Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



XRCC3 Gene

protein-coding   GIFtS: 60
GCID: GC14M104163

X-Ray Repair Complementing Defective Repair In Chinese Hamster...

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells
31 2
X-Ray Repair Cross-Complementing Protein 32 3
CMM62 5
RAD51-like1
DNA Repair Protein XRCC32

External Ids:    HGNC: 128301   Entrez Gene: 75172   Ensembl: ENSG000001262157   OMIM: 6006755   UniProtKB: O435423   

Export aliases for XRCC3 gene to outside databases

Previous GC identifers: GC14M101555 GC14M097979 GC14M102153 GC14M103233 GC14M084342


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for XRCC3 Gene:
This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination
to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster
irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and
is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients
of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been
identified. (provided by RefSeq, Jul 2008)

GeneCards Summary for XRCC3 Gene:
XRCC3 (X-ray repair complementing defective repair in Chinese hamster cells 3) is a protein-coding gene. Diseases associated with XRCC3 include mutagen sensitivity, and melanoma, cutaneous malignant, 6. GO annotations related to this gene include DNA-directed RNA polymerase activity and DNA-dependent ATPase activity.

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542
Function: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair
chromosomal fragmentation, translocations and deletions. Plays a role in regulating mitochondrial DNA copy number
under conditions of oxidative stress in the presence of RAD51 and RAD51C

Gene Wiki entry for XRCC3 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000014.9  NT_026437.13  NC_018925.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the XRCC3 gene promoter:
         CHOP-10   GR   PPAR-gamma1   p53   GR-beta   PPAR-gamma2   GR-alpha   C/EBPalpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidXRCC3 promoter sequence
   Search Chromatin IP Primers for XRCC3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat XRCC3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 14q32.3   Ensembl cytogenetic band:  14q32.33   HGNC cytogenetic band: 14q32.3

XRCC3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
XRCC3 gene location

GeneLoc information about chromosome 14         GeneLoc Exon Structure

GeneLoc location for GC14M104163:  view genomic region     (about GC identifiers)

Start:
104,163,946 bp from pter      End:
104,181,841 bp from pter
Size:
17,896 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542 (See protein sequence)
Recommended Name: DNA repair protein XRCC3  
Size: 346 amino acids; 37850 Da
Subunit: Interacts with RAD51C and RAD51. Part of a complex consisting of RAD51B, RAD51C, RAD51D, XRCC2 and XRCC3.
Forms a complex with FANCD2, BRCA2 and phosphorylated FANCG. Interacts with SWSAP1 and ZSWIM7; involved in
homologous recombination repair
Secondary accessions: O43568 Q9BU18

Explore the universe of human proteins at neXtProt for XRCC3: NX_O43542

Explore proteomics data for XRCC3 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys172
  • Modification sites at PhosphoSitePlus

  • See XRCC3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_001093588.1  NP_001093589.1  NP_005423.1  

    ENSEMBL proteins: 
     ENSP00000451362   ENSP00000343392   ENSP00000451974   ENSP00000452598   ENSP00000451361  
     ENSP00000473569   ENSP00000451118   ENSP00000451252   ENSP00000451173   ENSP00000452389  
     ENSP00000450780   ENSP00000450738   ENSP00000412990  

    XRCC3 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for XRCC3
    OriGene Protein Over-expression Lysate for XRCC3
    OriGene Custom MassSpec
    OriGene Custom Protein Services for XRCC3
    GenScript Custom Purified and Recombinant Proteins Services for XRCC3
    Novus Biologicals XRCC3 Proteins
    Novus Biologicals XRCC3 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for XRCC3

    XRCC3 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of XRCC3
    Browse R&D Systems for Antibodies
    OriGene Antibodies for XRCC3
    OriGene Custom Antibody Services for XRCC3
    Novus Biologicals XRCC3 Antibodies
    Abcam antibodies for XRCC3
    Cloud-Clone Corp. Antibodies for XRCC3
    ThermoFisher Antibodies for XRCC3
    LSBio Antibodies in human, mouse, rat for XRCC3

    XRCC3 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for XRCC3
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for XRCC3
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for XRCC3
    Cloud-Clone Corp. CLIAs for XRCC3


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    4 InterPro protein domains:
     IPR020588 RecA_ATP-bd
     IPR016467 DNA_recomb/repair_RecA-like
     IPR027417 P-loop_NTPase
     IPR013632 DNA_recomb/repair_Rad51_C

    Graphical View of Domain Structure for InterPro Entry O43542

    ProtoNet protein and cluster: O43542

    UniProtKB/Swiss-Prot: XRCC3_HUMAN, O43542
    Similarity: Belongs to the RecA family. RAD51 subfamily


    XRCC3 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: XRCC3_HUMAN, O43542
    Function: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair
    chromosomal fragmentation, translocations and deletions. Plays a role in regulating mitochondrial DNA copy number
    under conditions of oxidative stress in the presence of RAD51 and RAD51C
    Induction: Stress-induced increase in the mitochondrial levels is seen

         Genatlas biochemistry entry for XRCC3:
    repair X-ray defect,complementing defect in CHO cells,3,involved in recombinational repair,interacting with RAD51
    for maintenance of genomic integrity

         Gene Ontology (GO): Selected molecular function terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000400contributes to four-way junction DNA binding IDA--
    GO:0003677DNA binding ----
    GO:0005515protein binding IPI--
    GO:0005524ATP binding IEA--
    GO:0008094DNA-dependent ATPase activity IEA--
         
    XRCC3 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for XRCC3:
     Synthetic lethal with cisplati  Upregulation of Wnt/beta-caten 

         1 MGI phenotypic allele for Xrcc3 (no phenotypes)

    XRCC3 for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for XRCC3
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for XRCC3

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for XRCC3
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for XRCC3

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat XRCC3 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate XRCC3
    SwitchGear 3'UTR luciferase reporter plasmidXRCC3 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for XRCC3
    Predesigned siRNA for gene silencing in human, mouse, rat XRCC3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for XRCC3

    Clone
    Products:
         
    OriGene clones in human, mouse for XRCC3 (see all 19)
    OriGene ORF clones in mouse, rat for XRCC3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): XRCC3 (NM_001100118)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for XRCC3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat XRCC3

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for XRCC3
    Browse ESI BIO Cell Lines and PureStem Progenitors for XRCC3 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for XRCC3


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    XRCC3_HUMAN, O43542: Nucleus. Cytoplasm. Cytoplasm, perinuclear region. Mitochondrion. Note=Accumulates in
    discrete nuclear foci prior to DNA damage, and these foci persist throughout the time course of DNA repair
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    mitochondrion5
    nucleus5
    cytosol2
    cytoskeleton1

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA16215984
    GO:0005657replication fork IDA--
    GO:0005737cytoplasm IDA16215984
    GO:0005739mitochondrion IDA--
    GO:0033065Rad51C-XRCC3 complex IDA11751635

    XRCC3 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for XRCC3 About    
    See pathways by source

    SuperPathContained pathways About
    1Pyrimidine metabolism
    Fluoropyrimidine Activity0.69
    Fluoropyrimidine Pathway, Pharmacodynamics0.00
    2Homologous recombination
    Homologous recombination0.40
    3Integrated Breast Cancer Pathway
    Integrated Breast Cancer Pathway

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    2 BioSystems Pathways for XRCC3
        Fluoropyrimidine Activity
    Integrated Breast Cancer Pathway

    1 PharmGKB Pathway for XRCC3
        Fluoropyrimidine Pathway, Pharmacodynamics

    1 Kegg Pathway  (Kegg details for XRCC3):
        Homologous recombination


    XRCC3 for pathways           About GeneDecksing

        Pathway & Disease-focused RT2 Profiler PCR Arrays including XRCC3: 
              DNA Damage Signaling Pathway in human mouse rat
              DNA Repair in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for XRCC3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for XRCC3 (O435421, 3 ENSP000003433924) via UniProtKB, MINT, STRING, and/or I2D (see all 230)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    FANCGO152873, ENSP000003679104I2D: score=3 STRING: ENSP00000367910
    RAD51DO757713, ENSP000003780904I2D: score=2 STRING: ENSP00000378090
    RAD51Q066093, ENSP000002678684I2D: score=1 STRING: ENSP00000267868
    ZNHIT3Q156493, ENSP000002254104I2D: score=1 STRING: ENSP00000225410
    RAD51CO435023, ENSP000003367014I2D: score=3 STRING: ENSP00000336701
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000724double-strand break repair via homologous recombination IMP--
    GO:0000737DNA catabolic process, endonucleolytic IMP14716019
    GO:0006259DNA metabolic process ----
    GO:0006281DNA repair IGI10422536
    GO:0006310DNA recombination TAS9660962

    XRCC3 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for XRCC3

    Selected Novoseek inferred chemical compound relationships for XRCC3 gene (see all 11)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    pcb 153 61 9 19069643 (2), 18948301 (1)
    mitomycin c 42.3 3 7603995 (1), 17141189 (1)
    cisplatin 33.2 8 15843498 (2), 16622263 (1), 17141189 (1)
    folate 29 7 19177501 (2), 16997330 (2), 19360465 (1), 15066914 (1) (see all 5)
    benzene 20.3 8 18095557 (3), 17535647 (2), 17605237 (2), 16728435 (1)
    camptothecin 16.3 2 12584174 (2)
    melphalan 13.1 7 11584063 (4), 15843498 (1)
    n acetylcysteine 11.7 1 19069643 (1)
    p003 1.68 2 12007561 (1), 12865926 (1)
    methionine 0 2 17701750 (1), 12223443 (1)



    XRCC3 for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for XRCC3 gene (3 alternative transcripts): 
    NM_001100118.1  NM_001100119.1  NM_005432.3  

    Unigene Cluster for XRCC3:

    X-ray repair complementing defective repair in Chinese hamster cells 3
    Hs.592325  [show with all ESTs]
    Unigene Representative Sequence: BX368160
    Selected Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 19):
    ENST00000554913(uc001yoa.4) ENST00000352127(uc001ynz.4) ENST00000554811
    ENST00000553264 ENST00000555055(uc001ynx.4 uc001yny.4) ENST00000554974
    ENST00000554774 ENST00000555451 ENST00000555832 ENST00000553807 ENST00000557439
    ENST00000553361 ENST00000556980 ENST00000555964 ENST00000555231 ENST00000556682
    ENST00000553332 ENST00000554170
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat XRCC3 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate XRCC3
    SwitchGear 3'UTR luciferase reporter plasmidXRCC3 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for XRCC3
    Predesigned siRNA for gene silencing in human, mouse, rat XRCC3
    Clone
    Products:
         
    OriGene clones in human, mouse for XRCC3 (see all 19)
    OriGene ORF clones in mouse, rat for XRCC3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): XRCC3 (NM_001100118)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for XRCC3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat XRCC3
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for XRCC3
    OriGene qSTAR qPCR primer pairs in human, mouse for XRCC3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat XRCC3
      QuantiTect SYBR Green Assays in human, mouse, rat XRCC3
      QuantiFast Probe-based Assays in human, mouse, rat XRCC3

    Additional mRNA sequence: BC073820.1 

    1 DOTS entry:

    DT.100773069 

    Selected AceView cDNA sequences (see all 151):

    BM797370 AA595441 AI983015 BX339303 BM557723 AU118580 CR605233 BM915097 
    BM796198 AK022829 BX325623 AU138697 BM803244 CB150648 BX385078 BM127755 
    AF035586 BM128018 BM905634 CR610241 CR613005 BE396817 AU124974 AK126706 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for XRCC3 (see all 13)    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b ^ 6a · 6b · 6c · 6d · 6e ^ 7a · 7b · 7c ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13
    SP1:              -     -     -     -     -                       -                       -                       -     -     -                 -         
    SP2:                                -     -                       -                       -                                                               
    SP3:              -     -           -     -                       -                       -                                                               
    SP4:              -     -     -     -     -                       -                       -                                                               
    SP5:                                -     -                       -                       -                       -     -     -                           


    ECgene alternative splicing isoforms for XRCC3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    XRCC3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: ACTGTGCAGC
    XRCC3 Expression
    About this image

    XRCC3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    XRCC3 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.592325
        Pathway & Disease-focused RT2 Profiler PCR Arrays including XRCC3: 
              DNA Damage Signaling Pathway in human mouse rat
              DNA Repair in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for XRCC3
    OriGene qSTAR qPCR primer pairs in human, mouse for XRCC3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat XRCC3
    QuantiTect SYBR Green Assays in human, mouse, rat XRCC3
    QuantiFast Probe-based Assays in human, mouse, rat XRCC3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for XRCC3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for XRCC3 gene from Selected species (see all 18)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Xrcc31 , 5 X-ray repair complementing defective repair in Chinese more1, 5 76.97(n)1
    73.7(a)1
      12 (61.14 cM)5
    743351  NM_028875.21  NP_083151.11 
     1118031925 
    chicken
    (Gallus gallus)
    Aves XRCC31 X-ray repair complementing defective repair in Chinese more 62.34(n)
    62.24(a)
      423485  NM_001006489.1  NP_001006489.1 
    lizard
    (Anolis carolinensis)
    Reptilia XRCC36
    X-ray repair complementing defective repair in Chi...
    52(a)
    1 ↔ 1
    1(6024977-6038048)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia xrcc31 X-ray repair complementing defective repair in Chinese more 58.41(n)
    57.52(a)
      548895  NM_001016141.2  NP_001016141.1 
    zebrafish
    (Danio rerio)
    Actinopterygii xrcc31 X-ray repair complementing defective repair in Chinese more 57.97(n)
    53.33(a)
      541414  NM_001013541.1  NP_001013559.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta spn-B1 spindle B 47.06(n)
    39.92(a)
      41746  NM_057392.5  NP_476740.1 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RAD576
    Protein that stimulates strand exchange by stabili...
    15(a)
    1 ↔ 1
    IV(455201-456583) YDR004W
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons XRCC31 XRCC3 43.7(n)
    38.19(a)
      835850  NM_180871.1  NP_851202.1 
    rice
    (Oryza sativa)
    Liliopsida Os02g05621001 Os02g0562100 49.44(n)
    39.17(a)
      4329686  NM_001053685.1  NP_001047150.1 


    ENSEMBL Gene Tree for XRCC3 (if available)
    TreeFam Gene Tree for XRCC3 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for XRCC3 (see all 376)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 14 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs2016475951,2
    --84346512(+) AAAAA-/AAGAGAAG 3 -- int10--------
    rs1862585041,2
    C--84346747(+) CTGCTA/GCCCCA 3 -- int10--------
    rs1392321221,2
    --84346839(+) GCTCTC/TTGCAA 3 -- int10--------
    rs1499582341,2
    --84346880(+) AGCCAA/GTGTCT 3 -- int10--------
    rs32120921,2
    C,F,H--84346937(-) CAGCTC/TAGACA 3 -- int19Minor allele frequency- T:0.03NS EA NA 916
    rs1441897451,2
    --84346944(+) GCTGGA/GTGCCC 3 -- int10--------
    rs8615341,2
    C,F,H--84346994(-) AAGACG/AGCCCT 3 -- int119Minor allele frequency- A:0.24NS NA EA WA CSA 1068
    rs8615331,2
    C,H--84347008(-) TTGCCT/CCTGAG 3 -- int116Minor allele frequency- C:0.00EA NA WA CSA 424
    rs32120901,2
    C,F,O,H--84347156(-) GTGGGG/AAAGAG 3 -- int1 trp315Minor allele frequency- A:0.27NS NA EA WA 1086
    rs1907218721,2
    --84347271(+) GAACAC/TGCTTC 3 -- int10--------
    rs32120891,2
    C,F,H--84347310(-) GCTGCG/AACACC 3 -- int111Minor allele frequency- A:0.05NS EA NA WA 1392
    rs1441889561,2
    --84347333(+) CTGCC-/TGGCCCAC 3 -- int10--------
    rs32120871,2
    C,F,H--84347404(-) atgggC/Tctagg 3 -- int16Minor allele frequency- T:0.01NS EA WA 716
    rs784682871,2
    F--84347462(+) TGTAGC/GAGGAC 3 -- int11Minor allele frequency- G:0.01WA 118
    rs755407311,2
    C--84347512(+) GTCCA-/TCCTCCAC 3 -- int10--------
    rs1808909061,2
    --84347638(+) GACCCA/CACCTG 3 -- int10--------
    rs802244071,2
    F--84347650(+) TCCTCG/AGGCGT 3 -- int11Minor allele frequency- A:0.07WA 118
    rs1399665741,2
    --84347683(+) GTTCAG/TAGCTG 3 -- int10--------
    rs2002303921,2
    --84347809(+) ACATCA/GGCCAC 6 A syn10--------
    rs562885291,2
    C,F--84347844(+) AAATCG/AGAGCT 6 /R /* stg11Minor allele frequency- A:0.00NA 3840
    rs1431711861,2
    C--84347871(+) TGGAAC/TGTCAG 6 I V mis11Minor allele frequency- T:0.00NA 3420
    rs289030791,2
    C--84347872(-) ACTGAC/TGTTCC 6 D syn1 ese32Minor allele frequency- T:0.00EU NA 3590
    rs563472061,2
    C,F--84347886(+) CAGCCG/ACGGCT 6 /R /W mis12Minor allele frequency- A:0.00WA NA 3350
    rs1996813851,2
    --84347888(+) GCCGCA/GGCTGC 6 P L mis10--------
    rs1507291601,2
    C--84347916(+) CAGGCG/ACTTGT 6 /R /C mis11Minor allele frequency- A:0.00NA 3046
    rs2015611341,2
    C--84347939(+) CTTCCA/GTGCAG 6 T M mis10--------
    rs2005672981,2
    --84347941(+) TCCGTA/GCAGAT 6 C syn10--------
    rs1465073541,2
    C--84347952(+) GTAGAC/TGGCTC 6 I V mis11Minor allele frequency- T:0.00NA 2908
    rs2001249461,2
    --84347957(+) CGGCTC/GCTGGG 6 A G mis10--------
    rs559587061,2
    C--84347999(+) CCAGAC/TGGGCC 3 -- int10--------
    rs560367041,2
    C--84348023(+) CAAATA/CAAGTG 3 -- int10--------
    rs1849605131,2
    --84348099(+) GAGGAA/GGCTGG 3 -- int10--------
    rs32120861,2
    C,F--84348124(-) GCCAGT/GGGGAG 3 -- int12Minor allele frequency- G:0.05NS WA 298
    rs32120851,2
    C,F--84348140(-) GGCCCC/TGGAGG 3 -- int11Minor allele frequency- T:0.01NS 180
    rs353411221,2
    C,F--84348198(+) CCAGGC/TAAGGA 3 -- int14Minor allele frequency- T:0.03NA 98
    rs777432881,2
    F--84348256(+) CTCTCC/TTGCTC 3 -- int11Minor allele frequency- T:0.03NA 120
    rs32120841,2
    C--84348266(-) GGGCAG/AGGTGG 3 -- int11Minor allele frequency- A:0.01NS 178
    rs32120831,2
    C,F--84348283(-) TTCAC-/A/AG  
            
    GGGGG
    3 -- int11NS 178
    rs590926431,2
    C--84348283(+) TCCCCCT/-GTGAA 3 -- int11Minor allele frequency- -:0.50NA 2
    rs32120821,2
    C,H--84348305(-) GCCCTG/ACAGTG 3 -- int15Minor allele frequency- A:0.00NS EA 594
    rs1834008881,2
    --84348363(+) TGAGCC/GCCGAC 3 -- int10--------
    rs1403010531,2
    --84348366(+) GCCCCA/GACACA 3 -- int10--------
    rs32120811,2
    C,F,H--84348435(-) ATGGAG/ACCCAG 3 -- int16Minor allele frequency- A:0.01NS EA NA 716
    rs8615321,2
    C,F,A,H--84348634(-) gacgtG/Tctttc 3 -- int1 trp323Minor allele frequency- T:0.06NS EA NA MN WA CSA 1374
    rs1879418211,2
    --84348637(+) AGAACA/GTCCAC 3 -- int10--------
    rs725614651,2
    C,F--84348675(-) GGGCCG/ATCTCC 3 -- int15Minor allele frequency- A:0.02MN 400
    rs32120791,2
    C,F,H--84348758(-) ACTGCC/TTTCCC 3 -- int1 trp323Minor allele frequency- T:0.04NS EA NA MN WA 2312
    rs725614661,2
    F--84348795(-) GTTTTC/TGAGGT 3 -- int16Minor allele frequency- T:0.01MN EA 520
    rs1440244631,2
    --84348827(+) TGTCAC/TGAGAC 3 -- int10--------
    rs1920727021,2
    --84348836(+) ACCACA/GTGCTG 3 -- int10--------
    rs1509338681,2
    --84348845(+) TGTCCA/GGCTGC 3 -- int10--------
    rs32120781,2
    C,F,H--84348847(-) GTGCAG/ACCGGA 3 -- int119Minor allele frequency- A:0.04NS MN EA NA WA 2288
    rs1828872141,2
    --84348910(+) GGCTGA/CTGGGG 3 -- int10--------
    rs32120771,2
    C,F,H--84349027(-) ataaaT/Ctcagt 3 -- int16Minor allele frequency- C:0.01NS EA NA 712
    rs1879581211,2
    --84349076(+) CTGTCA/GCCCAG 3 -- int10--------
    rs32120761,2
    C,F--84349089(-) actgcA/Gctcca 3 -- int17Minor allele frequency- G:0.35NS NA WA CSA 184
    rs1924326621,2
    --84349154(+) GCCTCA/GGCCTT 3 -- int10--------
    rs1169364491,2
    F--84349171(+) AGCTGG/AGATTA 3 -- int11Minor allele frequency- A:0.03EA 120
    rs1141072041,2
    C,F--84349182(+) CAAGGC/TGTGCG 3 -- int11Minor allele frequency- T:0.10WA 118
    rs1500877221,2
    --84349184(+) AGGCGA/TGCGCT 3 -- int10--------
    rs1848328751,2
    --84349238(+) TCACCA/CTGTTG 3 -- int10--------
    rs1880099771,2
    --84349243(+) ATGTTG/TGTCAG 3 -- int10--------
    rs32120741,2
    F--84349272(-) gcactTTGGGAGGCCGAGGCTG
    AGGCAGGCGGATCAT
    /-
    gaagt
    3 -- int11Minor allele frequency- -:0.02NS 180
    rs32120751,2
    C--84349277(-) aggcgG/Aatcat 3 -- int11Minor allele frequency- A:0.01NS 172
    rs1922873851,2
    --84349317(+) GATTAC/TAGGCA 3 -- int10--------
    rs1850816441,2
    --84349333(+) TACTGC/TGCCTA 3 -- int10--------
    rs1893961661,2
    --84349412(+) GGAAGG/TCTTAG 3 -- int10--------
    rs32120731,2
    C,F,H--84349484(-) GCTCGC/TCGGCC 3 -- int15Minor allele frequency- T:0.00NS EA 590
    rs32120721,2
    C,F,O,H--84349491(-) TTAGAG/AAGCTC 3 -- int19Minor allele frequency- A:0.06NS NA WA 1258
    rs32120711,2
    C,H--84349544(-) GCCCCG/ATGGGC 3 -- int16Minor allele frequency- A:0.02NS EA WA 706
    rs795321681,2
    C,F--84349549(+) CGGGGC/TGTCGT 3 -- int11Minor allele frequency- T:0.03EA 120
    rs1426245511,2
    --84349598(+) AGTGCC/TCCCAC 3 -- int10--------
    rs1815691541,2
    --84349604(+) CCCACA/GCCGTG 3 -- int10--------
    rs32120701,2
    C,O--84349636(-) GTTACG/ACGGAC 3 -- int13Minor allele frequency- A:0.01NS NA 184
    rs32120691,2
    C--84349697(-) TTTTT-/TGCAAC 3 -- int11Minor allele frequency- T:0.01NS 176
    rs1842118651,2
    --84349720(+) CCCCCA/GCCCCA 3 -- int10--------
    rs733630821,2
    C--84349762(+) TCTGGC/TCCGCT 3 -- int12Minor allele frequency- T:0.03WA 120
    rs1468285571,2
    --84349793(+) TACTGC/TCTTGG 3 -- int10--------
    rs1894013011,2
    --84349959(+) GAACCA/GGTCAA 3 -- int10--------
    rs1470920221,2
    C--84349990(+) TGACG-/TTATGT 3 -- int10--------
    rs1392082141,2
    --84350018(+) GGGGAC/GATCGT 3 -- int10--------
    rs32120681,2
    C,F,H--84350051(-) TGGGCT/CGTCCA 3 -- int110Minor allele frequency- C:0.07NS NA 1756
    rs32120671,2
    C,F--84350061(-) CGCCCA/GCCGCT 3 -- int11Minor allele frequency- G:0.02NS 168
    rs1819646351,2
    --84350062(+) GCGGTA/GGGCGG 3 -- int10--------
    rs1171714791,2
    C,F--84350108(+) AAGCAC/TGGGAG 3 -- int11Minor allele frequency- T:0.01NA 120
    rs1436836161,2
    --84350141(+) CTGCCA/GCTTTC 3 -- int10--------
    rs32120661,2
    C,F,O,H--84350159(-) AGGCCC/TGAATT 3 -- int15Minor allele frequency- T:0.00NS EA 584
    rs71593031,2
    C,H--84350182(+) CAGGAA/TAGGAA 3 -- int1 trp34Minor allele frequency- T:0.00NS EA 420
    rs1481119141,2
    --84350297(+) CATCCC/TGCAGC 3 -- int10--------
    rs1418609921,2
    --84350366(+) CCCTGA/GGTATC 3 -- int10--------
    rs32120651,2
    C,H--84350480(-) GCCGCC/TCTCAT 3 -- int15Minor allele frequency- T:0.00NS EA 584
    rs32120641,2
    C,F,H--84350546(-) TTACCG/CCACGG 3 -- int122Minor allele frequency- C:0.08NS EA NA WA 2748
    rs1911838671,2
    --84350777(+) CCCTCC/TACCCA 3 -- int10--------
    rs1808434551,2
    --84350813(+) ACACCC/TTGGGT 3 -- int10--------
    rs32120631,2
    C,H--84350871(-) GCAGCG/AGTGTG 3 -- int15Minor allele frequency- A:0.00NS EA 582
    rs1399859441,2
    --84351004(+) TGCCAC/TTCTGT 3 -- int10--------
    rs1418230161,2
    --84351037(+) TGGGAA/GTCGCA 3 -- int10--------
    rs1462479061,2
    C--84351040(+) GAATCA/GCATGT 3 -- int10--------
    rs1392630541,2
    --84351063(+) ATTAGG/TTTAAA 3 -- int10--------
    rs8615311,2
    C,F,O,A,H--84351100(-) GTGAGG/TAGGAG 3 -- int1 trp330Minor allele frequency- T:0.26NS MN EA NA WA CSA 3376
    rs1499057811,2
    --84351143(+) CACCTA/GAGAGA 3 -- int10--------
    rs32120611,2
    C,F--84351170(-) AAAGCA/C/GTTCAG 3 -- int13NS WA NA 418
    rs740852691,2
    C,F--84351289(+) GCCCTC/TCCTGC 3 -- int11Minor allele frequency- T:0.50WA 2
    rs32120581,2
    C,F--84351353(-) AGCACA/GGCGAT 3 -- int14Minor allele frequency- G:0.05NS CSA WA EA 421
    rs556506821,2
    C,F--84351477(+) CTGTTC/GTGGAA 3 -- int11Minor allele frequency- G:0.03EA 120
    rs725631501,2
    F--84351573(-) GTGGGA/GCAGCT 3 -- int15Minor allele frequency- G:0.01MN 404
    rs3776851081,2
    C--84351657(+) CTGCCA/GCGGGA 6 R W mis10--------
    rs3714552471,2
    C--84351688(+) TGCAGC/TGCCAG 6 A syn10--------
    rs32120571,2,,4
    C,F,H--84351758(-) GCTCCG/ACGGTG 6 /H /R mis1 ese312Minor allele frequency- A:0.01NS MN EA NA 980
    rs3706173431,2
    C--84351793(+) AGGCTC/TAGGCG 6 L syn10--------
    rs32120561,2
    C,F--84351917(-) TGACCA/GTGCCT 3 -- int18Minor allele frequency- G:0.03NS MN CSA WA 693
    rs32120551,2
    C,H--84351959(-) GGCACC/TTGTGC 3 -- int15Minor allele frequency- T:0.00NS EA 586
    rs1865667541,2
    --84352050(+) GTCAGA/GGGGAG 3 -- int10--------
    rs32120541,2
    C,F,H--84352116(-) AAGGCG/TTCTGG 3 -- int15Minor allele frequency- T:0.02NS NA 562
    rs1477662611,2
    --84352142(+) GAGAGC/TCCCGA 3 -- int10--------
    rs1901082161,2
    --84352144(+) GAGCCC/TCGAGG 3 -- int10--------
    rs32120531,2
    C--84352150(-) GGAGCG/ACCTCG 3 -- int11Minor allele frequency- A:0.01NS 164
    rs1831138111,2
    --84352151(+) GAGGCA/GCTCCC 3 -- int10--------
    rs32120521,2
    C,F--84352156(-) TGTTAG/CGGAGC 3 -- int13Minor allele frequency- C:0.05NS CSA WA 284
    rs1176557741,2
    F--84352233(+) CAAGCG/AGCTTT 3 -- int11Minor allele frequency- A:0.03EA 120
    rs788150731,2
    C,F--84352258(+) GGCGCG/ACACAC 3 -- int12Minor allele frequency- A:0.06WA EA 238
    rs774671641,2
    C--84352376(+) CTCCAA/C/TGACAC 3 -- int10--------
    rs23685571,2
    C,F--84352382(+) GACACC/TGAAGC 3 -- int11Minor allele frequency- T:0.10WA 118
    rs8615301,2
    C,F,A,H--84352416(-) ACCGCG/ATGTCC 3 -- int122Minor allele frequency- A:0.43EA NA NS WA CSA 1328
    rs1151259431,2
    C,F--84352419(+) CATGCG/AGTGCA 3 -- int11Minor allele frequency- A:0.01WA 118
    rs1155241301,2
    F--84352430(+) GGCTGC/TGCTCT 3 -- int11Minor allele frequency- T:0.01WA 118
    rs32120501,2
    C,F--84352443(-) AGGCCC/TCAGGC 3 -- int12Minor allele frequency- T:0.04NS WA 262
    rs1426510631,2
    --84352445(+) CTGGGG/TCCTGG 3 -- int10--------
    rs1468900751,2
    --84352480(+) GGAGTA/CTGCAC 3 -- int10--------
    rs783998631,2
    F--84352701(+) TGCTGA/CGATGC 3 -- int10--------
    rs799922951,2
    C,F--84352734(+) CAGGCG/ACATGG 3 -- int11Minor allele frequency- A:0.02NA 120
    rs1181920771,2
    F--84352842(+) CCAGAG/CCCTGA 3 -- int11Minor allele frequency- C:0.04EA 120
    rs1171680921,2
    F--84352846(+) AGCCTG/AAAGGG 3 -- int11Minor allele frequency- A:0.03EA 120
    rs32120491,2
    C,F--84352930(-) GTGGGA/GCCTCC 3 -- int14Minor allele frequency- G:0.04NS CSA WA EA 418
    rs32120481,2
    C,F--84352940(-) GACAC-/AGGGGCT 3 -- int12Minor allele frequency- AG:0.02NS CSA 180
    rs791937941,2
    C--84352940(-) GACAC-/AGGGGCT 3 -- int10--------
    rs1152172621,2
    F--84352989(+) CCCCAT/CGGGTG 3 -- int11Minor allele frequency- C:0.01WA 118
    rs1500829771,2
    C--84353018(+) AACTC-/TGGGGCT 3 -- int10--------
    rs1417977781,2
    --84353049(+) CTGAGA/GCTGGT 3 -- int10--------
    rs558560271,2
    C--84353062(+) CTGGG-/TGAAGTCTGCACAGCCCCTGCCCTGCACCAC
    TGGGACCATGATGCTGGAGCCACATGTCACCCC
    TGAAG
    3 -- int10--------
    rs171017841,2
    F--84353090(-) CCAGTG/AGTGCA 3 -- int11Minor allele frequency- A:0.02MN 184
    rs32120471,2
    C--84353102(-) AGCAT-/ATCATGG 3 -- int11Minor allele frequency- AT:0.01NS 176
    rs17997951,2
    C,F,H--84353118(-) GGTGAC/TATGTG 3 -- int115Minor allele frequency- T:0.07NS MN NA WA EU 2875
    rs2019490081,2
    --84353147(+) GCCCAC/TCTACC 3 -- int10--------
    rs1399637221,2
    C,F--84353172(+) TTCCCC/TGCAAG 6 Q R mis11Minor allele frequency- T:0.00NA 4538
    rs1434108431,2
    C,F--84353173(+) TCCCCG/ACAAGT 6 /R /W mis12Minor allele frequency- A:0.00NA EU 5841
    rs1177616891,2
    C--84353190(+) AGGCCG/ATTCTC 6 /T /M mis11Minor allele frequency- A:0.01NA 120
    rs32120451,2
    C--84353213(-) AGCCCC/TGAGGT 6 P syn1 ese32Minor allele frequency- T:0.01NS NA 176
    rs32120441,2
    C,F--84353323(-) AGTCT-/TGACAT 3 -- int11Minor allele frequency- T:0.01NS 180
    rs1995297971,2
    C--84353340(+) ACGCAG/AGGCAA 3 -- int11Minor allele frequency- A:0.00EU 1281
    rs560855751,2
    C,F--84353359(+) CAAAAG/AGTGCT 3 -- int12Minor allele frequency- A:0.03CSA WA 120
    rs1170489461,2
    F--84353397(+) GCTTCC/TGATTC 3 -- int11Minor allele frequency- T:0.01NA 120
    rs1504535121,2
    --84353479(+) GGCACA/GAGGAA 3 -- int10--------
    rs1862081301,2
    --84353596(+) AGCAGA/GTTCCG 3 -- int10--------
    rs1905812681,2
    --84353632(+) CAGTTA/CCATGC 3 -- int10--------
    rs1382370261,2
    --84353655(+) GTGCTC/TCAGAA 3 -- int10--------
    rs32120431,2
    C,F,H--84353664(-) CCTGCC/TCCCTT 3 -- int15Minor allele frequency- T:0.02NS NA WA 612
    rs776743511,2
    F--84353665(+) AGGGGG/ACAGGA 3 -- int11Minor allele frequency- A:0.08WA 118
    rs1169078121,2
    F--84353708(+) CACCAG/AGCATG 3 -- int11Minor allele frequency- A:0.03EA 120
    rs1495826021,2
    C--84353731(+) GCCGCA/GGGAGA 3 -- int10--------
    rs1384102391,2
    C--84353848(+) ACGGC-/GGGGGTGG 3 -- cds10--------
    rs1432485771,2
    --84353933(+) GATAAA/GTGCAT 3 -- int10--------
    rs32120421,2
    C,F,H--84353941(-) AGAAAG/ATGATG 3 -- int14Minor allele frequency- A:0.00NS NA 406
    rs1387950431,2
    --84353961(+) CTTGTA/GGAAAG 3 -- int10--------
    rs1418623671,2
    C--84353968(+) AAAGAC/TGACAA 3 -- int10--------
    rs32120411,2
    C,F,H--84353969(-) TTTGTC/TGTCTT 3 -- int16Minor allele frequency- T:0.01NS NA 868
    rs1887727081,2
    --84354022(+) CACACA/GAGAGG 3 -- int10--------
    rs796851551,2
    C--84354042(+) TGGACA/GAAGCG 3 -- int10--------
    rs1823735191,2
    --84354140(+) TTGTGC/TGGCTG 3 -- int10--------
    rs1883153871,2
    --84354145(+) CGGCTA/GGAAAA 3 -- int10--------
    rs1915581541,2
    --84354208(+) TGGAAC/GGGTGG 3 -- int10--------
    rs1838965831,2
    --84354209(+) GGAAGA/GGTGGG 3 -- int10--------
    rs1138101861,2
    C,F--84354227(+) AAAGCA/GCCCCT 3 -- int11Minor allele frequency- G:0.00CSA 1
    rs32120401,2
    C,F,H--84354654(-) AGCTAC/TGTGAA 3 -- int17Minor allele frequency- T:0.03NS NA CSA 690
    rs1144510911,2
    F--84354749(+) CAGGGG/ACTGCA 3 -- int11Minor allele frequency- A:0.02WA 118
    rs760475951,2
    F--84354772(+) GTTTTG/CAGCAT 3 -- int11Minor allele frequency- C:0.03EA 120
    rs1890666331,2
    C--84354978(+) CACAGC/GCCCCA 3 -- int10--------
    rs1920519241,2
    --84355070(+) TTTTTA/TAAAAA 3 -- int10--------
    rs1858718951,2
    --84355092(+) ACGGCC/TGGGTG 3 -- int10--------
    rs116222201,2
    C,A,H--84355108(+) gctcaC/Tgcctg 3 -- int10--------
    rs116264821,2
    C,H--84355109(+) ctcatG/Tcctgt 3 -- int10--------
    rs1395324261,2
    C--84355141(+) TGAGGC/TGGGCG 3 -- int10--------
    rs1496857021,2
    --84355231(+) TAGCCA/GGGCGT 3 -- int10--------
    rs1477734831,2
    --84355253(+) CCTGTA/GGTCCC 3 -- int10--------
    rs1858456401,2
    --84355370(+) ACCCCA/GTCTCC 3 -- int10--------
    rs49005921,2
    C,F,A--84355394(+) TAAAAG/TACTTT 3 -- int17Minor allele frequency- T:0.27NA WA CSA EA 366
    rs2009698721,2
    C--84355485(+) GTTAAA/GAACAC 3 -- int10--------
    rs1882036401,2
    --84355528(+) AAATCC/TCATAG 3 -- int10--------
    rs563770121,2
    C,F--84355708(+) TCCAGT/CAGATC 6 /L syn11Minor allele frequency- C:0.04EA 120
    rs560186331,2
    C--84355747(+) CCAGGA/TTGAAT 3 -- ut510--------
    rs563140501,2
    C,F--84355944(+) CATGTC/TTGTCA 3 -- int11Minor allele frequency- T:0.03WA 118
    rs556539261,2
    C,F--84356264(+) TCAGTC/GGCCCC 3 -- int13Minor allele frequency- G:0.06CSA WA EA 240
    rs32120391,2
    C,F,H--84356372(-) GCTCGG/CGCTGT 3 -- int15Minor allele frequency- C:0.01NS EA 596
    rs1813868951,2
    C--84356374(+) AGCCCA/GAGCCT 3 -- int10--------
    rs32120381,2
    C,F,H--84356484(-) GGGGAT/CGCAGA 3 -- int111Minor allele frequency- C:0.30NS MN EA NA WA CSA 906
    rs1144805781,2
    C,F--84356550(+) GGCAGC/GAGCCT 3 -- int11Minor allele frequency- G:0.09WA 118
    rs32120371,2
    C--84356563(-) GACCCG/AGCCCT 3 -- int13Minor allele frequency- A:0.01NS NA 182
    rs1856743951,2
    --84356659(+) TTCCCC/TTGGAC 3 -- int10--------
    rs1147990201,2
    C,F--84356668(+) ACCACA/GCAGAA 3 -- int11Minor allele frequency- G:0.07WA 118
    rs1479669701,2
    --84356697(+) ACGATC/TACGCT 3 -- int10--------
    rs1490029921,2
    C--84357010(+) GGGGCA/GCTGAA 3 -- int10--------
    rs557293691,2
    C,F--84357227(+) CTCGCA/GCCTGG 3 -- int11Minor allele frequency- G:0.09WA 118
    rs1437786561,2
    C--84357242(+) GGACCC/TCACAC 3 -- int10--------
    rs32120351,2
    C,F,H--84357420(-) TTCCCG/AGTGCT 3 -- int13Minor allele frequency- A:0.01NS MN NA 462
    rs1908309511,2
    C--84357422(+) CACCGA/C/GGAAGG 3 -- int10--------
    rs456039421,2
    C--84357542(-) GGAGCC/TGGACT 3 -- int1 ut510--------
    rs17997941,2
    C,F,H--84357577(-) GCAGGA/GTGTGC 3 -- int1 ut5121Minor allele frequency- G:0.37EA NS MN NA CSA WA 3001
    rs8615291,2
    C,F,A--84357624(-) TCGTCG/ACTAAA 3 -- int125Minor allele frequency- A:0.12NS MN NA WA CSA EA 1607
    rs1510819741,2
    --84357627(+) AGTGAC/TGACCT 3 -- int10--------
    rs341009261,2
    C,F--84357657(-) CAGCTG/ATCAAG 3 -- int15Minor allele frequency- A:0.01MN 400
    rs1450334251,2
    C--84357729(+) GCATCC/TCCTTC 3 -- int10--------
    rs32120321,2
    H--84357811(-) GCCATG/TGGCTG 3 -- int15Minor allele frequency- T:0.00NS EA 528
    rs1388150861,2
    --84357858(+) AGACCA/GCAGTG 3 -- int10--------
    rs1405612411,2
    --84357927(+) CTTTCA/CCAGAT 3 -- int10--------
    rs32120311,2
    C,F,H--84357989(-) CTCCCA/GGGCCA 3 -- int113Minor allele frequency- G:0.07NS EA NA WA 1718
    rs784491771,2
    F--84358102(+) GAGCAG/CCCCAC 3 -- int11Minor allele frequency- C:0.03EA 120
    rs32120301,2
    C,F,H--84358234(-) CTAACA/CGCTCT 3 -- int14Minor allele frequency- C:0.01NS NA 354
    rs1495313271,2
    --84358300(+) CTTCCA/GAGGTG 3 -- int10--------
    rs787109411,2
    C,F--84358557(+) GAAGGT/CTGTGC 3 -- int11Minor allele frequency- C:0.08WA 118
    rs1157527631,2
    F--84358610(+) GACCTC/TGGTCC 3 -- int11Minor allele frequency- T:0.04WA 118
    rs32120291,2
    H--84358636(-) GAGAGC/TGGGAG 3 -- int15Minor allele frequency- T:0.00NS EA 578
    rs801961781,2
    C,F--84358666(+) AGGCAA/CACCTC 3 -- int12Minor allele frequency- C:0.06WA EA 238
    rs32120281,2
    C,F,H--84358703(-) GAGCGG/AGCCCC 3 -- int114Minor allele frequency- A:0.05NS NA 1724
    rs22951521,2
    C,F,H--84358754(-) GCAGGG/AAGGTG 3 -- int113Minor allele frequency- A:0.33EA NS NA WA CSA 2211
    rs1832459411,2
    --84358781(+) CCATGA/GAGGCC 3 -- int10--------
    rs1874379181,2
    --84358817(+) CTCCTC/TCCCTC 3 -- int10--------
    rs1177452131,2
    --84358848(+) GAACCC/TGAGAA 3 -- int11Minor allele frequency- T:0.01NA 120
    rs32120261,2
    C,F,H--84358910(-) AATAAG/AGAGAT 3 -- int114Minor allele frequency- A:0.04NS NA WA 1746
    rs32120251,2
    C,F,H--84358956(-) CTCTCC/TTGGGG 3 -- int16Minor allele frequency- T:0.01NS EA NA 662
    rs1918328601,2
    --84359028(+) CAGCAC/TCGTGG 3 -- int10--------
    rs32120241,2
    C,F--84359045(-) TTGGCC/TGCCTT 3 -- int19Minor allele frequency- T:0.29NS NA WA CSA EA 518
    rs1829279921,2
    --84359133(+) AAAGAA/GAAATA 3 -- int10--------
    rs1152236711,2
    C,F--84359163(+) CTTGCG/AGTCCC 3 -- int11Minor allele frequency- A:0.03WA 118
    rs1167008631,2
    C,F--84359231(+) CTCCAC/GCCCGG 3 -- int12Minor allele frequency- G:0.06WA EA 238
    rs1482353561,2
    C--84359332(+) TTTTTG/TTGTGT 3 -- int10--------
    rs1876819321,2
    --84359354(+) TGGAGC/TCTTTT 3 -- int10--------
    rs1997936531,2
    C--84359480(+) GGCACC/GTGCCA 3 -- int10--------
    rs1140659691,2
    C,F--84359635(+) CTAAAG/AGATTT 3 -- int12Minor allele frequency- A:0.05WA EA 238
    rs32120231,2
    F--84360026(-) ggggcTGCGAGC 
     CGGGC
    /-
    ggcag
    3 -- cds11Minor allele frequency- -:0.01NS 178
    rs1912127811,2
    --84360208(+) CAATCC/GAAAGT 3 -- us2k10--------
    rs1412042841,2
    --84360223(+) ATCTCC/TCTGAG 3 -- us2k10--------
    rs1164048951,2
    C,F--84360987(+) GTCCCG/TAGAGC 3 -- us2k11Minor allele frequency- T:0.08WA 118
    rs32120211,2
    F--84361186(-) ACTGGG/ATCCTG 3 -- us2k11Minor allele frequency- A:0.02NS 172
    rs1826737401,2
    --84361247(+) TCGGAA/GGCGAG 3 -- us2k10--------
    rs8615281,2
    C,F,H--84361308(-) CCCATG/AGGAAA 3 -- us2k128Minor allele frequency- A:0.13MN NS EA NA WA 3484
    rs761516411,2
    C,F--84361405(+) CTCCCG/ATGGGG 3 -- us2k11Minor allele frequency- A:0.09WA 118
    rs1473901091,2
    C--84361532(+) GTTCTG/TTGGAT 3 -- us2k10--------
    rs1428069291,2
    C--84361631(+) TCCCT-/CAGTGAT 3 -- us2k10--------
    rs2001363061,2
    --84361711(+) CTTGG-/TTTGGA 3 -- us2k10--------
    rs1477283141,2
    C--84361725(+) CTGGT-/GGGGGGTG 3 -- us2k10--------
    rs1129651731,2
    C,F--84361735(+) GTGAGC/TGGCCA 3 -- us2k11Minor allele frequency- T:0.50NA 2
    rs1148391711,2
    C,F--84361808(+) TGTACG/AGAGCC 3 -- us2k11Minor allele frequency- A:0.08WA 118
    rs362091111,2
    C--84361850(-) CACTGC/GTCTCA 3 -- us2k10--------
    rs799955111,2
    C,F--84361966(+) GAAAAT/CTGTAT 3 -- us2k11Minor allele frequency- C:0.09WA 118
    rs1450633321,2
    C--84361978(+) TATGGC/TGTAAC 3 -- us2k10--------
    rs1850106181,2
    --84361983(+) TGTAAC/TGAACT 3 -- us2k10--------
    rs740852711,2
    C,F--84362013(+) TCTACG/ATCTGT 3 -- us2k12Minor allele frequency- A:0.14WA 120
    rs360858451,2
    C--104168208(+) TCTTA-/AAAAAA 3 -- int10--------
    rs3694260221,2
    C--104168220(+) AAAAA-/AGAGAA 3 -- int11Minor allele frequency- A:0.50NA 2
    rs106653521,2
    C--104176924(+) ACAAA-/AA    
       G
    /GAA
    AAAAT
    6 -- cds11CSA 2
    rs341060661,2
    C--104176925(+) CAAAA-/AAGAAATT 3 -- cds10--------
    rs711260541,2
    C--104176926(-) TAATTTTC/-TTTTT 3 -- cds11Minor allele frequency- -:0.00NA 2
    rs1399616901,2
    C--104177190(+) TAAGA-/ACACACA 3 -- int10--------
    rs1134383401,2
    C--104177191(+) AAGAA-/AC/CA 
            
    CACAC
    3 -- int11CSA 2
    rs711260551,2
    C--104177220(-) TTCAG-/GG/GT 
            
    GTGTG
    3 -- int11NA 2
    rs23077311,2
    C,F--104178445(-) TGTTCTCCACGC 
     CGGGC
    /-
    CTGTC
    3 -- cds15Minor allele frequency- -:0.09EU NA EA NS 520
    rs2007130731,2
    C--104178445(-) TGTTCC/TTNNNN 3 -- int10--------
    rs171154871,2
    C--104178446(-) CTGTT-/CTCCACGCCGG
    G
    /TCCACGCCGGGC
    CCTGT
    6 -- cds11NA 2
    rs8615391,2,4
    ----see VAR_0130062 mis40--------
    rs289030801,2,4
    ----see VAR_0292952 mis40--------
    rs289030811,2,4
    ----see VAR_0292962 mis40--------
    rs3685846281,2
    ----84353426(+) GGACCA/GATCCC 3 -- int10--------
    rs1115364081,2
    ----84346719(+) ATAAAG/CTAAGC 3 -- int11Minor allele frequency- C:0.00CSA 1
    rs3721742391,2
    ----104168539(+) CTGCT-/TGCT  
            
    CTCTG
    3 -- int10--------
    rs3735877991,2
    ----84355595(+) GCCAGC/TGTTTT 3 -- int10--------
    rs563465871,2
    ----84357906(+) GCCTGA/GTCTCT 3 -- int10--------
    rs32120601,2
    ----84351259(-) TGCCCC/TGCCGC 3 -- int11Minor allele frequency- T:0.01NS 180
    rs3704170511,2
    ----84350720(+) GGGCTC/TTCAGG 3 -- int10--------
    rs558568271,2
    ----84357691(+) TCCCCC/TGGGCG 3 -- int10--------
    rs71563811,2
    ----84359436(+) caaacA/Gattct 3 -- int10--------
    rs3767985151,2
    ----84348488(+) AGGATA/GTGTAG 3 -- int10--------
    rs3707146021,2
    ----84354838(+) CCACAA/CCAGGT 3 -- int10--------
    rs3723836571,2
    ----84351818(+) GGAACC/TGCTCC 6 Q R mis10--------
    rs3717427191,2
    ----84350065(+) GTGGGC/TGGGCC 3 -- int10--------
    rs357703761,2
    ----84361458(+) CCCTT-/GGGCCA 3 -- us2k10--------
    rs3685849041,2
    ----84351443(+) GCTGTC/TAGCTG 3 -- int10--------
    rs3736048741,2
    ----84357522(+) CTCACC/TGTTGG 3 -- int1 ut510--------
    rs779147001,2
    ----84355374(+) CGTCTC/ACAAAA 3 -- int11Minor allele frequency- A:0.50NA 2
    rs3772859061,2
    ----84355142(+) GAGGCA/GGGCGG 3 -- int10--------
    rs562101011,2
    ----84353018(+) AACTC-/TGGGGCT 3 -- int10--------
    rs3701937901,2
    ----84351378(+) TGGGGG/TCTAGC 3 -- int10--------
    rs3691150451,2
    ----84353325(+) TGTCAA/GACTGT 3 -- int10--------
    rs3684636651,2
    ----84354960(-) AGCGTA/GCCTAC 3 -- int10--------
    rs3694743691,2
    ----84361659(+) TGGAAC/GAGGTT 3 -- us2k10--------
    rs3765821641,2
    ----84355728(+) TTTGTC/TGGTGG 3 -- ut510--------
    rs756605461,2
    ----84355881(+) TGTCAG/CTGAGG 3 -- spa11Minor allele frequency- C:0.50NA 2
    rs1389877601,2
    ----84347923(+) TTGTGC/TGGGAA 6 P syn11Minor allele frequency- T:0.00NA 2994
    rs1402173531,2
    ----84356733(+) TGCTC-/CCCGG 
     CGTGGAG
    AGGGA
    3 -- cds10--------
    rs3729858821,2
    ----84353179(+) CAAGTG/TTAAGG 6 N H mis10--------
    rs3725984831,2
    ----84357928(+) TTTCAC/GGATAT 3 -- int10--------
    rs3710737591,2
    ----84358585(+) CTATAC/GGCTGC 3 -- int10--------
    rs3729129401,2
    ----84357084(+) CAAATC/TAAAAG 3 -- int10--------
    rs3690840741,2
    ----84347758(+) GTCCTA/GAATAG 3 -- int10--------
    rs3687137011,2
    ----84360452(+) GGCCGA/GGTGCG 3 -- us2k10--------
    rs3720489431,2
    ----84349189(+) TGCGCC/TCCACG 3 -- int10--------
    rs3769861731,2
    ----84357344(+) CTGTCA/GGAGGC 3 -- int10--------
    rs1123458231,2
    ----84358874(+) AATAAG/ACCGTG 3 -- int11Minor allele frequency- A:0.00CSA 1
    rs346655731,2
    ----84348278(+) TCCTT-/CCCCCT 3 -- int10--------

    HapMap Linkage Disequilibrium report for XRCC3 (104163946 - 104181841 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for XRCC3 (see all 13):   &