc3h14 33
  • 90.61 (n)
cow
(Bos Taurus)
Mammalia ZC3H14 33 34
  • 88.92 (n)
oppossum
(Monodelphis domestica)
Mammalia ZC3H14 34
  • 82 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 75 (a)
OneToMany
-- 34
  • 65 (a)
OneToMany
chicken
(Gallus gallus)
Aves ZC3H14 33 34
  • 72.23 (n)
lizard
(Anolis carolinensis)
Reptilia ZC3H14 34
  • 68 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia zc3h14 33
  • 59.29 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.23969 33
zebrafish
(Danio rerio)
Actinopterygii zc3h14 33 34
  • 57.08 (n)
Dr.13570 33
fruit fly
(Drosophila melanogaster)
Insecta Nab2 34
  • 20 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea sut-2 34
  • 20 (a)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes NAB2 36
Species where no ortholog for ZC3H14 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ZC3H14 Gene

ENSEMBL:
Gene Tree for ZC3H14 (if available)
TreeFam:
Gene Tree for ZC3H14 (if available)

Paralogs for ZC3H14 Gene

Pseudogenes.org Pseudogenes for ZC3H14 Gene

genes like me logo Genes that share paralogs with ZC3H14: view

No data available for Paralogs for ZC3H14 Gene

Variants for ZC3H14 Gene

Sequence variations from dbSNP and Humsavar for ZC3H14 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs571303442 pathogenic, Mental retardation, autosomal recessive 56 88,610,948(+) TTCAAATTCGTTTTTCTCATGTCAGTTCAAATTC/TTCAAATTC genic_downstream_transcript_variant, intron_variant
rs886037950 pathogenic, Mental retardation, autosomal recessive 56 88,572,606(+) C/T coding_sequence_variant, genic_upstream_transcript_variant, stop_gained
rs10682918 likely-benign, not provided 88,571,139(+) /A/AT/ATT genic_upstream_transcript_variant, intron_variant
rs144601125 likely-benign, not specified 88,572,890(+) T/C coding_sequence_variant, genic_upstream_transcript_variant, synonymous_variant
rs1469602 likely-benign, not specified 88,575,836(+) T/A/G genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ZC3H14 Gene

Variant ID Type Subtype PubMed ID
esv2748994 CNV deletion 23290073
esv2748995 CNV deletion 23290073
esv2748997 CNV deletion 23290073
esv3635277 CNV gain 21293372
nsv1049685 CNV gain 25217958
nsv1108915 CNV deletion 24896259
nsv456391 CNV gain 19166990
nsv565512 CNV gain 21841781
nsv820243 CNV gain 19587683

Variation tolerance for ZC3H14 Gene

Residual Variation Intolerance Score: 9.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.56; 30.11% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ZC3H14 Gene

Human Gene Mutation Database (HGMD)
ZC3H14
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ZC3H14

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ZC3H14 Gene

Disorders for ZC3H14 Gene

MalaCards: The human disease database

(2) MalaCards diseases for ZC3H14 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, and GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal recessive 56
  • mrt56
autosomal recessive non-syndromic intellectual disability
  • autosomal recessive mental retardation
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

ZC3HE_HUMAN
  • Mental retardation, autosomal recessive 56 (MRT56) [MIM:617125]: A form of mental retardation, a disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. {ECO:0000269 PubMed:21734151}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ZC3H14

genes like me logo Genes that share disorders with ZC3H14: view

No data available for Genatlas for ZC3H14 Gene

Publications for ZC3H14 Gene

  1. Antigens recognized by autologous antibody in patients with renal-cell carcinoma. (PMID: 10508479) Scanlan MJ … Old LJ (International journal of cancer 1999) 2 3 4 58
  2. Identification of a Nuclear Exosome Decay Pathway for Processed Transcripts. (PMID: 27871484) Meola N … Jensen TH (Molecular cell 2016) 3 4 58
  3. A conserved role for the zinc finger polyadenosine RNA binding protein, ZC3H14, in control of poly(A) tail length. (PMID: 24671764) Kelly SM … Corbett AH (RNA (New York, N.Y.) 2014) 3 4 58
  4. Mutation of the conserved polyadenosine RNA binding protein, ZC3H14/dNab2, impairs neural function in Drosophila and humans. (PMID: 21734151) Pak C … Kuss AW (Proceedings of the National Academy of Sciences of the United States of America 2011) 3 4 58
  5. Splice variants of the human ZC3H14 gene generate multiple isoforms of a zinc finger polyadenosine RNA binding protein. (PMID: 19303045) Leung SW … Corbett AH (Gene 2009) 3 4 58

Products for ZC3H14 Gene

Sources for ZC3H14 Gene

Content
Loading form....