Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

VPS45 Gene

protein-coding   GIFtS: 56
GCID: GC01P150039

vacuolar protein sorting 45 homolog (S. cerevisiae)

(Previous names: vacuolar protein sorting 45A (yeast homolog), vacuolar...)
(Previous symbols: VPS45B, VPS45A)
 Explore 2 diseases affiliated with
VPS45 via our new
 Human Malady Compendium 
Biological research products
for VPS45
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Vacuolar Protein Sorting 45 Homolog (S. Cerevisiae)1 2     H1VPS452
VPS45A1 2 3 5     VPS54A2
VPS45B1 2 3     VSP452
H11 2     VSP45A2
HlVps451     Leucocyte Vacuolar Protein Sorting 452
H-Vps451     Vacuolar Protein Sorting 45A2
Vacuolar Protein Sorting 45A (Yeast Homolog)1     Vacuolar Protein Sorting-Associated Protein 452
Vacuolar Protein Sorting 45A (Yeast)1     H-VPS451

External Ids:    HGNC: 145791   Entrez Gene: 113112   Ensembl: ENSG000001366317   OMIM: 6100355   UniProtKB: Q9NRW73   

Export aliases for VPS45 gene to outside databases

Previous GC identifers: GC01P148306 GC01P121419


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for VPS45:
Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct
organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in
vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence
similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in
peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators.
(provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: VPS45_HUMAN, Q9NRW7
Function: May play a role in vesicle-mediated protein trafficking from the Golgi stack through the trans-Golgi network

Gene Wiki entry for VPS45


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.1  NT_004487.19  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the VPS45 gene promoter:
         Nkx3-1   Nkx3-1 v4   Brachyury   Nkx3-1 v1   STAT5A   IRF-1   Nkx3-1 v2   Nkx3-1 v3   LHX3a/Lhx3a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidVPS45 promoter sequence
   Search SABiosciences Chromatin IP Primers for VPS45

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat VPS45


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q21.2   Ensembl cytogenetic band:  1q21.2   HGNC cytogenetic band: 1q21.2

VPS45 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
VPS45 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P150039:  view genomic region     (about GC identifiers)

Start:
150,039,342 bp from pter      End:
150,117,505 bp from pter
Size:
78,164 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: VPS45_HUMAN, Q9NRW7 (See protein sequence)
Recommended Name: Vacuolar protein sorting-associated protein 45  
Size: 570 amino acids; 65077 Da
Subunit: Interacts with STX6 (By similarity). Interacts with ZFYVE20
Subcellular location: Golgi apparatus membrane; Peripheral membrane protein (By similarity). Endosome membrane;
Peripheral membrane protein (By similarity). Note=Associated with Golgi/endosomal vesicles and the trans-Golgi network
(By similarity)
Secondary accessions: D3DUZ9 Q15715 Q5T4P6 Q9Y4Z6

Explore the universe of human proteins at neXtProt for VPS45: NX_Q9NRW7

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9NRW7

  • VPS45 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_009190.2  
    ENSEMBL proteins: 
     ENSP00000358126   ENSP00000400143   ENSP00000440690   ENSP00000358124  
    Reactome Protein details: Q9NRW7
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: VPS45
    OriGene Protein Over-expression Lysate: VPS45
    OriGene Custom Protein Services for VPS45 
    GenScript Custom Purified and Recombinant Proteins Services for VPS45
    Novus Biologicals VPS45 Protein
    Novus Biologicals VPS45 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for VPS45

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000139Golgi membrane IEA--
    GO:0000299integral to membrane of membrane fraction ----
    GO:0005575cellular_component ND--
    GO:0005622intracellular ----
    GO:0005794Golgi apparatus ISS--


    VPS45 for ontologies           About GeneDecksing



    VPS45 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies (see all 2): VPS45
    OriGene Custom Antibody Services for VPS45 
    GenScript Custom Superior Antibodies Services for VPS45
    Novus Biologicals VPS45 Antibodies
    Search for Antibodies for VPS45 at Abcam  
    Uscn Antibodies for VPS45
    ThermoFisher Antibodies for VPS45

    Assay Products for VPS45: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for VPS45
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for VPS45


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    VPS45 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR001619 Sec1-like

    Graphical View of Domain Structure for InterPro Entry Q9NRW7

    ProtoNet protein and cluster: Q9NRW7

    1 Blocks protein family: IPB001619 Sec1-like protein

    UniProtKB/Swiss-Prot: VPS45_HUMAN, Q9NRW7
    Similarity: Belongs to the STXBP/unc-18/SEC1 family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: VPS45_HUMAN, Q9NRW7
    Function: May play a role in vesicle-mediated protein trafficking from the Golgi stack through the trans-Golgi network

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: VPS45
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat VPS45
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate VPS45:
    hsa-miR-1290 hsa-miR-206 hsa-miR-485-3p hsa-miR-1 hsa-miR-619 hsa-miR-613 hsa-miR-1286 hsa-miR-143*
    SwitchGear 3'UTR luciferase reporter plasmidVPS45 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VPS45 (see all 7)
    OriGene shRNA RFP: VPS45
    OriGene siRNA: VPS45
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VPS45

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for VPS45

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: VPS45 (NM_007259)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for VPS45
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VPS45 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for VPS45
    Search LifeMap BioReagents cell lines for VPS45

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VPS45

    Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003674molecular_function ND--
    GO:0005515protein binding ----


    VPS45 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for VPS45:
     Increased gamma-H2AX phosphory 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Normal wtCFTR traffic / Sorting endosome formation
    Normal wtCFTR traffic / Sorting endosome formation1.00
    Delta508-CFTR traffic / Sorting endosome formation in CF0.77
    2Factors involved in megakaryocyte development and platelet production
    Factors involved in megakaryocyte development and platelet production1.00
    3Endocytosis
    Endocytosis1.00
    4Clathrin-dependent protein traffic
    Transport_Clathrin-coated vesicle cycle0.66
    5Platelet activation, signaling and aggregation
    Hemostasis0.43

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    3 GeneGo (Thomson Reuters) Pathways for VPS45
        Normal wtCFTR traffic / Sorting endosome formation
    Delta508-CFTR traffic / Sorting endosome formation in CF
    Transport Clathrin-coated vesicle cycle

    2        Reactome Pathways for VPS45
        Hemostasis
    Factors involved in megakaryocyte development and platelet production


    1         Kegg Pathway  (Kegg details for VPS45):
        Endocytosis


    VPS45 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for VPS45

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/52 Interacting proteins for VPS45 (Q9NRW73 ENSP000003581264) via UniProtKB, MINT, STRING, and/or I2D (see all 52)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    NAPBQ9H1153, ENSP000003662254I2D: score=4 STRING: ENSP00000366225
    PSMD3O432423, ENSP000002646394I2D: score=3 STRING: ENSP00000264639
    VPS18Q9P2533, ENSP000002205094I2D: score=3 STRING: ENSP00000220509
    STX16O146623, ENSP000003601834I2D: score=2 STRING: ENSP00000360183
    AP3D1O146173, ENSP000003440554I2D: score=1 STRING: ENSP00000344055
    About this table

    Gene Ontology (GO): 3 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006886intracellular protein transport NAS10404641
    GO:0006904vesicle docking involved in exocytosis IEA--
    GO:0007596blood coagulation TAS--


    VPS45 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for VPS45
    Search CenterWatch for drugs/clinical trials and news about VPS45 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for VPS45 gene: 
    NM_007259.3  

    Unigene Cluster for VPS45:

    Vacuolar protein sorting 45 homolog (S. cerevisiae)
    Hs.443750  [show with all ESTs]
    Unigene Representative Sequence: NM_007259
    12 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000369130(uc010pbr.1 uc009wlm.1 uc010pbp.1 uc001etp.3 uc010pbq.2 uc001etq.3)
    ENST00000462852 ENST00000478999 ENST00000460366 ENST00000497638 ENST00000419023
    ENST00000477558 ENST00000472756 ENST00000491789 ENST00000484306 ENST00000535106
    ENST00000369128(uc010pbs.2)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: VPS45
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat VPS45
    8 QIAGEN miScript miRNA Assays for microRNAs that regulate VPS45:
    hsa-miR-1290 hsa-miR-206 hsa-miR-485-3p hsa-miR-1 hsa-miR-619 hsa-miR-613 hsa-miR-1286 hsa-miR-143*
    SwitchGear 3'UTR luciferase reporter plasmidVPS45 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VPS45 (see all 7)
    OriGene shRNA RFP: VPS45
    OriGene siRNA: VPS45
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VPS45
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: VPS45 (NM_007259)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for VPS45
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VPS45 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VPS45
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat VPS45
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VPS45
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VPS45

    Additional cDNA sequence: 

    AF165513.1 AJ133421.1 AK023170.1 AK223214.1 AK293555.1 AK295529.1 AK298786.1 AK298835.1 
    AK301994.1 AK307949.1 AY453586.1 BC012932.1 BC028382.2 

    19 DOTS entries:

    DT.447459  DT.95284029  DT.95194412  DT.100803657  DT.75164560  DT.95194417  DT.95239400  DT.121414882 
    DT.416990  DT.97845520  DT.99988117  DT.40113939  DT.92463595  DT.95194400  DT.95194413  DT.100803655 
    DT.40132558  DT.92463612  DT.95194414 

    24/253 AceView cDNA sequences (see all 253):

    AU131412 AA291962 BC028382 N50867 AI057492 BQ001991 BM454221 BM563489 
    BM681711 BU528438 BM724061 AA099573 AA809510 AW117623 AA738488 NM_007259 
    AA902761 BI489999 BE855917 H98649 BQ951312 AA765898 CB159551 BM708815 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for VPS45 (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2a · 2b · 2c · 2d ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b · 7c ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11a · 11b ^ 12a ·
    SP1:                                            -           -                 -           -                 -     -                                             
    SP2:                                            -           -                 -     -     -     -     -     -     -                                             
    SP3:                                                        -                 -           -                 -     -                                             
    SP4:                    -     -     -     -     -           -                 -           -                                                                     
    SP5:                                            -           -                 -                                                                                 

    ExUns: 12b ^ 13 ^ 14 ^ 15 ^ 16 ^ 17a · 17b
    SP1:                    -                     
    SP2:                                          
    SP3:                                          
    SP4:                                          
    SP5:                                          


    ECgene alternative splicing isoforms for VPS45

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    VPS45 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATGACCACA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See VPS45 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for VPS45

    SOURCE GeneReport for Unigene cluster: Hs.443750

    UniProtKB/Swiss-Prot: VPS45_HUMAN, Q9NRW7
    Tissue specificity: Ubiquitous. Expression was highest in testis, heart and brain, intermediate in kidney, spleen,
    prostate, ovary, small intestine and thymus and low in lung, skeletal muscle, placenta, colon, pancreas, peripheral
    blood leukocytes and liver

        SABiosciences Expression via Pathway-Focused PCR Array including VPS45: 
              Inflammatory Response & Autoimmunity 384HT in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VPS45
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat VPS45
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VPS45
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VPS45
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VPS45

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for VPS45 gene from 9/35 species (see all 35)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves VPS451 vacuolar protein sorting 45 homolog (S. cerevisiae) 79.89(n)
    92.39(a)
      430741  NM_001031593.1  NP_001026764.1 
    lizard
    (Anolis carolinensis)
    Reptilia VPS456
    --
    91(a)
    1 ↔ 1
    GL345017.1(598-10330)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.87032 Xenopus laevis transcribed sequence with moderate similarity more 78.17(n)    BU912999.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.158742 Transcribed sequence with moderate similarity to protein more 75.23(n)    57089617 
    fruit fly
    (Drosophila melanogaster)
    Insecta Vps451 Vacuolar protein sorting 45 56.66(n)
    55.52(a)
      41153  NM_141652.1  NP_649909.1 
    worm
    (Caenorhabditis elegans)
    Secernentea vps-451 Protein VPS-45 51.54(n)
    48.96(a)
      180449  NM_171622.3  NP_741714.1 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes VPS45(YGL095C)4
    VPS451
    Protein of the Sec1p/Munc-18 family, essential for more4
    Vps45p1
    49.07(n)1
    39.88(a)1
      7(330607-328874)4
    8527851, 4  NP_011420.31  NP_011420.14 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons VPS451 vacuolar protein sorting-associated protein 45-like more 52.6(n)
    47.1(a)
      844050  NM_106364.1  NP_565150.1 
    rice
    (Oryza sativa)
    Liliopsida AK066001.12   -- 77.44(n)    AK066001.1 


    ENSEMBL Gene Tree for VPS45 (if available)
    TreeFam Gene Tree for VPS45 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1307 NCBI SNPs in VPS45 are shown (see all 1307    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1504996191,2
    --150037406(+) TCTATA/CCTTAA 1 -- us2k10--------
    rs1882123731,2
    --150037411(+) CCTTAA/CAGCAC 1 -- us2k10--------
    rs1807018981,2
    --150037453(+) TCAAGA/TTGAAG 1 -- us2k10--------
    rs75209301,2
    C,F,A,H,--150037560(+) GTTTAC/TTTATA 1 -- us2k1 tfbs321Minor allele frequency- T:0.37NS EA NA WA CSA 2010
    rs557300681,2
    C,--150037636(+) AAGTAA/CCTGGG 1 -- us2k12Minor allele frequency- C:0.12WA 120
    rs1437343331,2
    C,--150037774(+) CTTCA-/GGAAGG 1 -- us2k10--------
    rs1398152161,2
    --150037788(+) GATGCA/TGTCTA 1 -- us2k10--------
    rs567193041,2
    C--150037853(+) TGTTT-/TTTTTTTTTTTTTTTTTTTTTTTTGAG
    ACGGAGTCTCGCTCTGTCGCAAAATGTTT
    ATGTT
    1 -- us2k11Minor allele frequency- TTTTTTTTTTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCAAAATGTTT:0.00NA 2
    rs1412781821,2
    C,--150037897(+) TCTGT-/CGCAAA 1 -- us2k10--------
    rs1863606841,2
    --150038200(+) AATTAC/TAGGTA 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for VPS45 (150039342 - 150117505 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 2 variations for VPS45
         1 CNV: 97505
         1 Indel: 44449

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing VPS45
    DNA2.0 Custom Variant and Variant Library Synthesis for VPS45

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    VPS45 for disorders           About GeneDecksing

    OMIM gene information: 610035    OMIM disorders: --

    2 diseases for VPS45:    About MalaCards
    malaria    prostatitis


    Export disorders for VPS45 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for VPS45 gene, integrated from 9 sources (see all 26):
    (articles sorted by number of sources associating them with VPS45)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Mammalian homologues of yeast vacuolar protein sorting (vps) genes implicated in Golgi-to-lysosome trafficking. (PubMed id 8996080)1, 2, 3 Pevsner J.... Scheller R.H. (1996)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    4. Divalent Rab effectors regulate the sub-compartmental organization and sorting of early endosomes. (PubMed id 11788822)1, 2 de Renzis S.... Zerial M. (2002)
    5. Rabenosyn-5, a novel Rab5 effector, is complexed with hVPS45 and recruited to endosomes through a FYVE finger domain. (PubMed id 11062261)1, 2 Nielsen E.... Zerial M. (2000)
    6. Molecular cloning and characterization of a cDNA encoding the human leucocyte vacuolar protein sorting (hlVps45). (PubMed id 10404641)1, 2 Rajasekariah P.... Sutherland G.R. (1999)
    7. Proteome-wide identification of ubiquitylation sites b y conjugation of engineered lysine-less ubiquitin. (PubMed id 22053931)1 Oshikawa K....Nakayama K.I. (2012)
    8. A census of human soluble protein complexes. (PubMed id 22939629)1 Havugimana P.C....Emili A. (2012)
    9. Methods for quantification of in vivo changes in prote in ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)1 Udeshi N.D....Carr S.A. (2012)
    10. Functional dissection of lysine deacetylases reveals t hat HDAC1 and p300 regulate AMPK. (PubMed id 22318606)1 Lin Y.Y....Boeke J.D. (2012)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 11311 HGNC: 14579 AceView: VPS45A Ensembl:ENSG00000136631 euGenes: HUgn11311
    ECgene: VPS45 Kegg: 11311 H-InvDB: VPS45

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for VPS45 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for VPS45 gene:
    Search GeneIP for patents involving VPS45

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for VPS45   OriGene shRNA RFP for VPS45  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VPS45   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VPS45  
     OriGene Protein Over-expression Lysate for VPS45   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for VPS45   OriGene 3'-UTR Clone for VPS45  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VPS45  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for VPS45   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for VPS45   OriGene Custom Protein Services for VPS45  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat VPS45
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing VPS45
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat VPS45
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VPS45
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VPS45
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VPS45
     GenScript Custom Purified and Recombinant Proteins Services for VPS45 GenScript cDNA clones with any tag delivered in your preferred vector for VPS45
     GenScript Custom Assay Services for VPS45 GenScript Custom Superior Antibodies Services for VPS45
     GenScript Custom overexpressing Cell Line Services for VPS45 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in VPS45 promoter
     Search Chromatin IP Primers for VPS45
     RT2 qPCR Primer Assay in human, mouse, rat VPS45
     Search GNC Networks for VPS45
     SABiosciences PCR Arrays including human, mouse, rat VPS45
     Search Tocris compounds for VPS45
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     VPS45 antibodies
     VPS45 proteins
     VPS45 lysates
     Search for Antibodies for VPS45 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for VPS45
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     VPS45 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for VPS45
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VPS45
     SwitchGear 3'UTR luciferase reporter plasmids for VPS45
     SwitchGear Promoter luciferase reporter plasmids for VPS45
     ThermoFisher Antibodies for VPS45
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VPS45
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      VPS45 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4