Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ZBTB2 Gene

protein-coding   GIFtS: 48
GCID: GC06M151685

zinc finger and BTB domain containing 2

 Explore 3 diseases affiliated with
ZBTB2 via our new
 Human Malady Compendium 
Biological research products
for ZBTB2
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Zinc Finger And BTB Domain Containing 21 2
ZNF4371 2 3
KIAA14831 3
BA351K16.21
Zinc Finger And BTB Domain-Containing Protein 22

External Ids:    HGNC: 208681   Entrez Gene: 576212   Ensembl: ENSG000001814727   UniProtKB: Q8N6803   

Export aliases for ZBTB2 gene to outside databases

Previous GC identifers: GC06M151640 GC06M151716 GC06M151777 GC06M151726 GC06M149247


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: ZBTB2_HUMAN, Q8N680
Function: May be involved in transcriptional regulation




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000006.11  NC_018917.1  NT_025741.15  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ZBTB2 gene promoter:
         Sox5   POU3F1   SRY   POU2F1   HSF2   POU2F1b   POU2F1a   Sox9   POU2F1c   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidZBTB2 promoter sequence
   Search SABiosciences Chromatin IP Primers for ZBTB2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZBTB2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 6q25.1   Ensembl cytogenetic band:  6q25.1   HGNC cytogenetic band: 6q25.1

ZBTB2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ZBTB2 gene location

GeneLoc information about chromosome 6         GeneLoc Exon Structure

GeneLoc location for GC06M151685:  view genomic region     (about GC identifiers)

Start:
151,685,250 bp from pter      End:
151,712,683 bp from pter
Size:
27,434 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ZBTB2_HUMAN, Q8N680 (See protein sequence)
Recommended Name: Zinc finger and BTB domain-containing protein 2  
Size: 514 amino acids; 57337 Da
Subcellular location: Nucleus (Potential)
Secondary accessions: A8K7C7 Q5SZ81 Q9P245

Explore the universe of human proteins at neXtProt for ZBTB2: NX_Q8N680

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q8N680

  • ZBTB2 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_065912.1  
    ENSEMBL proteins: 
     ENSP00000323183  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: ZBTB2
    OriGene Protein Over-expression Lysate: ZBTB2
    OriGene Custom Protein Services for ZBTB2 
    GenScript Custom Purified and Recombinant Proteins Services for ZBTB2
    Novus Biologicals ZBTB2 Protein
    Novus Biologicals ZBTB2 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for ZBTB2

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--


    ZBTB2 for ontologies           About GeneDecksing



    ZBTB2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ZBTB2 
    GenScript Custom Superior Antibodies Services for ZBTB2
    Novus Biologicals ZBTB2 Antibodies
    Search for Antibodies for ZBTB2 at Abcam  
    Uscn Antibodies for ZBTB2
    ThermoFisher Antibodies for ZBTB2

    Assay Products for ZBTB2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ZBTB2
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for ZBTB2


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ZBTB2 for domains           About GeneDecksing

    5/6 InterPro domains/families (see all 6):
     IPR015880 Znf_C2H2-like
     IPR011333 BTB/POZ_fold
     IPR013087 Znf_C2H2/integrase_DNA-bd
     IPR013069 BTB_POZ
     IPR000210 BTB/POZ-like

    Graphical View of Domain Structure for InterPro Entry Q8N680

    ProtoNet protein and cluster: Q8N680

    1 Blocks protein family: IPB000210 BTB/POZ domain

    UniProtKB/Swiss-Prot: ZBTB2_HUMAN, Q8N680
    Similarity: Contains 1 BTB (POZ) domain
    Similarity: Contains 4 C2H2-type zinc fingers


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: ZBTB2_HUMAN, Q8N680
    Function: May be involved in transcriptional regulation

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: ZBTB2
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZBTB2
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate ZBTB2 (see all 13):
    hsa-miR-3163 hsa-miR-548am hsa-miR-146a hsa-miR-130a* hsa-miR-23c hsa-miR-1284 hsa-miR-153 hsa-miR-23b
    SwitchGear 3'UTR luciferase reporter plasmidZBTB2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZBTB2 (see all 7)
    OriGene shRNA RFP: ZBTB2
    Browse OriGene siRNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZBTB2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ZBTB2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ZBTB2 (NM_006977)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZBTB2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZBTB2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ZBTB2
    Search LifeMap BioReagents cell lines for ZBTB2

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZBTB2

    Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003677DNA binding IEA--
    GO:0008270zinc ion binding IEA--


    ZBTB2 for ontologies           About GeneDecksing


    7 GenomeRNAi human phenotypes for ZBTB2:
     Decreased Wnt reporter activit  Decreased influenza A H1N1 (A/  Decreased influenza A/WSN/33 r  Decreased p24 protein expressi 
     Increased cell death HMECs cel  Increased gamma-H2AX phosphory  Metaphase cells 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for ZBTB2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 7)

    5/7 Interacting proteins for ZBTB2 (Q8N6803 ENSP000003231834) via UniProtKB, MINT, STRING, and/or I2D (see all 7)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TP53P046373, ENSP000002693054I2D: score=1 STRING: ENSP00000269305
    SUMO2P619563, ENSP000004059654I2D: score=1 STRING: ENSP00000405965
    WDR48Q8TAF33, ENSP000003074914I2D: score=2 STRING: ENSP00000307491
    STAT6P422263, ENSP000003001344I2D: score=1 STRING: ENSP00000300134
    CREBBPQ927933, ENSP000002623674I2D: score=2 STRING: ENSP00000262367
    About this table

    Gene Ontology (GO): 2 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006351transcription, DNA-dependent IEA--
    GO:0006355regulation of transcription, DNA-dependent IEA--


    ZBTB2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ZBTB2
    Search CenterWatch for drugs/clinical trials and news about ZBTB2 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ZBTB2 gene: 
    NM_020861.1  

    Unigene Cluster for ZBTB2:

    Zinc finger and BTB domain containing 2
    Hs.520073  [show with all ESTs]
    Unigene Representative Sequence: BC020172
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000325144(uc003qoh.3)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: ZBTB2
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ZBTB2
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate ZBTB2 (see all 13):
    hsa-miR-3163 hsa-miR-548am hsa-miR-146a hsa-miR-130a* hsa-miR-23c hsa-miR-1284 hsa-miR-153 hsa-miR-23b
    SwitchGear 3'UTR luciferase reporter plasmidZBTB2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZBTB2 (see all 7)
    OriGene shRNA RFP: ZBTB2
    Browse OriGene siRNA
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZBTB2
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ZBTB2 (NM_006977)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ZBTB2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZBTB2 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZBTB2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ZBTB2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZBTB2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZBTB2

    Additional cDNA sequence: 

    AB040916.1 AJ420526.1 AK092886.1 AK291942.1 AL832957.1 BC020172.1 

    5 DOTS entries:

    DT.110934  DT.95163737  DT.100748291  DT.100736631  DT.100736632 

    24/68 AceView cDNA sequences (see all 68):

    CB047004 AI689206 AW674826 BI818997 AA446591 BQ581278 AA994297 NM_020861 
    BC020172 BF665643 BU579889 BM681132 AX747790 AA446719 BM727705 AW243652 
    AK092886 AI423715 AL832957 BQ128123 BM828414 CB961287 AI370863 BG333741 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ZBTB2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATAGTTGAG

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    ZBTB2 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    1 LifeMap In Vivo Development Anatomical Compartment/Cell 
    Tissue Anatomical Compartment CellCategory (developmental path)
    PancreasIslets of LangerhansMature Beta CellsPancreas
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See ZBTB2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ZBTB2

    SOURCE GeneReport for Unigene cluster: Hs.520073
        SABiosciences Custom PCR Arrays for ZBTB2
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZBTB2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ZBTB2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZBTB2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZBTB2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZBTB2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for ZBTB2 gene from 4/12 species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves ZBTB21 zinc finger and BTB domain containing 2 82.91(n)
    89.43(a)
      421635  NM_001031070.1  NP_001026241.1 
    lizard
    (Anolis carolinensis)
    Reptilia ZBTB26
    --
    87(a)
    1 ↔ 1
    GL343259.1(1130076-1133649)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.13432 Xenopus laevis transcribed sequence with weak similarity more 77.22(n)    BJ043335.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufc05d082 Danio rerio mRNA similar to KIAA1483 protein (cDNA more 76.85(n)    BC049490.1 


    ENSEMBL Gene Tree for ZBTB2 (if available)
    TreeFam Gene Tree for ZBTB2 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ZBTB2 gene
    ZBTB252  ZBTB12  
    2 SIMAP similar genes for ZBTB2 using alignment to 1 protein entry:     ZBTB2_HUMAN:
    DKFZp666M0210    ZBTB25

    ZBTB2 for paralogs           About GeneDecksing


    1 Pseudogenes.org Pseudogene for ZBTB2
    PGOHUM00000244612


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/15 NCBI SNPs in ZBTB2 are shown (see all 15    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 6 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1825477831,2
    --151684772(+) ATAAGC/TATGGA 1 -- int10--------
    rs122341641,2
    H--151684841(+) GAAAAC/GGACTC 1 -- int14Minor allele frequency- G:0.00NS EA 420
    rs1855263411,2
    --151684882(+) TCCCAC/GCACTT 1 -- int10--------
    rs105716591,2
    C--151685131(+) aaaaa-/AA    
       AAAAA
    aaaaa
    1 -- int11Minor allele frequency- AAAAAAA:0.00NA 2
    rs673153071,2
    C,--151708484(+) CTCAG-/TGTCAACACT
    GAGAAGACATTT
    TGTCA
    1 -- int10--------
    rs571749911,2
    C--151708493(+) AACAC-/TGAGAAGACA
    TTTTGTCAACAC
    AGCGG
    1 -- int11Minor allele frequency- TGAGAAGACATTTTGTCAACAC:0.00NA 2
    rs792963831,2
    C,--151708493(+) AACACA/TGAGAA 1 -- int10--------
    rs763921201,2
    C--151708497(+) CTGAGA/GAGACA 1 -- int10--------
    rs1837268531,2
    --151708518(+) ACAGCA/GGAAAA 1 -- int10--------
    rs58809291,2
    C,--151711485(+) CCCCC-/GTCCCT 1 -- int1 trp30--------

    HapMap Linkage Disequilibrium report for ZBTB2 (151685250 - 151712683 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for ZBTB2: --

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZBTB2
    DNA2.0 Custom Variant and Variant Library Synthesis for ZBTB2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    ZBTB2 for disorders           About GeneDecksing

    3 diseases for ZBTB2:    About MalaCards
    chronic myeloid leukemia    myeloid leukemia    leukemia

    Human Genome Epidemiology (HuGE) Navigator: ZBTB2 (1 document)

    Export disorders for ZBTB2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ZBTB2 gene, integrated from 9 sources (see all 17):
    (articles sorted by number of sources associating them with ZBTB2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Prediction of the coding sequences of unidentified human genes. XVII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 10819331)1, 2, 3 Nagase T.... Ohara O. (2000)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    4. The DNA sequence and analysis of human chromosome 6. (PubMed id 14574404)1, 2 Mungall A.J.... Beck S. (2003)
    5. NOTCH1 nuclear interactome reveals key regulators of i ts transcriptional activity and oncogenic function. (PubMed id 23022380)1 Yatim A....Benkirane M. (2012)
    6. A genome-wide association study identifies novel loci associated with susceptibility to chronic myeloid leukemia. (PubMed id 21540461)1 Kim D.H....Lipton J.H. (2011)
    7. Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)1 Danielsen J.M....Nielsen M.L. (2011)
    8. Comparative proteomic analysis identifies a role for S UMO in protein quality control. (PubMed id 21693764)1 Tatham M.H....Hay R.T. (2011)
    9. An atlas of combinatorial transcriptional regulation in mouse and man. (PubMed id 20211142)1 Ravasi T....Hayashizaki Y. (2010)
    10. System-wide changes to SUMO modifications in response to heat shock. (PubMed id 19471022)1 Golebiowski F....Hay R.T. (2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 57621 HGNC: 20868 AceView: ZBTB2 Ensembl:ENSG00000181472 euGenes: HUgn57621
    ECgene: ZBTB2 H-InvDB: ZBTB2

    (According to HUGE)
    About This Section
    HUGE: KIAA1483

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ZBTB2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ZBTB2 gene:
    Search GeneIP for patents involving ZBTB2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for ZBTB2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ZBTB2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ZBTB2  
     OriGene Protein Over-expression Lysate for ZBTB2   Browse OriGene Fluorogenic Cell Assay Kits  
     Browse OriGene siRNAs   OriGene 3'-UTR Clone for ZBTB2  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ZBTB2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for ZBTB2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ZBTB2   OriGene Custom Protein Services for ZBTB2  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ZBTB2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ZBTB2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ZBTB2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ZBTB2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ZBTB2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ZBTB2
     GenScript Custom Purified and Recombinant Proteins Services for ZBTB2 GenScript cDNA clones with any tag delivered in your preferred vector for ZBTB2
     GenScript Custom Assay Services for ZBTB2 GenScript Custom Superior Antibodies Services for ZBTB2
     GenScript Custom overexpressing Cell Line Services for ZBTB2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ZBTB2 promoter
     Search Chromatin IP Primers for ZBTB2
     RT2 qPCR Primer Assay in human, mouse, rat ZBTB2
     Search GNC Networks for ZBTB2
     SABiosciences Custom PCR Arrays for ZBTB2
     Search Tocris compounds for ZBTB2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ZBTB2 antibodies
     ZBTB2 proteins
     ZBTB2 lysates
     Search for Antibodies for ZBTB2 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for ZBTB2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     ZBTB2 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for ZBTB2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ZBTB2
     SwitchGear 3'UTR luciferase reporter plasmids for ZBTB2
     SwitchGear Promoter luciferase reporter plasmids for ZBTB2
     ThermoFisher Antibodies for ZBTB2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ZBTB2
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ZBTB2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4