Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

XRCC3 Gene

protein-coding GIFtS: 60
GCID: GC14M104163

X-ray repair complementing defective repair in Chinese hamster...

Explore 86 diseases affiliated with
XRCC3 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 3¹ ²
X-Ray Repair Cross-Complementing Protein 3² ³
CMM6² ⁵
DNA Repair Protein XRCC3²

External Ids:	HGNC: 12830¹	Entrez Gene: 7517²	Ensembl: ENSG00000126215⁷	OMIM: 600675⁵	UniProtKB: O43542³

Export aliases for XRCC3 gene to outside databases

Previous GC identifers: GC14M101555 GC14M097979 GC14M102153 GC14M103233 GC14M084342

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for XRCC3:

This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to

maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a

repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is

chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of

varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified.

(provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542

Function: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair

chromosomal fragmentation, translocations and deletions. Plays a role in regulating mitochondrial DNA copy number

under conditions of oxidative stress in the presence of RAD51 and RAD51C

Gene Wiki entry for XRCC3

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000014.8 NC_018925.1 NT_026437.12

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the XRCC3 gene promoter:
CHOP-10 GR PPAR-gamma1 p53 GR-beta PPAR-gamma2 GR-alpha C/EBPalpha
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: XRCC3 promoter sequence

Search SABiosciences Chromatin IP Primers for XRCC3

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat XRCC3

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 14q32.3 Ensembl cytogenetic band: 14q32.33 HGNC cytogenetic band: 14q32.3

XRCC3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
XRCC3 gene location

GeneLoc information about chromosome 14 GeneLoc Exon Structure

GeneLoc location for GC14M104163: view genomic region (about GC identifiers)

Start:	104,163,946 bp from pter	End:	104,181,841 bp from pter
Size:	17,896 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542 (See protein sequence)

Recommended Name: DNA repair protein XRCC3

Size: 346 amino acids; 37850 Da

Subunit: Interacts with RAD51C and RAD51. Part of a complex consisting of RAD51B, RAD51C, RAD51D, XRCC2 and XRCC3.

Forms a complex with FANCD2, BRCA2 and phosphorylated FANCG. Interacts with SWSAP1 and ZSWIM7; involved in homologous

recombination repair

Subcellular location: Nucleus. Cytoplasm. Cytoplasm, perinuclear region. Mitochondrion. Note=Accumulates in discrete

nuclear foci prior to DNA damage, and these foci persist throughout the time course of DNA repair

Secondary accessions: O43568 Q9BU18

Explore the universe of human proteins at neXtProt for XRCC3: NX_O43542

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_O43542

XRCC3 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (3 alternative transcripts):

NP_001093588.1 NP_001093589.1 NP_005423.1

ENSEMBL proteins:

ENSP00000451362 ENSP00000343392 ENSP00000451974 ENSP00000452598 ENSP00000451361

ENSP00000451118 ENSP00000451252 ENSP00000451173 ENSP00000452389 ENSP00000450780

ENSP00000450738 ENSP00000412990

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate (see all 5): XRCC3 OriGene Custom Protein Services for XRCC3
	GenScript Custom Purified and Recombinant Proteins Services for XRCC3
	Novus Biologicals XRCC3 Proteins Novus Biologicals XRCC3 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for XRCC3

Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	IDA	16215984
GO:0005737	cytoplasm	IDA	16215984
GO:0005739	mitochondrion	IDA	--
GO:0048471	perinuclear region of cytoplasm	IDA	16215984

XRCC3 for ontologies About GeneDecksing

XRCC3 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	OriGene Antibodies (see all 3): XRCC3 OriGene Custom Antibody Services for XRCC3
	GenScript Custom Superior Antibodies Services for XRCC3
	Novus Biologicals XRCC3 Antibodies
	Abcam antibodies for XRCC3
	Uscn Antibodies for XRCC3
	ThermoFisher Antibodies for XRCC3

Assay Products for XRCC3:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for XRCC3
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for XRCC3

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

XRCC3 for domains About GeneDecksing

3 InterPro domains/families:

IPR020588 DNA_recomb_RecA/RadB_ATP-bd

IPR016467 DNA_recomb/repair_RecA-like

IPR013632 DNA_recomb/repair_Rad51_C

Graphical View of Domain Structure for InterPro Entry O43542

ProtoNet protein and cluster: O43542

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542

Similarity: Belongs to the RecA family. RAD51 subfamily

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542

Function: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair

chromosomal fragmentation, translocations and deletions. Plays a role in regulating mitochondrial DNA copy number

under conditions of oxidative stress in the presence of RAD51 and RAD51C

Induction: Stress-induced increase in the mitochondrial levels is seen

Genatlas biochemistry entry for XRCC3:

repair X-ray defect,complementing defect in CHO cells,3,involved in recombinational repair,interacting with RAD51 for

maintenance of genomic integrity

miRNA Products:		OriGene 3'-UTR Clone (see all 3): XRCC3 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat XRCC3
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate XRCC3
		SwitchGear 3'UTR luciferase reporter plasmid: XRCC3 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for XRCC3 (see all 4) OriGene shRNA RFP: XRCC3 OriGene siRNA: XRCC3
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat XRCC3

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for XRCC3

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for XRCC3 (see all 5) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for XRCC3 (see all 3) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): XRCC3 (NM_001100118)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for XRCC3
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat XRCC3

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for XRCC3
		Search LifeMap BioReagents cell lines for XRCC3

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for XRCC3

Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003677	DNA binding	IEA	--
GO:0005515	protein binding	IPI	--
GO:0005524	ATP binding	IEA	--
GO:0008094	DNA-dependent ATPase activity	IEA	--

XRCC3 for ontologies About GeneDecksing

2 GenomeRNAi human phenotypes for XRCC3:

Synthetic lethal with cisplati

Upregulation of Wnt/beta-caten

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Fluoropyrimidine Activity

Fluoropyrimidine Activity

1.00

Fluoropyrimidine Pathway, Pharmacodynamics

0.30

Integrated Breast Cancer Pathway

Integrated Breast Cancer Pathway

1.00

Homologous recombination

Homologous recombination

0.38

Pathway sources
See GeneCards unified pathways
Show all pathways

2 BioSystems Pathways for XRCC3

	Integrated Breast Cancer Pathway
	Fluoropyrimidine Activity

1 PharmGKB Pathway for XRCC3

Fluoropyrimidine Pathway, Pharmacodynamics

1 Kegg Pathway (Kegg details for XRCC3):

Homologous recombination

XRCC3 for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for XRCC3

STRING Interaction Network Preview (showing 5 interactants - click image to see 15)

5/15 Interacting proteins for XRCC3 (O43542^{1, 3} ENSP00000343392⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 15)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
FANCG	O15287³, ENSP00000367910⁴	I2D: score=3 STRING: ENSP00000367910
RAD51C	O43502³, ENSP00000336701⁴	I2D: score=3 STRING: ENSP00000336701
BRCA2	P51587³, ENSP00000369497⁴	I2D: score=1 STRING: ENSP00000369497
RAD51	Q06609³, ENSP00000267868⁴	I2D: score=1 STRING: ENSP00000267868
ZNHIT3	Q15649³, ENSP00000225410⁴	I2D: score=1 STRING: ENSP00000225410

About this table

Gene Ontology (GO): 5 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006259	DNA metabolic process	--	--
GO:0006281	DNA repair	IGI	10422536
GO:0006310	DNA recombination	IEA	--
GO:0006974	response to DNA damage stimulus	TAS	7603995
GO:0010033	response to organic substance	IEA	--

XRCC3 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

XRCC3 for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for XRCC3
10/11 Novoseek chemical compound relationships for XRCC3 gene (see all 11) About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
pcb 153	61	9	19069643 (2), 18948301 (1)
mitomycin c	42.3	3	7603995 (1), 17141189 (1)
cisplatin	33.2	8	15843498 (2), 16622263 (1), 17141189 (1)
folate	29	7	19177501 (2), 16997330 (2), 19360465 (1), 15066914 (1) (see all 5)
benzene	20.3	8	18095557 (3), 17535647 (2), 17605237 (2), 16728435 (1)
camptothecin	16.3	2	12584174 (2)
melphalan	13.1	7	11584063 (4), 15843498 (1)
n acetylcysteine	11.7	1	19069643 (1)
p003	1.68	2	12007561 (1), 12865926 (1)
methionine	0	2	17701750 (1), 12223443 (1)

Search CenterWatch for drugs/clinical trials and news about XRCC3

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for XRCC3 gene (3 alternative transcripts):

NM_001100118.1 NM_001100119.1 NM_005432.3

Unigene Clusters for XRCC3:

X-ray repair complementing defective repair in Chinese hamster cells 3

Hs.592325 [show with all ESTs], Hs.733412 [show with all ESTs]

Unigene Representative Sequences: BX368160, AK124498

18/19 Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 19):

ENST00000554913(uc001yoa.4) ENST00000352127(uc001ynz.4) ENST00000554811

ENST00000553264 ENST00000555055(uc001ynx.4 uc001yny.4) ENST00000554974

ENST00000554774 ENST00000555451 ENST00000555832 ENST00000553807 ENST00000557439

ENST00000553361 ENST00000556980 ENST00000555964 ENST00000555231 ENST00000556682

ENST00000553332 ENST00000554170

miRNA Products:		OriGene 3'-UTR Clone (see all 3): XRCC3 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat XRCC3
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate XRCC3
		SwitchGear 3'UTR luciferase reporter plasmid: XRCC3 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for XRCC3 (see all 4) OriGene shRNA RFP: XRCC3 OriGene siRNA: XRCC3
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat XRCC3

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for XRCC3 (see all 5) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for XRCC3 (see all 3) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): XRCC3 (NM_001100118)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for XRCC3
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat XRCC3

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for XRCC3 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat XRCC3
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat XRCC3
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat XRCC3

Additional cDNA sequence:

AF035586.1 AK022829.1 AK023646.1 AK124498.1 AK296465.1 BC001036.1 BC002949.1 BC011725.2

BT007417.1 BX161398.1

19 DOTS entries:

DT.99936700 DT.102838411 DT.100773069 DT.408842 DT.120790634 DT.75146282 DT.92051759 DT.100797026

DT.120790785 DT.100797028 DT.92063298 DT.432421 DT.120790878 DT.91974123 DT.95372736 DT.100693953

DT.100700104 DT.100762829 DT.95372738

24/151 AceView cDNA sequences (see all 151):

BE396817 BM915097 BU182143 BX385078 AU138697 BM682035 AU124974 BM127755

AK022829 BM557723 AK126706 BM128018 CR603680 BX375448 BC073820 BC011725

BC002949 BQ213513 CR610241 CB048579 BC001036 AU118580 CB150648 AL526291

GeneLoc Exon Structure

5/13 Alternative Splicing Database (ASD) splice patterns (SP) for XRCC3 (see all 13) About this scheme

ExUns:	1a	·	1b	^	2	^	3a	·	3b	^	4a	·	4b	·	4c	^	5a	·	5b	^	6a	·	6b	·	6c	·	6d	·	6e	^	7a	·	7b	·	7c	^	8a	·	8b	^	9	^	10	^	11	^	12	^	13
SP1:					-		-		-		-		-								-								-								-		-		-						-
SP2:											-		-								-								-
SP3:					-		-				-		-								-								-
SP4:					-		-		-		-		-								-								-
SP5:											-		-								-								-								-		-		-

ECgene alternative splicing isoforms for XRCC3

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

XRCC3 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: ACTGTGCAGC

About this image
See XRCC3 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for XRCC3

SOURCE GeneReport for Unigene clusters: Hs.592325 Hs.733412

SABiosciences Expression via Pathway-Focused PCR Arrays including XRCC3:

DNA Damage Signaling Pathway in human mouse rat

DNA Repair in human mouse rat

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for XRCC3 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat XRCC3
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat XRCC3
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat XRCC3

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for XRCC3

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of eukaryotes.

Orthologs for XRCC3 gene from 6/21 species (see all 21) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	XRCC3¹	X-ray repair complementing defective repair in Chinese more	62.34(n) 62.24(a)		423485 NM_001006489.1 NP_001006489.1
lizard (Anolis carolinensis)	Reptilia	XRCC3⁶	--	56(a)	1 ↔ 1	1(6025876-6038869)
zebrafish (Danio rerio)	Actinopterygii	xrcc3¹	X-ray repair complementing defective repair in Chinese more	57.97(n) 53.33(a)		541414 NM_001013541.1 NP_001013559.1
fruit fly (Drosophila melanogaster)	Insecta	spn-B¹	spindle B	47.06(n) 39.92(a)		41746 NM_057392.4 NP_476740.1
thale cress (Arabidopsis thaliana)	eudicotyledons	XRCC3¹	DNA repair protein XRCC3-like protein	42.4(n) 36.4(a)		835850 NM_125127.2 NP_200554.1
rice (Oryza sativa)	Liliopsida	Os02g0562100¹	hypothetical protein	49.65(n) 39.33(a)		4329686 NM_001053685.1 NP_001047150.1

ENSEMBL Gene Tree for XRCC3 (if available)
TreeFam Gene Tree for XRCC3 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 14 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs861539^1,2	C,F,H,	other	85419791(-)	`GGCCAC/TGCTGC`	6	T M	mis¹		34		NS MN EU NA EA WA CSA	7595
rs28903080^1,2	C	--	84343772(-)	`CACACG/AGGCCG`	6	/R /G	mis¹ ese³		2		EU NA	194
rs79874791^1,2		--	84344044(+)	`CGCAGC/AGTGGC`	6	/T	syn¹		1		NA	3698
rs3212092^1,2	C,F,H,	--	84346937(-)	`CAGCTC/TAGACA`	3	--	int¹		9		NS EA NA	916
rs861534^1,2	C,F,H,	--	84346994(-)	`AAGACG/AGCCCT`	3	--	int¹		19		NS NA EA WA CSA	1068
rs3212089^1,2	C,F,H,	--	84347310(-)	`GCTGCG/AACACC`	3	--	int¹		11		NS EA NA WA	1392
rs3212087^1,2	C,F,H,	--	84347404(-)	`ATGGGC/TCTAGG`	3	--	int¹		6		NS EA WA	716
rs78468287^1,2		--	84347462(+)	`TGTAGC/GAGGAC`	3	--	int¹		1		WA	118
rs80224407^1,2	F,	--	84347650(+)	`TCCTCG/AGGCGT`	3	--	int¹		1		WA	118
rs28903079^1,2	C	--	84347872(-)	`ACTGAC/TGTTCC`	6	D	syn¹ ese³		2		EU NA	3590
rs56036704^1,2	C,	--	84348023(+)	`CAAATA/CAAGTG`	3	--	int¹		0	--	--	--	--
rs3212086^1,2	C,	--	84348124(-)	`GCCAGT/GGGGAG`	3	--	int¹		2		NS WA	298
rs3212085^1,2	C,	--	84348140(-)	`GGCCCC/TGGAGG`	3	--	int¹		1		NS	180
rs35341122^1,2	C,F	--	84348198(+)	`CCAGGC/TAAGGA`	3	--	int¹		4		NA	98
rs77743288^1,2	F,	--	84348256(+)	`CTCTCC/TTGCTC`	3	--	int¹		1		NA	120
rs59092643^1,2	C	--	84348282(+)	`TCCCCCT/-GTGAA`	3	--	int¹		1		NA	2
rs3212082^1,2	C,H	--	84348305(-)	`GCCCTG/ACAGTG`	3	--	int¹		5		NS EA	594
rs3212081^1,2	C,F,H,	--	84348435(-)	`ATGGAG/ACCCAG`	3	--	int¹		6		NS EA NA	716
rs72561465^1,2	F	--	84348675(-)	`GGGCCG/ATCTCC`	3	--	int¹		5		MN	400
rs3212079^1,2	C,F,H,	--	84348758(-)	`ACTGCC/TTTCCC`	3	--	int¹ trp³		23		NS EA NA MN WA	2312
rs72561466^1,2	F,	--	84348795(-)	`GTTTTC/TGAGGT`	3	--	int¹		6		MN EA	520
rs3212078^1,2	C,F,H,	--	84348847(-)	`GTGCAG/ACCGGA`	3	--	int¹		19		NS MN EA NA WA	2288
rs3212077^1,2	C,F,H,	--	84349027(-)	`ATAAAT/CTCAGT`	3	--	int¹		6		NS EA NA	712
rs3212074^1,2	F	--	84349272(-)	`gcactTTGGGAGGCCGAGGCTG AGGCAGGCGGATCAT/-gaagt`	3	--	int¹		1		NS	180
rs3212073^1,2	C,F,H	--	84349484(-)	`GCTCGC/TCGGCC`	3	--	int¹		5		NS EA	590
rs3212072^1,2	C,F,O,H,	--	84349491(-)	`TTAGAG/AAGCTC`	3	--	int¹		9		NS NA WA	1258
rs3212071^1,2	C,H,	--	84349544(-)	`GCCCCG/ATGGGC`	3	--	int¹		6		NS EA WA	706
rs79532168^1,2	C,F,	--	84349549(+)	`CGGGGC/TGTCGT`	3	--	int¹		1		EA	120
rs3212070^1,2	C,O	--	84349636(-)	`GTTACG/ACGGAC`	3	--	int¹		3		NS NA	184
rs3212069^1,2	C	--	84349698(-)	`TTTTT-/TGCAAC`	3	--	int¹		1		NS	176
rs73363082^1,2	C,	--	84349762(+)	`TCTGGC/TCCGCT`	3	--	int¹		2		WA	120
rs3212068^1,2	C,F,H,	--	84350051(-)	`TGGGCT/CGTCCA`	3	--	int¹		10		NS NA	1756
rs3212067^1,2	C,F,	--	84350061(-)	`CGCCCA/GCCGCT`	3	--	int¹		1		NS	168
rs3212066^1,2	C,O,H,	--	84350159(-)	`AGGCCC/TGAATT`	3	--	int¹		5		NS EA	584
rs7159303^1,2	C,H	--	84350182(+)	`CAGGAA/TAGGAA`	3	--	int¹ trp³		4		NS EA	420
rs3212065^1,2	C,H	--	84350480(-)	`GCCGCC/TCTCAT`	3	--	int¹		5		NS EA	584
rs3212064^1,2	C,F,H,	--	84350546(-)	`TTACCG/CCACGG`	3	--	int¹		22		NS EA NA WA	2748
rs3212063^1,2	C,H,	--	84350871(-)	`GCAGCG/AGTGTG`	3	--	int¹		5		NS EA	582
rs3212061^1,2	C,F,	--	84351170(-)	`AAAGCA/C/GTTCAG`	3	--	int¹		3		NS WA NA	418
rs74085269^1,2	C,	--	84351289(+)	`GCCCTC/TCCTGC`	3	--	int¹		1		WA	2
rs3212058^1,2	C,F,	--	84351353(-)	`AGCACA/GGCGAT`	3	--	int¹		4		NS CSA WA EA	421
rs55650682^1,2	C,F,	--	84351477(+)	`CTGTTC/GTGGAA`	3	--	int¹		1		EA	120
rs72563150^1,2	F	--	84351573(-)	`GTGGGA/GCAGCT`	3	--	int¹		5		MN	404
rs3212056^1,2	C,F,	--	84351917(-)	`TGACCA/GTGCCT`	3	--	int¹		8		NS MN CSA WA	693
rs3212055^1,2	C,H	--	84351959(-)	`GGCACC/TTGTGC`	3	--	int¹		5		NS EA	586
rs3212054^1,2	C,F,H,	--	84352116(-)	`AAGGCG/TTCTGG`	3	--	int¹		5		NS NA	562
rs3212052^1,2	C,F,	--	84352156(-)	`TGTTAG/CGGAGC`	3	--	int¹		3		NS CSA WA	284
rs78815073^1,2	F,	--	84352258(+)	`GGCGCG/ACACAC`	3	--	int¹		2		WA EA	238
rs2368557^1,2	F,	--	84352382(+)	`GACACC/TGAAGC`	3	--	int¹		1		WA	118
rs3212050^1,2	C,F,	--	84352443(-)	`AGGCCC/TCAGGC`	3	--	int¹		2		NS WA	262
rs78399863^1,2		--	84352701(+)	`TGCTGA/CGATGC`	3	--	int¹		0	--	--	--	--
rs79992295^1,2	C,F,	--	84352734(+)	`NNNNCG/ACATGG`	3	--	int¹		1		NA	120
rs3212049^1,2	C,F,	--	84352930(-)	`GTGGGA/GCCTCC`	3	--	int¹		4		NS CSA WA EA	418
rs79193794^1,2	C,	--	84352940(-)	`GACAC-/AGGGGCT`	3	--	int¹		0	--	--	--	--
rs3212048^1,2	C,F,	--	84352941(-)	`GACAC-/AGGGGCT`	3	--	int¹		2		NS CSA	180
rs55856027^1,2	C	--	84353062(+)	`CTGGG-/TGAAGTCTGCACAGCCCCTGCCCTGCACCAC TGGGACCATGATGCTGGAGCCACATGTCACCCCTGAAG`	3	--	int¹		0	--	--	--	--
rs17101784^1,2	F	--	84353090(-)	`CCAGTG/AGTGCA`	3	--	int¹		1		MN	184
rs3212045^1,2	C	--	84353213(-)	`AGCCCC/TGAGGT`	6	P	syn¹ ese³		2		NS NA	176
rs3212044^1,2	C,F	--	84353324(-)	`AGTCT-/TGACAT`	3	--	int¹		1		NS	180
rs56085575^1,2	C,	--	84353359(+)	`CAAAAG/AGTGCT`	3	--	int¹		2		CSA WA	120
rs3212043^1,2	C,F,H,	--	84353664(-)	`CCTGCC/TCCCTT`	3	--	int¹		5		NS NA WA	612
rs77674351^1,2	F,	--	84353665(+)	`AGGGGG/ACAGGA`	3	--	int¹		1		WA	118
rs3212042^1,2	C,F,H,	--	84353941(-)	`AGAAAG/ATGATG`	3	--	int¹		4		NS NA	406
rs3212041^1,2	C,F,H,	--	84353969(-)	`TTTGTC/TGTCTT`	3	--	int¹		6		NS NA	868
rs113810186^1,2		--	84354227(+)	`AAAGCA/GCCCCT`	3	--	int¹		1		CSA	1
rs3212040^1,2	C,F,H,	--	84354654(-)	`AGCTAC/TGTGAA`	3	--	int¹		7		NS NA CSA	690
rs76047595^1,2	F,	--	84354772(+)	`GTTTTG/CAGCAT`	3	--	int¹		1		EA	120
rs11622220^1,2	C,A,H,	--	84355108(+)	`gctcaC/Tgcctg`	3	--	int¹		0	--	--	--	--
rs11626482^1,2	C,H,	--	84355109(+)	`ctcatG/Tcctgt`	3	--	int¹		0	--	--	--	--
rs200969872^1,2	C	--	84355485(+)	`GTTAAA/GAACAC`	3	--	int¹		0	--	--	--	--
rs56314050^1,2	C,F,	--	84355944(+)	`CATGTC/TTGTCA`	3	--	int¹		1		WA	118
rs55653926^1,2	C,	--	84356264(+)	`TCAGTC/GGCCCC`	3	--	int¹		3		CSA WA EA	240
rs3212039^1,2	C,F,H,	--	84356372(-)	`GCTCGG/CGCTGT`	3	--	int¹		5		NS EA	596
rs3212037^1,2	C	--	84356563(-)	`GACCCG/AGCCCT`	3	--	int¹		3		NS NA	182
rs55729369^1,2	C,F,	--	84357227(+)	`CTCGCA/GCCTGG`	3	--	int¹		1		WA	118
rs3212035^1,2	C,F,H,	--	84357420(-)	`TTCCCG/AGTGCT`	3	--	int¹		3		NS MN NA	462
rs45603942^1,2	C	--	84357542(-)	`GGAGCC/TGGACT`	3	--	ut5¹ int¹		0	--	--	--	--
rs34100926^1,2	C,F,	--	84357657(-)	`CAGCTG/ATCAAG`	3	--	int¹		5		MN	400
rs3212032^1,2	H	--	84357811(-)	`GCCATG/TGGCTG`	3	--	int¹		5		NS EA	528
rs3212031^1,2	C,F,H,	--	84357989(-)	`CTCCCA/GGGCCA`	3	--	int¹		13		NS EA NA WA	1718
rs78449177^1,2	F,	--	84358102(+)	`GAGCAG/CCCCAC`	3	--	int¹		1		EA	120
rs3212030^1,2	C,F,H,	--	84358234(-)	`CTAACA/CGCTCT`	3	--	int¹		4		NS NA	354
rs78710941^1,2	F,	--	84358557(+)	`GAAGGT/CTGTGC`	3	--	int¹		1		WA	118
rs3212029^1,2	H	--	84358636(-)	`GAGAGC/TGGGAG`	3	--	int¹		5		NS EA	578
rs80196178^1,2	F,	--	84358666(+)	`AGGCAA/CACCTC`	3	--	int¹		2		WA EA	238
rs3212028^1,2	C,F,H,	--	84358703(-)	`NNNNGG/AGCCCC`	3	--	int¹		14		NS NA	1724
rs3212026^1,2	C,F,H,	--	84358910(-)	`AATAAG/AGAGAT`	3	--	int¹		14		NS NA WA	1746
rs3212025^1,2	C,F,H	--	84358956(-)	`CTCTCC/TTGGGG`	3	--	int¹		6		NS EA NA	662
rs114065969^1,2	C,F,	--	84359635(+)	`CTAAAG/AGATTT`	3	--	int¹		2		WA EA	238
rs3212021^1,2	F	--	84361186(-)	`ACTGGG/ATCCTG`	3	--	us2k¹		1		NS	172
rs861528^1,2	C,F,H,	--	84361308(-)	`CCCATG/AGGAAA`	3	--	us2k¹		28		MN NS EA NA WA	3484
rs76151641^1,2	F,	--	84361405(+)	`CTCCCG/ATGGGG`	3	--	us2k¹		1		WA	118
rs112965173^1,2	C,	--	84361735(+)	`GTGAGC/TGGCCA`	3	--	us2k¹		1		NA	2
rs36209111^1,2	C,	--	84361850(-)	`CACTGC/GTCTCA`	3	--	us2k¹		0	--	--	--	--
rs79995511^1,2	F,	--	84361966(+)	`GAAAAT/CTGTAT`	3	--	us2k¹		1		WA	118
rs74085271^1,2	C,	--	84362013(+)	`TCTACG/ATCTGT`	3	--	us2k¹		2		WA	120
rs186258504^1,2		--	104168454(+)	`CTGCTA/GCCCCA`	3	--	int¹		0	--	--	--	--
rs139232122^1,2		--	104168546(+)	`GCTCTC/TTGCAA`	3	--	int¹		0	--	--	--	--
rs149958234^1,2		--	104168587(+)	`AGCCAA/GTGTCT`	3	--	int¹		0	--	--	--	--
rs144189745^1,2		--	104168651(+)	`GCTGGA/GTGCCC`	3	--	int¹		0	--	--	--	--
rs861533^1,2	C,H,	--	104168715(-)	`TTGCCT/CCTGAG`	3	--	int¹		16		EA NA WA CSA	424
rs3212090^1,2	C,F,O,H,	--	104168863(-)	`GTGGGG/AAAGAG`	3	--	int¹ trp³		15		NS NA EA WA	1086
rs190721872^1,2		--	104168978(+)	`GAACAC/TGCTTC`	3	--	int¹		0	--	--	--	--
rs144188956^1,2		--	104169040(+)	`CTGCC-/TGGCCCAC`	3	--	int¹		0	--	--	--	--
rs75540731^1,2	C	--	104169219(+)	`GTCCA-/TCCTCCAC`	3	--	int¹		0	--	--	--	--
rs180890906^1,2		--	104169345(+)	`GACCCA/CACCTG`	3	--	int¹		0	--	--	--	--
rs139966574^1,2		--	104169390(+)	`GTTCAG/TAGCTG`	3	--	int¹		0	--	--	--	--
rs200230392^1,2		--	104169516(+)	`ACATCA/GGCCAC`	6	A	syn¹		0	--	--	--	--
rs56288529^1,2	C,F	--	104169551(+)	`AAATCG/AGAGCT`	6	/R /*	stg¹		1		NA	3840
rs143171186^1,2	C	--	104169578(+)	`TGGAAC/TGTCAG`	6	I V	mis¹		1		NA	3420
rs56347206^1,2	C,F,	--	104169593(+)	`CAGCCG/ACGGCT`	6	/R /W	mis¹		2		WA NA	3350
rs199681385^1,2		--	104169595(+)	`GCCGCA/GGCTGC`	6	P L	mis¹		0	--	--	--	--
rs150729160^1,2	C	--	104169623(+)	`CAGGCG/ACTTGT`	6	/R /C	mis¹		1		NA	3046
rs201561134^1,2		--	104169646(+)	`CTTCCA/GTGCAG`	6	T M	mis¹		0	--	--	--	--
rs200567298^1,2		--	104169648(+)	`TCCGTA/GCAGAT`	6	C	syn¹		0	--	--	--	--
rs146507354^1,2	C	--	104169659(+)	`GTAGAC/TGGCTC`	6	I V	mis¹		1		NA	2908
rs200124946^1,2		--	104169664(+)	`CGGCTC/GCTGGG`	6	A G	mis¹		0	--	--	--	--
rs55958706^1,2	C,	--	104169706(+)	`CCAGAC/TGGGCC`	3	--	int¹		0	--	--	--	--
rs184960513^1,2		--	104169806(+)	`GAGGAA/GGCTGG`	3	--	int¹		0	--	--	--	--
rs144969882^1,2	C,	--	104169989(+)	`TCCCC-/CTGTGAA`	3	--	int¹		0	--	--	--	--
rs183400888^1,2		--	104170070(+)	`TGAGCC/GCCGAC`	3	--	int¹		0	--	--	--	--
rs140301053^1,2		--	104170073(+)	`GCCCCA/GACACA`	3	--	int¹		0	--	--	--	--
rs861532^1,2	C,F,A,H,	--	104170341(-)	`GACGTG/TCTTTC`	3	--	int¹ trp³		23		NS EA NA MN WA CSA	1374
rs187941821^1,2		--	104170344(+)	`AGAACA/GTCCAC`	3	--	int¹		0	--	--	--	--
rs144024463^1,2		--	104170534(+)	`TGTCAC/TGAGAC`	3	--	int¹		0	--	--	--	--
rs192072702^1,2		--	104170543(+)	`ACCACA/GTGCTG`	3	--	int¹		0	--	--	--	--
rs150933868^1,2		--	104170552(+)	`TGTCCA/GGCTGC`	3	--	int¹		0	--	--	--	--
rs182887214^1,2		--	104170617(+)	`GGCTGA/CTGGGG`	3	--	int¹		0	--	--	--	--
rs187958121^1,2		--	104170783(+)	`CTGTCA/GCCCAG`	3	--	int¹		0	--	--	--	--
rs3212076^1,2	C,F,	--	104170796(-)	`ACTGCA/GCTCCA`	3	--	int¹		7		NS NA WA CSA	184
rs192432662^1,2		--	104170861(+)	`GCCTCA/GGCCTT`	3	--	int¹		0	--	--	--	--
rs116936449^1,2	F,	--	104170878(+)	`AGCTGG/AGATTA`	3	--	int¹		1		EA	120
rs114107204^1,2	F,	--	104170889(+)	`CAAGGC/TGTGCG`	3	--	int¹		1		WA	118
rs150087722^1,2		--	104170891(+)	`AGGCGA/TGCGCT`	3	--	int¹		0	--	--	--	--
rs184832875^1,2		--	104170945(+)	`TCACCA/CTGTTG`	3	--	int¹		0	--	--	--	--
rs188009977^1,2		--	104170950(+)	`ATGTTG/TGTCAG`	3	--	int¹		0	--	--	--	--
rs192287385^1,2		--	104171024(+)	`GATTAC/TAGGCA`	3	--	int¹		0	--	--	--	--
rs185081644^1,2		--	104171040(+)	`TACTGC/TGCCTA`	3	--	int¹		0	--	--	--	--
rs189396166^1,2		--	104171119(+)	`GGAAGG/TCTTAG`	3	--	int¹		0	--	--	--	--
rs142624551^1,2		--	104171305(+)	`AGTGCC/TCCCAC`	3	--	int¹		0	--	--	--	--
rs181569154^1,2		--	104171311(+)	`CCCACA/GCCGTG`	3	--	int¹		0	--	--	--	--
rs184211865^1,2		--	104171427(+)	`CCCCCA/GCCCCA`	3	--	int¹		0	--	--	--	--
rs146828557^1,2		--	104171500(+)	`TACTGC/TCTTGG`	3	--	int¹		0	--	--	--	--
rs189401301^1,2		--	104171666(+)	`GAACCA/GGTCAA`	3	--	int¹		0	--	--	--	--
rs147092022^1,2	C,	--	104171697(+)	`TGACG-/TTATGT`	3	--	int¹		0	--	--	--	--
rs139208214^1,2		--	104171725(+)	`GGGGAC/GATCGT`	3	--	int¹		0	--	--	--	--
rs181964635^1,2		--	104171769(+)	`GCGGTA/GGGCGG`	3	--	int¹		0	--	--	--	--
rs117171479^1,2		--	104171815(+)	`AAGCAC/TGGGAG`	3	--	int¹		1		NA	120
rs143683616^1,2		--	104171848(+)	`CTGCCA/GCTTTC`	3	--	int¹		0	--	--	--	--
rs148111914^1,2		--	104172004(+)	`CATCCC/TGCAGC`	3	--	int¹		0	--	--	--	--
rs141860992^1,2		--	104172073(+)	`CCCTGA/GGTATC`	3	--	int¹		0	--	--	--	--
rs191183867^1,2		--	104172484(+)	`CCCTCC/TACCCA`	3	--	int¹		0	--	--	--	--
rs180843455^1,2		--	104172520(+)	`ACACCC/TTGGGT`	3	--	int¹		0	--	--	--	--
rs139985944^1,2		--	104172711(+)	`TGCCAC/TTCTGT`	3	--	int¹		0	--	--	--	--
rs141823016^1,2		--	104172744(+)	`TGGGAA/GTCGCA`	3	--	int¹		0	--	--	--	--
rs146247906^1,2		--	104172747(+)	`GAATCA/GCATGT`	3	--	int¹		0	--	--	--	--
rs139263054^1,2		--	104172770(+)	`ATTAGG/TTTAAA`	3	--	int¹		0	--	--	--	--
rs861531^1,2	C,F,O,A,H,	--	104172807(-)	`GTGAGG/TAGGAG`	3	--	int¹ trp³		30		NS MN EA NA WA CSA	3376
rs149905781^1,2		--	104172850(+)	`CACCTA/GAGAGA`	3	--	int¹		0	--	--	--	--
rs3212057^1,2	C,F,H,	--	104173465(-)	`GCTCCG/ACGGTG`	6	/H /R	mis¹ ese³		12		NS MN EA NA	980
rs186566754^1,2		--	104173757(+)	`GTCAGA/GGGGAG`	3	--	int¹		0	--	--	--	--
rs147766261^1,2		--	104173849(+)	`GAGAGC/TCCCGA`	3	--	int¹		0	--	--	--	--
rs190108216^1,2		--	104173851(+)	`GAGCCC/TCGAGG`	3	--	int¹		0	--	--	--	--
rs183113811^1,2		--	104173858(+)	`GAGGCA/GCTCCC`	3	--	int¹		0	--	--	--	--
rs117655774^1,2	F,	--	104173940(+)	`CAAGCG/AGCTTT`	3	--	int¹		1		EA	120
rs77467164^1,2	C	--	104174083(+)	`CTCCAA/CGACAC`	3	--	int¹		0	--	--	--	--
rs861530^1,2	C,F,A,H,	--	104174123(-)	`ACCGCG/ATGTCC`	3	--	int¹		22		EA NA NS WA CSA	1328
rs115125943^1,2		--	104174126(+)	`CATGCG/AGTGCA`	3	--	int¹		1		WA	118
rs115524130^1,2		--	104174137(+)	`GGCTGC/TGCTCT`	3	--	int¹		1		WA	118
rs142651063^1,2		--	104174152(+)	`CTGGGG/TCCTGG`	3	--	int¹		0	--	--	--	--
rs146890075^1,2		--	104174187(+)	`GGAGTA/CTGCAC`	3	--	int¹		0	--	--	--	--
rs118192077^1,2	F,	--	104174549(+)	`CCAGAG/CCCTGA`	3	--	int¹		1		EA	120
rs117168092^1,2	F,	--	104174553(+)	`AGCCTG/AAAGGG`	3	--	int¹		1		EA	120
rs115217262^1,2		--	104174696(+)	`CCCCAT/CGGGTG`	3	--	int¹		1		WA	118
rs150082977^1,2		--	104174725(+)	`AACTC-/TGGGGCT`	3	--	int¹		0	--	--	--	--
rs141797778^1,2		--	104174756(+)	`CTGAGA/GCTGGT`	3	--	int¹		0	--	--	--	--
rs3212047^1,2	C,	--	104174807(-)	`AGCAT-/ATCATGG`	3	--	int¹		1		NS	176
rs1799795^1,2	C,F,H,	--	104174825(-)	`GGTGAC/TATGTG`	3	--	int¹		15		NS MN NA WA EU	2875
rs201949008^1,2		--	104174854(+)	`GCCCAC/TCTACC`	3	--	int¹		0	--	--	--	--
rs139963722^1,2	C,F	--	104174879(+)	`TTCCCC/TGCAAG`	6	Q R	mis¹		1		NA	4538
rs143410843^1,2	C,F	--	104174880(+)	`TCCCCG/ACAAGT`	6	/R /W	mis¹		2		NA EU	5841
rs117761689^1,2	C,	--	104174897(+)	`AGGCCG/ATTCTC`	6	/T /M	mis¹		1		NA	120
rs117048946^1,2		--	104175104(+)	`GCTTCC/TGATTC`	3	--	int¹		1		NA	120
rs150453512^1,2		--	104175186(+)	`GGCACA/GAGGAA`	3	--	int¹		0	--	--	--	--
rs186208130^1,2		--	104175303(+)	`AGCAGA/GTTCCG`	3	--	int¹		0	--	--	--	--
rs190581268^1,2		--	104175339(+)	`CAGTTA/CCATGC`	3	--	int¹		0	--	--	--	--
rs138237026^1,2		--	104175362(+)	`GTGCTC/TCAGAA`	3	--	int¹		0	--	--	--	--
rs116907812^1,2	F,	--	104175415(+)	`CACCAG/AGCATG`	3	--	int¹		1		EA	120
rs149582602^1,2		--	104175438(+)	`GCCGCA/GGGAGA`	3	--	int¹		0	--	--	--	--
rs138410239^1,2	C,	--	104175553(+)	`ACGGC-/GGGGGTGG`	3	--	int¹		0	--	--	--	--
rs143248577^1,2		--	104175640(+)	`GATAAA/GTGCAT`	3	--	int¹		0	--	--	--	--
rs138795043^1,2		--	104175668(+)	`CTTGTA/GGAAAG`	3	--	int¹		0	--	--	--	--
rs141862367^1,2		--	104175675(+)	`AAAGAC/TGACAA`	3	--	int¹		0	--	--	--	--
rs188772708^1,2		--	104175729(+)	`CACACA/GAGAGG`	3	--	int¹		0	--	--	--	--
rs79685155^1,2	C,	--	104175749(+)	`TGGACA/GAAGCG`	3	--	int¹		0	--	--	--	--
rs182373519^1,2		--	104175847(+)	`TTGTGC/TGGCTG`	3	--	int¹		0	--	--	--	--
rs188315387^1,2		--	104175852(+)	`CGGCTA/GGAAAA`	3	--	int¹		0	--	--	--	--
rs191558154^1,2		--	104175915(+)	`TGGAAC/GGGTGG`	3	--	int¹		0	--	--	--	--
rs183896583^1,2		--	104175916(+)	`GGAAGA/GGTGGG`	3	--	int¹		0	--	--	--	--
rs114451091^1,2	F,	--	104176456(+)	`CAGGGG/ACTGCA`	3	--	int¹		1		WA	118
rs189066633^1,2		--	104176685(+)	`CACAGC/GCCCCA`	3	--	int¹		0	--	--	--	--
rs192051924^1,2		--	104176777(+)	`TTTTTA/TAAAAA`	3	--	int¹		0	--	--	--	--
rs185871895^1,2		--	104176799(+)	`ACGGCC/TGGGTG`	3	--	int¹		0	--	--	--	--
rs139532426^1,2		--	104176848(+)	`TGAGGC/TGGGCG`	3	--	int¹		0	--	--	--	--
rs10665352^1,2	C	--	104176924(+)	`ACAAAAAG/-AAAAT`	3	--	int¹		1		CSA	2
rs149685702^1,2		--	104176935(+)	`TAGCCA/GGGCGT`	3	--	int¹		0	--	--	--	--
rs147773483^1,2		--	104176957(+)	`CCTGTA/GGTCCC`	3	--	int¹		0	--	--	--	--
rs185845640^1,2		--	104177074(+)	`ACCCCA/GTCTCC`	3	--	int¹		0	--	--	--	--
rs4900592^1,2	C,F,A,	--	104177098(+)	`TAAAAG/TACTTT`	3	--	int¹		7		NA WA CSA EA	366
rs139961690^1,2	C,	--	104177190(+)	`TAAGA-/ACACACA`	3	--	int¹		0	--	--	--	--
rs71126055^1,2	C	--	104177220(-)	`TTCAGGT/-GTGTG`	3	--	int¹		1		NA	2
rs188203640^1,2		--	104177230(+)	`AAATCC/TCATAG`	3	--	int¹		0	--	--	--	--
rs56377012^1,2	C,F,	--	104177410(+)	`TCCAGT/CAGATC`	6	/L	syn¹		1		EA	120
rs56018633^1,2	C,	--	104177449(+)	`CCAGGA/TTGAAT`	3	--	ut5¹		0	--	--	--	--
rs181386895^1,2		--	104178076(+)	`AGCCCA/GAGCCT`	3	--	int¹		0	--	--	--	--
rs3212038^1,2	C,F,H,	--	104178186(-)	`GGGGAT/CGCAGA`	3	--	int¹		11		NS MN EA NA WA CSA	906
rs114480578^1,2	F,	--	104178252(+)	`GGCAGC/GAGCCT`	3	--	int¹		1		WA	118
rs185674395^1,2		--	104178361(+)	`TTCCCC/TTGGAC`	3	--	int¹		0	--	--	--	--
rs114799020^1,2	F,	--	104178370(+)	`ACCACA/GCAGAA`	3	--	int¹		1		WA	118
rs147966970^1,2		--	104178399(+)	`ACGATC/TACGCT`	3	--	int¹		0	--	--	--	--
rs2307731^1,2	C,F,	--	104178445(-)	`TGTTCTCCACGC CGGGC/-CTGTC`	3	--	int¹		5		EU NA EA NS	520
rs200713073^1,2	C	--	104178445(-)	`TGTTCC/TTNNNN`	3	--	int¹		0	--	--	--	--
rs149002992^1,2		--	104178700(+)	`GGGGCA/GCTGAA`	3	--	int¹		0	--	--	--	--
rs143778656^1,2		--	104178932(+)	`GGACCC/TCACAC`	3	--	int¹		0	--	--	--	--
rs190830951^1,2		--	104179112(+)	`CACCGA/GGAAGG`	3	--	int¹		0	--	--	--	--
rs1799794^1,2	C,F,H,	--	104179267(-)	`GCAGGA/GTGTGC`	3	--	int¹ ut5¹		21		EA NS MN NA CSA WA	3001
rs861529^1,2	C,F,A,	--	104179314(-)	`TCGTCG/ACTAAA`	3	--	int¹		25		NS MN NA WA CSA EA	1607
rs151081974^1,2		--	104179317(+)	`AGTGAC/TGACCT`	3	--	int¹		0	--	--	--	--
rs145033425^1,2		--	104179419(+)	`GCATCC/TCCTTC`	3	--	int¹		0	--	--	--	--
rs138815086^1,2		--	104179548(+)	`AGACCA/GCAGTG`	3	--	int¹		0	--	--	--	--
rs140561241^1,2		--	104179617(+)	`CTTTCA/CCAGAT`	3	--	int¹		0	--	--	--	--
rs149531327^1,2		--	104179990(+)	`CTTCCA/GAGGTG`	3	--	int¹		0	--	--	--	--
rs115752763^1,2	F,	--	104180300(+)	`GACCTC/TGGTCC`	5	--	int¹ us2k¹		1		WA	118
rs2295152^1,2	C,F,H,	--	104180444(-)	`GCAGGG/AAGGTG`	5	--	int¹ us2k¹		13		EA NS NA WA CSA	2211
rs183245941^1,2		--	104180471(+)	`CCATGA/GAGGCC`	5	--	us2k¹ int¹		0	--	--	--	--
rs187437918^1,2		--	104180507(+)	`CTCCTC/TCCCTC`	5	--	int¹ us2k¹		0	--	--	--	--
rs117745213^1,2		--	104180538(+)	`GAACCC/TGAGAA`	5	--	int¹ us2k¹		1		NA	120
rs191832860^1,2		--	104180718(+)	`CAGCAC/TCGTGG`	5	--	int¹ us2k¹		0	--	--	--	--
rs3212024^1,2	C,F,	--	104180735(-)	`TTGGCC/TGCCTT`	5	--	int¹ us2k¹		9		NS NA WA CSA EA	518
rs182927992^1,2		--	104180823(+)	`AAAGAA/GAAATA`	5	--	int¹ us2k¹		0	--	--	--	--
rs115223671^1,2	C,F,	--	104180853(+)	`CTTGCG/AGTCCC`	5	--	int¹ us2k¹		1		WA	118
rs116700863^1,2	F,	--	104180921(+)	`CTCCAC/GCCCGG`	5	--	int¹ us2k¹		2		WA EA	238
rs148235356^1,2		--	104181022(+)	`TTTTTG/TTGTGT`	5	--	int¹ us2k¹		0	--	--	--	--
rs187681932^1,2		--	104181044(+)	`TGGAGC/TCTTTT`	5	--	int¹ us2k¹		0	--	--	--	--
rs3212023^1,2	F	--	104181715(-)	`ggggcTGCGAGC CGGGC/-ggcag`	5	--	us2k¹ int¹		1		NS	178
rs191212781^1,2		--	104181898(+)	`CAATCC/GAAAGT`	5	--	us2k¹		0	--	--	--	--
rs141204284^1,2		--	104181913(+)	`ATCTCC/TCTGAG`	5	--	us2k¹		0	--	--	--	--
rs116404895^1,2	F,	--	104182677(+)	`GTCCCG/TAGAGC`	5	--	int¹ us2k¹		1		WA	118
rs182673740^1,2		--	104182937(+)	`TCGGAA/GGCGAG`	5	--	us2k¹ int¹		0	--	--	--	--
rs147390109^1,2		--	104183222(+)	`GTTCTG/TTGGAT`	5	--	us2k¹ int¹		0	--	--	--	--
rs142806929^1,2		--	104183321(+)	`TCCCT-/CAGTGAT`	5	--	us2k¹ int¹		0	--	--	--	--
rs200136306^1,2		--	104183401(+)	`CTTGG-/TTTGGA`	5	--	us2k¹ int¹		0	--	--	--	--
rs147728314^1,2		--	104183415(+)	`CTGGT-/GGGGGGTG`	5	--	us2k¹ int¹		0	--	--	--	--
rs114839171^1,2	F,	--	104183498(+)	`TGTACG/AGAGCC`	5	--	us2k¹ int¹		1		WA	118
rs145063332^1,2		--	104183668(+)	`TATGGC/TGTAAC`	5	--	us2k¹ int¹		0	--	--	--	--
rs185010618^1,2		--	104183673(+)	`TGTAAC/TGAACT`	5	--	us2k¹ int¹		0	--	--	--	--
rs71417875^1,2	--	--	84350035(+)	`GGCAGG/AAGGGT`	3	--	int¹		1		NA	2
rs141201371^1,2	--	--	104169617(+)	`CTGCTG/ACAGGC`	6	/Q /*	stg¹		1		NA	3066
rs57488231^1,2	--	--	104177191(+)	`CACAC-/ACCTGAA`	3	--	int¹		0	--	--	--	--
rs199529797^1,2	--	--	104175047(+)	`ACGCAG/AGGCAA`	3	--	int¹		1		EU	1281
rs34106066^1,2	--	--	104176925(+)	`CAAAA-/AAGAAATT`	3	--	int¹		0	--	--	--	--
rs111945322^1,2	--	--	84348341(+)	`AACGCG/CTTCTG`	3	--	int¹		1		CSA	2
rs3212088^1,2	--	--	84347378(-)	`ctgacG/Agcagt`	3	--	int¹		1		NS	180
rs111463848^1,2	--	--	84349533(+)	`AGGACA/CCCGTG`	3	--	int¹		0	--	--	--	--
rs3212053^1,2	--	--	84352150(-)	`GGAGCG/ACCTCG`	3	--	int¹		1		NS	164
rs3212059^1,2	--	--	84351344(-)	`ATGCCG/AGCCCA`	3	--	int¹		1		NS	180
rs34665573^1,2	--	--	84348278(+)	`TCCTT-/CCCCCT`	3	--	int¹		0	--	--	--	--
rs3212084^1,2	--	--	84348266(-)	`GGGCAG/AGGTGG`	3	--	int¹		1		NS	178
rs112345823^1,2	--	--	84358874(+)	`AATAAG/ACCGTG`	3	--	int¹		1		CSA	1
rs61995795^1,2	--	--	84355914(+)	`GGGAAA/GGCTGT`	3	--	int¹		1		NA	2
rs146725448^1,2	--	--	104174896(+)	`GAGGCC/TGTTCT`	6	T	syn¹		1		NA	4542
rs111536408^1,2	--	--	84346719(+)	`ATAAAG/CTAAGC`	3	--	int¹		1		CSA	1
rs55856827^1,2	--	--	84357691(+)	`TCCCCC/TGGGCG`	3	--	int¹		0	--	--	--	--
rs7156381^1,2	--	--	84359436(+)	`caaacA/Gattct`	3	--	int¹		0	--	--	--	--
rs3212060^1,2	--	--	84351259(-)	`TGCCCC/TGCCGC`	3	--	int¹		1		NS	180
rs56346587^1,2	--	--	84357906(+)	`GCCTGA/GTCTCT`	3	--	int¹		0	--	--	--	--
rs77068874^1,2	--	--	84353323(-)	`AGTCT-/TGACAT`	3	--	int¹		0	--	--	--	--
rs75660546^1,2	--	--	84355881(+)	`TGTCAG/CTGAGG`	3	--	spa¹		1		NA	2
rs138987760^1,2	--	--	104169630(+)	`TTGTGC/TGGGAA`	6	P	syn¹		1		NA	2994
rs140217353^1,2	--	--	104178435(+)	`TGCTC-/CCCGG CGTGGAGAGGGA`	3	--	int¹		0	--	--	--	--
rs56210101^1,2	--	--	84353018(+)	`AACTC-/TGGGGCT`	3	--	int¹		0	--	--	--	--
rs77914700^1,2	--	--	84355374(+)	`CGTCTC/ACAAAA`	3	--	int¹		1		NA	2
rs35770376^1,2	--	--	84361458(+)	`CCCTT-/GGGCCA`	3	--	us2k¹		0	--	--	--	--
rs76746670^1,2	--	--	84349697(-)	`TTTTT-/TGCAAC`	3	--	int¹		0	--	--	--	--
rs199632866^1,2	--	--	104177810(+)	`CTCTGA/GGGCTT`	3	--	ut5¹		0	--	--	--	--
rs76254297^1,2	--	--	84353103(+)	`CCATG-/ATATGCT`	3	--	int¹		0	--	--	--	--
rs36102947^1,2	--	--	84346759(+)	`CTGCA-/GGGGAT`	3	--	int¹		0	--	--	--	--
rs34183054^1,2	--	--	84343459(+)	`TCGCA-/CCCCTT`	6	C V	fra¹		0	--	--	--	--
rs3212075^1,2	--	--	84349277(-)	`aggcgG/Aatcat`	3	--	int¹		1		NS	172
rs3212019^1,2	--	--	84361519(-)	`AAACTG/AGACAC`	3	--	us2k¹		1		NS	178
rs68039905^1,2	--	--	104178447(+)	`CAGGA-/CCCGG CGTGGAGAACAGA`	3	--	int¹		0	--	--	--	--
rs35974678^1,2	--	--	104175209(+)	`CTGCG-/CCCCTG`	3	--	int¹		0	--	--	--	--
rs61995794^1,2	--	--	84351898(+)	`CAGGGC/TTGGGG`	3	--	int¹		1		NA	2
rs41285494^1,2	--	--	84344131(+)	`GAGTCA/GATGAC`	6	I	syn¹		0	--	--	--	--
rs709401^1,2	--	--	84350238(-)	`GCCACC/TGTGAC`	3	--	int¹		5		EA NA	50
rs149963487^1,2	--	--	104169638(+)	`GAAGGC/TGTCTT`	6	T A	mis¹		1		NA	3018

HapMap Linkage Disequilibrium report for XRCC3 (104163946 - 104181841 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 2 variations for XRCC3
1 CNV: 3949
1 Indel: 33277
Human Gene Mutation Database (HGMD): XRCC3

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing XRCC3

DNA2.0 Custom Variant and Variant Library Synthesis for XRCC3

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

XRCC3 for disorders About GeneDecksing

OMIM gene information: 600675 OMIM disorders: --

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542

Defects in XRCC3 are the cause of susceptibility to breast cancer (BC) [MIM:114480]. BC is a common malignancy

originating from breast epithelial tissue. Breast neoplasms can be distinguished by their histologic pattern. Invasive

ductal carcinoma is by far the most common type. Breast cancer is etiologically and genetically heterogeneous.

Important genetic factors have been indicated by familial occurrence and bilateral involvement. Mutations at more than

one locus can be involved in different families or even in the same case

Defects in XRCC3 are the cause of susceptibility to cutaneous malignant melanoma type 6 (CMM6) [MIM:613972].

CMM6 is a malignant neoplasm of melanocytes, arising de novo or from a pre-existing benign nevus, which occurs most

often in the skin but also may involve other sites

20/86 diseases for XRCC3 (see all 86): About MalaCards

diffuse large b-cell lymphoma xeroderma pigmentosum b-cell lymphomas acoustic neuroma

mutagen sensitivity non-hodgkin lymphoma soft tissue sarcoma spina bifida

ataxia telangiectasia orofacial cleft squamous cell carcinoma biliary tract cancer

breast cancer susceptibility urinary bladder cancer cutaneous malignant melanoma oral squamous cell carcinoma

breast cancer squamous cell carcinoma of the head and neck neuroma systemic lupus erythematosus

4 diseases from the University of Copenhagen DISEASES database for XRCC3:

Xeroderma pigmentosum Breast cancer Urinary bladder cancer Lung cancer

10/26 Novoseek disease relationships for XRCC3 gene (see all 26) About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
xeroderma pigmentosum	53.3	4	16707649 (1), 18630471 (1), 19307510 (1), 17630853 (1)
chromosomal aberrations	49.7	5	16997330 (2), 17159780 (1), 17923529 (1)
cancer	48	23	16791138 (4), 9542526 (3), 16137195 (3), 16707649 (3) (see all 12)
bladder cancer	42.1	14	19815090 (2), 16284380 (2), 12223443 (1), 19429237 (1) (see all 7)
breast cancer	41.9	26	19426727 (4), 19886181 (3), 12565173 (2), 12023982 (2) (see all 14)
cancer lung	41.1	12	17034901 (3), 12618330 (2), 17705814 (2), 12917199 (1) (see all 8)
ataxia telangiectasia	31.1	1	16966185 (1)
skin cancer	30.3	2	15126335 (1), 16791138 (1)
genetic susceptibility	23.6	1	18543213 (1)
adenocarcinoma	21.9	4	16571649 (1), 16540687 (1), 18336773 (1)

Genetic Association Database (GAD): XRCC3
Human Genome Epidemiology (HuGE) Navigator: XRCC3 (267 documents)

Export disorders for XRCC3 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for XRCC3 gene, integrated from 9 sources (see all 375):
(articles sorted by number of sources associating them with XRCC3)

Utopia: connect your pdf to the dynamic
world of online information

Variants in DNA double-strand break repair genes and breast cancer susceptibility. (PubMed id 12023982)^{1, 2, 4, 9} Kuschel B....Dunning A. (2002)
A variant within the DNA repair gene XRCC3 is associated with the development of melanoma skin cancer. (PubMed id 11059748)^{1, 2, 4, 9} Winsey S.L.... Welsh K.I. (2000)
XRCC3 genetic polymorphism, smoking, and lung carcinoma risk in minority populations. (PubMed id 14534887)^{1, 4, 9} Wang Y....Wu X. (2003)
Microsatellite polymorphisms in DNA repair genes XRCC1, XRCC3 and XRCC5 in patients with gynecological tumors: association with late clinical radiosensitivity and cancer incidence. (PubMed id 16137195)^{1, 4, 9} De Ruyck K....Thierens H. (2005)
Are genetic polymorphisms in OGG1, XRCC1 and XRCC3 genes predictive for the DNA strand break repair phenotype and genotoxicity in workers exposed to low dose ionising radiations? (PubMed id 15491645)^{1, 4, 9} Aka P....Kirsch-Volders M. (2004)
XRCC2 and XRCC3, new human Rad51-family members, promote chromosome stability and protect against DNA cross-links and other damages. (PubMed id 9660962)^{1, 2, 9} Liu N....Thompson L.H. (1998)
Rare microsatellite polymorphisms in the DNA repair genes XRCC1, XRCC3 and XRCC5 associated with cancer in patients of varying radiosensitivity. (PubMed id 9542526)^{1, 4, 9} Price E.A....Arrand J.E. (1997)
Cellular localization of human Rad51C and regulation of ubiquitin-mediated proteolysis of Rad51. (PubMed id 16215984)^{1, 2, 9} Bennett B.T. and Knight K.L. (2005)
An association of polymorphism of DNA repair genes XRCC1 and XRCC3 with colorectal cancer. (PubMed id 15354414)^{1, 4, 9} Krupa R. and Blasiak J. (2004)
An assessment of a variant of the DNA repair gene XRCC3 as a possible nevus or melanoma susceptibility genotype. (PubMed id 15009726)^{1, 4, 9} Bertram C.G....Newton Bishop J.A. (2004)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 7517	HGNC: 12830	AceView: XRCC3	Ensembl:ENSG00000126215	euGenes: HUgn7517
ECgene: XRCC3	Kegg: 7517	H-InvDB: XRCC3

(According to HUGE)
About This Section

(According

Advanced Search

Export list of displayed genes

XRCC3 Gene

X-ray repair complementing defective repair in Chinese hamster...

Aliases
for XRCC3 gene

Summaries
for XRCC3 gene

Genomic Views
for XRCC3 gene

Proteins
for XRCC3 gene

Protein Domains /
Families
for XRCC3 gene

Function
for XRCC3 gene

Pathways & Interactions
for XRCC3 gene

Drugs & Compounds
for XRCC3 gene

Transcripts
for XRCC3 gene

Expression
for XRCC3 gene

Orthologs
for XRCC3 gene

Paralogs
for XRCC3 gene

Genomic Variants
for XRCC3 gene

Disorders / Diseases
for XRCC3 gene

Publications
for XRCC3 gene

External Searches for XRCC3 gene

Genome Databases showing XRCC3 gene

Other Databases showing XRCC3 gene

Specialized Databases showing XRCC3 gene

Gastric Cancer
Nevi
Melanoma
bladder cancer
Skin Cancer
Genetic Susceptibility
Glioma
Adenoma
Colorectal Cancer
Carcinoma Basal Cell
Xeroderma Pigmentosum
Carcinoma
Carcinoma Squamous Cell
Breast Cancer
prostate cancer
Chromosomal Aberrations
NSCLC
Tumors
Metastasis
Adenocarcinoma
breast cancer metastatic
SMOKING HABIT
Cancer
Cancer Lung
Ataxia Telangiectasia
Poisoning

Advanced Search

Export list of displayed genes

XRCC3 Gene

X-ray repair complementing defective repair in Chinese hamster...

Aliasesfor XRCC3 gene

Summariesfor XRCC3 gene

Genomic Viewsfor XRCC3 gene

Proteinsfor XRCC3 gene

Protein Domains /Familiesfor XRCC3 gene

Functionfor XRCC3 gene

Pathways & Interactionsfor XRCC3 gene

Drugs & Compoundsfor XRCC3 gene

Transcriptsfor XRCC3 gene

Expression for XRCC3 gene

Orthologsfor XRCC3 gene

Paralogsfor XRCC3 gene

Genomic Variantsfor XRCC3 gene

Disorders / Diseasesfor XRCC3 gene

Publicationsfor XRCC3 gene

External Searches for XRCC3 gene

Genome Databases showing XRCC3 gene

Other Databases showing XRCC3 gene

Specialized Databases showing XRCC3 gene

Aliases
for XRCC3 gene

Summaries
for XRCC3 gene

Genomic Views
for XRCC3 gene

Proteins
for XRCC3 gene

Protein Domains /
Families
for XRCC3 gene

Function
for XRCC3 gene

Pathways & Interactions
for XRCC3 gene

Drugs & Compounds
for XRCC3 gene

Transcripts
for XRCC3 gene

Expression
for XRCC3 gene

Orthologs
for XRCC3 gene

Paralogs
for XRCC3 gene

Genomic Variants
for XRCC3 gene

Disorders / Diseases
for XRCC3 gene

Publications
for XRCC3 gene