Free for academic non-profit institutions. Other users need a Commercial license

Aliases for WIZ Gene

Aliases for WIZ Gene

  • Widely Interspaced Zinc Finger Motifs 2 3 5
  • Widely-Interspaced Zinc Finger-Containing Protein 3 4
  • Zinc Finger Protein 803 3 4
  • WIZ Zinc Finger 2 3
  • ZNF803 3 4
  • Protein Wiz 3

External Ids for WIZ Gene

Previous GeneCards Identifiers for WIZ Gene

  • GC19M015911
  • GC19M015377
  • GC19M015394
  • GC19M015395
  • GC19M015532
  • GC19M015100

Summaries for WIZ Gene

GeneCards Summary for WIZ Gene

WIZ (Widely Interspaced Zinc Finger Motifs) is a Protein Coding gene. Diseases associated with WIZ include Bladder Exstrophy-Epispadias-Cloacal Exstrophy Complex and Asphyxia Neonatorum. Gene Ontology (GO) annotations related to this gene include SET domain binding. An important paralog of this gene is ZNF644.

UniProtKB/Swiss-Prot for WIZ Gene

  • May link EHMT1 and EHMT2 histone methyltransferases to the CTBP corepressor machinery. May be involved in EHMT1-EHMT2 heterodimer formation and stabilization (By similarity).

Additional gene information for WIZ Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for WIZ Gene

Genomics for WIZ Gene

GeneHancer (GH) Regulatory Elements for WIZ Gene

Promoters and enhancers for WIZ Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I015449 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 -1.4 -1374 4.3 HDGF PKNOX1 ATF1 ARNT SIN3A ZNF2 YY1 ZNF121 GLIS2 ZNF143 MIR1470 WIZ AKAP8 BRD4 TPM4 RAB8A ZNF333 ENSG00000273218 RASAL3 GC19M015202
GH19I015448 Enhancer 0.8 ENCODE 550.8 +1.1 1051 0.2 ZNF2 THRB BCL11B ZEB1 ZNF335 ZBTB48 ZNF366 PATZ1 ZNF391 ZNF600 MIR1470 WIZ PIR35527 GC19M015429 GC19M015202
GH19I015450 Enhancer 0.7 ENCODE 550.8 +0.8 831 0.2 MXI1 EBF1 THRB BCL11B ZEB1 ZNF335 ZNF366 ZBTB48 PATZ1 PRDM10 MIR1470 WIZ PIR35527 GC19M015429 GC19M015202
GH19I014570 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.8 +878.2 878159 1.8 HDGF PKNOX1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B NDUFB7 AKAP8 CCDC130 DDX39A DCAF15 BRD4 RFX1 ENSG00000268189 WIZ DNAJB1
GH19I016063 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 5.4 -623.0 -622957 18.7 CLOCK FEZF1 DMAP1 IRF4 E2F8 ZNF143 ZNF263 MCM3 SP3 MEF2D TPM4 AKAP8 CHERP ENSG00000269578 C19orf44 BRD4 ENSG00000267904 ENSG00000268087 SMIM7 MED26
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around WIZ on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the WIZ gene promoter:

Genomic Locations for WIZ Gene

Genomic Locations for WIZ Gene
chr19:15,419,980-15,449,956
(GRCh38/hg38)
Size:
29,977 bases
Orientation:
Minus strand
chr19:15,532,318-15,560,762
(GRCh37/hg19)

Genomic View for WIZ Gene

Genes around WIZ on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
WIZ Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for WIZ Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for WIZ Gene

Proteins for WIZ Gene

  • Protein details for WIZ Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O95785-WIZ_HUMAN
    Recommended name:
    Protein Wiz
    Protein Accession:
    O95785
    Secondary Accessions:
    • B3KVH1
    • B7ZM82
    • M0QY21
    • Q4G0E0
    • Q6P6B0
    • Q6ZN24
    • Q7LDY6
    • Q7LDZ1
    • Q96IG5
    • Q96SQ6
    • Q9BUR8
    • Q9NPT1

    Protein attributes for WIZ Gene

    Size:
    1651 amino acids
    Molecular mass:
    178674 Da
    Quaternary structure:
    • Interacts with EHMT1, EHMT2, CTBP1 and CTBP2 (By similarity). Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2.
    SequenceCaution:
    • Sequence=BAB55234.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for WIZ Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for WIZ Gene

Post-translational modifications for WIZ Gene

  • Ubiquitination at posLast=15971597

No data available for DME Specific Peptides for WIZ Gene

Domains & Families for WIZ Gene

Gene Families for WIZ Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for WIZ Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

O95785

UniProtKB/Swiss-Prot:

WIZ_HUMAN :
  • The C2H2-type zinc finger 11 mediates interaction with EHMT1 and EHMT2.
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
Domain:
  • The C2H2-type zinc finger 11 mediates interaction with EHMT1 and EHMT2.
Family:
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
genes like me logo Genes that share domains with WIZ: view

Function for WIZ Gene

Molecular function for WIZ Gene

UniProtKB/Swiss-Prot Function:
May link EHMT1 and EHMT2 histone methyltransferases to the CTBP corepressor machinery. May be involved in EHMT1-EHMT2 heterodimer formation and stabilization (By similarity).

Phenotypes From GWAS Catalog for WIZ Gene

Gene Ontology (GO) - Molecular Function for WIZ Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003676 nucleic acid binding IEA --
GO:0005515 protein binding IPI 16702210
GO:0046872 metal ion binding IEA --
GO:0070984 SET domain binding IEA --
genes like me logo Genes that share ontologies with WIZ: view

Phenotypes for WIZ Gene

genes like me logo Genes that share phenotypes with WIZ: view

Animal Model Products

CRISPR Products

miRNA for WIZ Gene

miRTarBase miRNAs that target WIZ

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for WIZ Gene

Localization for WIZ Gene

Subcellular locations from UniProtKB/Swiss-Prot for WIZ Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for WIZ gene
Compartment Confidence
extracellular 5
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (4)
  • Midbody (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for WIZ Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA,IEA 16702210
GO:0005654 nucleoplasm IDA --
GO:0030496 midbody IDA --
GO:0070062 extracellular exosome IDA,HDA 19056867
genes like me logo Genes that share ontologies with WIZ: view

Pathways & Interactions for WIZ Gene

No Data Available

Gene Ontology (GO) - Biological Process for WIZ Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010571 positive regulation of nuclear cell cycle DNA replication IMP 23545495
GO:0050821 protein stabilization IMP 16702210
GO:0070208 protein heterotrimerization IDA 16702210
genes like me logo Genes that share ontologies with WIZ: view

No data available for Pathways by source and SIGNOR curated interactions for WIZ Gene

Drugs & Compounds for WIZ Gene

No Compound Related Data Available

Transcripts for WIZ Gene

Unigene Clusters for WIZ Gene

Widely interspaced zinc finger motifs:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for WIZ Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13
SP1: -
SP2: - - - - -
SP3:
SP4: -
SP5:
SP6:

Relevant External Links for WIZ Gene

GeneLoc Exon Structure for
WIZ
ECgene alternative splicing isoforms for
WIZ

Expression for WIZ Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for WIZ Gene

Protein differential expression in normal tissues from HIPED for WIZ Gene

This gene is overexpressed in Heart (31.9) and Peripheral blood mononuclear cells (12.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for WIZ Gene



Protein tissue co-expression partners for WIZ Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of WIZ Gene:

WIZ

SOURCE GeneReport for Unigene cluster for WIZ Gene:

Hs.442138

Evidence on tissue expression from TISSUES for WIZ Gene

  • Nervous system(4.5)
  • Skin(4.3)
  • Muscle(4.1)
genes like me logo Genes that share expression patterns with WIZ: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for WIZ Gene

Orthologs for WIZ Gene

This gene was present in the common ancestor of chordates.

Orthologs for WIZ Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia WIZ 33 34
  • 99.15 (n)
dog
(Canis familiaris)
Mammalia WIZ 33 34
  • 89.45 (n)
cow
(Bos Taurus)
Mammalia WIZ 33 34
  • 88.88 (n)
rat
(Rattus norvegicus)
Mammalia Wiz 33
  • 86.79 (n)
mouse
(Mus musculus)
Mammalia Wiz 33 16 34
  • 86.46 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia WIZ 34
  • 59 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia WIZ 34
  • 30 (a)
OneToOne
chicken
(Gallus gallus)
Aves WIZ 33
  • 69.68 (n)
lizard
(Anolis carolinensis)
Reptilia WIZ 34
  • 33 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii WIZ 34
  • 13 (a)
OneToOne
wufi11h08 33
Species where no ortholog for WIZ was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for WIZ Gene

ENSEMBL:
Gene Tree for WIZ (if available)
TreeFam:
Gene Tree for WIZ (if available)

Paralogs for WIZ Gene

Paralogs for WIZ Gene

Pseudogenes.org Pseudogenes for WIZ Gene

genes like me logo Genes that share paralogs with WIZ: view

Variants for WIZ Gene

Sequence variations from dbSNP and Humsavar for WIZ Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000062281 -- 15,432,526(-) GGCGGCGGCGGGGGTGGGGGCGGCGGCGG/GGCGGCGGCGG 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000067924 -- 15,436,356(-) G/T genic_upstream_transcript_variant, intron_variant
rs1000087652 -- 15,446,274(-) T/C genic_upstream_transcript_variant, intron_variant
rs1000169098 -- 15,429,185(-) C/T intron_variant
rs1000205649 -- 15,434,919(-) T/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for WIZ Gene

Variant ID Type Subtype PubMed ID
nsv1064684 CNV gain 25217958
nsv1118815 CNV deletion 24896259
nsv819830 CNV gain 19587683
nsv833765 CNV loss 17160897
nsv953987 CNV deletion 24416366

Variation tolerance for WIZ Gene

Residual Variation Intolerance Score: 20.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.81; 58.39% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for WIZ Gene

Human Gene Mutation Database (HGMD)
WIZ
SNPedia medical, phenotypic, and genealogical associations of SNPs for
WIZ

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for WIZ Gene

Disorders for WIZ Gene

MalaCards: The human disease database

(4) MalaCards diseases for WIZ Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
bladder exstrophy-epispadias-cloacal exstrophy complex
  • exstrophy-epispadias complex
asphyxia neonatorum
  • asphyxia - birth
exstrophy of bladder
  • bladder exstrophy
kleefstra syndrome
  • 9q subtelomeric deletion syndrome
- elite association - COSMIC cancer census association via MalaCards
Search WIZ in MalaCards View complete list of genes associated with diseases
genes like me logo Genes that share disorders with WIZ: view

No data available for UniProtKB/Swiss-Prot and Genatlas for WIZ Gene

Publications for WIZ Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  2. Insertional polymorphisms of ETn retrotransposons include a disruption of the wiz gene in C57BL/6 mice. (PMID: 12226707) Baust C … Mager DL (Mammalian genome : official journal of the International Mammalian Genome Society 2002) 2 3 58
  3. Molecular cloning and distinct developmental expression pattern of spliced forms of a novel zinc finger gene wiz in the mouse cerebellum. (PMID: 9795207) Matsumoto K … Tohyama M (Brain research. Molecular brain research 1998) 2 3 58
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  5. Site-specific mapping of the human SUMO proteome reveals co-modification with phosphorylation. (PMID: 28112733) Hendriks IA … Nielsen ML (Nature structural & molecular biology 2017) 4 58

Products for WIZ Gene

Sources for WIZ Gene

Content
Loading form....