Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

VGLL4 Gene

protein-coding   GIFtS: 49
GCID: GC03M011597

vestigial like 4 (Drosophila)

 Explore 1 disease affiliated with
VGLL4 via our new
 Human Malady Compendium 
Biological research products
for VGLL4
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Vestigial Like 4 (Drosophila)1 2
KIAA01211 3
VGL-42
Transcription Cofactor Vestigial-Like Protein 42
Vestigial-Like 42
Vgl-43

External Ids:    HGNC: 289661   Entrez Gene: 96862   Ensembl: ENSG000001445607   UniProtKB: Q141353   

Export aliases for VGLL4 gene to outside databases

Previous GC identifers: GC03M011573 GC03M011574


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: VGLL4_HUMAN, Q14135
Function: May act as a specific coactivator for the mammalian TEFs (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000003.11  NC_018914.1  NT_022517.18  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the VGLL4 gene promoter:
         Sox5   Sp1   FOXF2   FOXD1   SRY   ARP-1   NF-kappaB1   Ik-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidVGLL4 promoter sequence
   Search SABiosciences Chromatin IP Primers for VGLL4

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat VGLL4


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 3p25.3   Ensembl cytogenetic band:  3p25.3   HGNC cytogenetic band: 3p25.2

VGLL4 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
VGLL4 gene location

GeneLoc information about chromosome 3         GeneLoc Exon Structure

GeneLoc location for GC03M011597:  view genomic region     (about GC identifiers)

Start:
11,597,544 bp from pter      End:
11,762,220 bp from pter
Size:
164,677 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: VGLL4_HUMAN, Q14135 (See protein sequence)
Recommended Name: Transcription cofactor vestigial-like protein 4  
Size: 290 amino acids; 30948 Da
Subunit: Interacts with TEFs (By similarity). Interacts with IRF2BP2
Subcellular location: Nucleus (By similarity)
Sequence caution: Sequence=AAH03038.1; Type=Erroneous translation; Note=Wrong choice of CDS; Sequence=BAA09470.3;
Type=Erroneous initiation; Note=Translation N-terminally shortened;
Secondary accessions: B4DTS7 Q7L5V0 Q9BQ78
Alternative splicing: 6 isoforms:  Q14135-1   Q14135-2   Q14135-3   Q14135-4   Q14135-5   Q14135-6   (Probable target of nonsense-mediated mRNA decay)

Explore the universe of human proteins at neXtProt for VGLL4: NX_Q14135

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q14135

  • VGLL4 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (4 alternative transcripts): 
    NP_001121691.1  NP_001121692.1  NP_001121693.1  NP_055482.2  

    ENSEMBL proteins: 
     ENSP00000273038   ENSP00000404624   ENSP00000416615   ENSP00000402878   ENSP00000404251  
     ENSP00000413030   ENSP00000412923   ENSP00000394439   ENSP00000394123   ENSP00000391932  
     ENSP00000411670   ENSP00000391554   ENSP00000395557   ENSP00000393100   ENSP00000384705  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins (see all 2): VGLL4
    OriGene Protein Over-expression Lysate (see all 3): VGLL4
    OriGene Custom Protein Services for VGLL4 
    GenScript Custom Purified and Recombinant Proteins Services for VGLL4
    Novus Biologicals VGLL4 Protein
    Novus Biologicals VGLL4 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for VGLL4

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--
    GO:0005730nucleolus ----


    VGLL4 for ontologies           About GeneDecksing



    VGLL4 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for VGLL4 
    GenScript Custom Superior Antibodies Services for VGLL4
    Novus Biologicals VGLL4 Antibodies
    Search for Antibodies for VGLL4 at Abcam  
    Uscn Antibodies for VGLL4
    Search ThermoFisher Antibodies for VGLL4

    Assay Products for VGLL4: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for VGLL4
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for VGLL4


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    VGLL4 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR006627 TDU_repeat

    Graphical View of Domain Structure for InterPro Entry Q14135

    ProtoNet protein and cluster: Q14135

    1 Blocks protein family: IPB006627 Protein of unknown function TDU

    UniProtKB/Swiss-Prot: VGLL4_HUMAN, Q14135
    Similarity: Belongs to the vestigial family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: VGLL4_HUMAN, Q14135
    Function: May act as a specific coactivator for the mammalian TEFs (By similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone (see all 4): VGLL4
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat VGLL4
    8/87 QIAGEN miScript miRNA Assays for microRNAs that regulate VGLL4 (see all 87):
    hsa-miR-376b hsa-miR-199a-3p hsa-miR-4325 hsa-miR-3622b-3p hsa-miR-3613-3p hsa-miR-155* hsa-miR-4293 hsa-miR-4326
    SwitchGear 3'UTR luciferase reporter plasmidVGLL4 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VGLL4 (see all 7)
    OriGene shRNA RFP: VGLL4
    OriGene siRNA: VGLL4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VGLL4

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for VGLL4

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4 (see all 6)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4 (see all 5)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 4): VGLL4 (NM_001128220)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for VGLL4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VGLL4 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for VGLL4
    Search LifeMap BioReagents cell lines for VGLL4

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VGLL4

    1 GenomeRNAi human phenotype for VGLL4:
     Increased homologous recombina 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for VGLL4

    STRING Interaction Network Preview (showing 5 interactants - click image to see 6)

    5/7 Interacting proteins for VGLL4 (Q141353 ENSP000004042514) via UniProtKB, MINT, STRING, and/or I2D (see all 7)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TEAD1P283473, ENSP000003545884I2D: score=1 STRING: ENSP00000354588
    MEF2AQ020783, ENSP000003463894I2D: score=1 STRING: ENSP00000346389
    MEF2CQ064133, ENSP000003962194I2D: score=1 STRING: ENSP00000396219
    TEAD3Q995943I2D: score=1 
    CDK6ENSP000002657344STRING: ENSP00000265734
    About this table

    Gene Ontology (GO): 2 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006351transcription, DNA-dependent IEA--
    GO:0006355regulation of transcription, DNA-dependent IEA--


    VGLL4 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for VGLL4
    Search CenterWatch for drugs/clinical trials and news about VGLL4 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for VGLL4 gene (4 alternative transcripts): 
    NM_001128219.1  NM_001128220.1  NM_001128221.1  NM_014667.2  

    Unigene Cluster for VGLL4:

    Vestigial like 4 (Drosophila)
    Hs.740389  [show with all ESTs]
    Unigene Representative Sequence: AK126479
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000273038(uc010hdv.1 uc010hdw.1 uc011aun.1 uc010hdx.1 uc003bwf.2 uc003bwg.2)
    ENST00000413604 ENST00000451674 ENST00000424529 ENST00000430365 ENST00000426568
    ENST00000445411 ENST00000418000 ENST00000458499 ENST00000417206 ENST00000417466
    ENST00000424709 ENST00000419541 ENST00000437722 ENST00000480288 ENST00000463387
    ENST00000404339

    miRNA
    Products:
         
    OriGene 3'-UTR Clone (see all 4): VGLL4
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat VGLL4
    8/87 QIAGEN miScript miRNA Assays for microRNAs that regulate VGLL4 (see all 87):
    hsa-miR-376b hsa-miR-199a-3p hsa-miR-4325 hsa-miR-3622b-3p hsa-miR-3613-3p hsa-miR-155* hsa-miR-4293 hsa-miR-4326
    SwitchGear 3'UTR luciferase reporter plasmidVGLL4 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VGLL4 (see all 7)
    OriGene shRNA RFP: VGLL4
    OriGene siRNA: VGLL4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VGLL4
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4 (see all 6)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4 (see all 5)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 4): VGLL4 (NM_001128220)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for VGLL4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VGLL4 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VGLL4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat VGLL4
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VGLL4
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VGLL4

    Additional cDNA sequence: 

    AK126479.1 AK130542.1 AK300344.1 AK307708.1 AK308761.1 BC000763.2 BC001514.2 BC003038.1 
    D50911.3 

    24 DOTS entries:

    DT.95155732  DT.40286625  DT.92448622  DT.95155731  DT.119954  DT.100823023  DT.92448576  DT.40116097 
    DT.120922148  DT.97805866  DT.100823026  DT.92448572  DT.100823033  DT.95155734  DT.100739897  DT.92448616 
    DT.100014647  DT.100038018  DT.100727123  DT.120922072  DT.91998774  DT.100701137  DT.92448573  DT.95155729 

    24/438 AceView cDNA sequences (see all 438):

    AI085497 CB114551 BF724423 BM710460 BM753535 AA757985 AA767200 AA258583 
    Z42417 CA865531 AI216553 BM694318 BQ648497 CA438107 AA447150 CA444019 
    AL133984 CA440339 BM511751 AW276579 AI498741 AA029492 BG251953 AI918218 

    GeneLoc Exon Structure

    5/14 Alternative Splicing Database (ASD) splice patterns (SP) for VGLL4 (see all 14)    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b · 3c ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16a · 16b · 16c ^ 17a · 17b ^ 18a · 18b · 18c ·
    SP1:              -     -     -                 -     -     -     -     -     -           -     -     -     -                 -     -     -                     
    SP2:              -     -     -           -     -     -     -     -     -     -           -     -     -     -                 -     -     -                     
    SP3:        -     -     -     -           -     -     -     -     -     -     -           -     -     -     -                 -     -     -                     
    SP4:                                      -     -     -     -     -     -     -           -     -     -     -                 -     -     -                     
    SP5:                                                              -     -     -           -     -     -     -                 -     -     -                     

    ExUns: 18d ^ 19a · 19b · 19c · 19d · 19e
    SP1:        -                           
    SP2:        -                           
    SP3:                                    
    SP4:                                    
    SP5:        -                           


    ECgene alternative splicing isoforms for VGLL4

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    VGLL4 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TGTGTAAATC

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See VGLL4 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for VGLL4

    SOURCE GeneReport for Unigene cluster: Hs.740389
        SABiosciences Expression via Pathway-Focused PCR Array including VGLL4: 
              Lymphoma in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VGLL4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat VGLL4
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VGLL4
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VGLL4
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VGLL4

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for VGLL4 gene from 5/13 species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Vgll41 , 5 vestigial like 4 (Drosophila)1, 5 87.34(n)1
    91.64(a)1
      6 (53.07 cM)5
    2323341  NM_177683.21  NP_808351.11 
     1148606285 
    chicken
    (Gallus gallus)
    Aves VGLL41 vestigial like 4 (Drosophila) 78.34(n)
    81.63(a)
      415962  NM_001030593.1  NP_001025764.1 
    lizard
    (Anolis carolinensis)
    Reptilia VGLL46
    --
    79(a)
    1 ↔ 1
    2(158097071-158146401)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.154092 Xenopus laevis transcribed sequence with moderate similarity more 76.67(n)    BX851197.1 
    zebrafish
    (Danio rerio)
    Actinopterygii AL923572.12   -- 82.18(n)    AL923572.1 


    ENSEMBL Gene Tree for VGLL4 (if available)
    TreeFam Gene Tree for VGLL4 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/3276 NCBI SNPs in VGLL4 are shown (see all 3276    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 3 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs762783861,2
    F,--11535823(+) GGTGTG/ACACAG 1 -- ds50011Minor allele frequency- A:0.11WA 118
    rs750678201,2
    F,--11536120(+) TGGCTG/ACACCC 1 -- ds50011Minor allele frequency- A:0.07EA 120
    rs98545731,2
    C,F,H,--11536124(+) TGCACC/TCATGA 1 -- ds50019Minor allele frequency- T:0.07NS EA NA WA 664
    rs634285621,2
    C,--11536155(+) CCCCCG/CAGGGT 1 -- ds50011Minor allele frequency- C:0.50NA 2
    rs756092081,2
    --11536437(+) TGGGGC/TGAATT 1 -- nc-transcript-variant1Minor allele frequency- T:0.01NA 120
    rs98552411,2
    C,H,--11536457(+) GGTCAC/TCTGCA 1 -- nc-transcript-variant6Minor allele frequency- T:0.03NS EA NA 532
    rs76218431,2
    C,F,A,H,--11536776(+) GCCAGT/GATGAG 1 -- nc-transcript-variant17Minor allele frequency- G:0.29NS EA NA WA CSA 1893
    rs786943981,2
    F,--11537840(+) ACCCCG/ATGGCC 1 -- nc-transcript-variant1Minor allele frequency- A:0.02WA 118
    rs797832731,2
    F,--11537992(+) ATTCCA/GGGCTG 1 -- nc-transcript-variant1Minor allele frequency- G:0.06WA 118
    rs667300651,2
    C--11538169(+) CATGTGGGCAGAGATAGCTT
    GTAAGGCTCACAGT
    /-
    TATGT
    1 -- nc-transcript-variant1Minor allele frequency- -:0.50NA 2

    HapMap Linkage Disequilibrium report for VGLL4 (11597544 - 11762220 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 10 variations for VGLL4
         6 CNVs: 63394 91191 68333 91192 79676 50907
         4 Indels: 98233 41360 46275 46278

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing VGLL4
    DNA2.0 Custom Variant and Variant Library Synthesis for VGLL4

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    VGLL4 for disorders           About GeneDecksing

    1 disease for VGLL4:    About MalaCards
    anorexia nervosa

    Human Genome Epidemiology (HuGE) Navigator: VGLL4 (2 documents)

    Export disorders for VGLL4 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for VGLL4 gene, integrated from 9 sources (see all 17):
    (articles sorted by number of sources associating them with VGLL4)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Prediction of the coding sequences of unidentified human genes. IV. The coding sequences of 40 new genes (KIAA0121-KIAA0160) deduced by analysis of cDNA clones from human cell line KG-1. (PubMed id 8590280)1, 2, 3 Nagase T....Nomura N. (1995)
    2. Vgl-4, a novel member of the vestigial-like family of transcription cofactors, regulates alpha1-adrenergic activation of gene expres sion in cardiac myocytes. (PubMed id 15140898)1, 3, 9 Chen H.H....Stewart A.F. (2004)
    3. IRF2BP2 is a skeletal and cardiac muscle-enriched isc hemia-inducible activator of VEGFA expression. (PubMed id 20702774)1, 2 Teng A.C....Stewart A.F. (2010)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    6. A novel inhibitor of apoptosis protein (IAP)-interact ing protein, Vestigial-like (Vgl)-4, counteracts apoptosis-inhibitory function of IAPs by nuclear sequestration. (PubMed id 21839727)1 Jin H.S....Lee T.H. (2011)
    7. Genome-wide YFP fluorescence complementation screen id entifies new regulators for telomere signaling in human cells. (PubMed id 21044950)1 Lee O.H....Songyang Z. (2011)
    8. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1 Rose J.E....Uhl G.R. (2010)
    9. A genome-wide association study on common SNPs and ra re CNVs in anorexia nervosa. (PubMed id 21079607)1 Wang K....Hakonarson H. (2010)
    10. Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis. (PubMed id 20068231)2 Olsen J.V....Mann M. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 9686 HGNC: 28966 AceView: VGLL4 Ensembl:ENSG00000144560 euGenes: HUgn9686
    ECgene: VGLL4 H-InvDB: VGLL4

    (According to HUGE)
    About This Section
    HUGE: KIAA0121

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for VGLL4 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for VGLL4 gene:
    Search GeneIP for patents involving VGLL4

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for VGLL4  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for VGLL4   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for VGLL4  
     OriGene Protein Over-expression Lysate for VGLL4   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for VGLL4   OriGene 3'-UTR Clone for VGLL4  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for VGLL4  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for VGLL4   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for VGLL4   OriGene Custom Protein Services for VGLL4  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat VGLL4
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing VGLL4
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat VGLL4
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat VGLL4
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat VGLL4
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat VGLL4
     GenScript Custom Purified and Recombinant Proteins Services for VGLL4 GenScript cDNA clones with any tag delivered in your preferred vector for VGLL4
     GenScript Custom Assay Services for VGLL4 GenScript Custom Superior Antibodies Services for VGLL4
     GenScript Custom overexpressing Cell Line Services for VGLL4 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in VGLL4 promoter
     Search Chromatin IP Primers for VGLL4
     RT2 qPCR Primer Assay in human, mouse, rat VGLL4
     GNC Network for VGLL4
     SABiosciences PCR Arrays including human, mouse, rat VGLL4
     Search Tocris compounds for VGLL4
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     VGLL4 antibodies
     VGLL4 proteins
     VGLL4 lysates
     Search for Antibodies for VGLL4 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for VGLL4
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     VGLL4 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for VGLL4
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for VGLL4
     SwitchGear 3'UTR luciferase reporter plasmids for VGLL4
     SwitchGear Promoter luciferase reporter plasmids for VGLL4
     Search ThermoFisher Antibodies for VGLL4
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat VGLL4
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      VGLL4 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4