Free for academic non-profit institutions. Other users need a Commercial license

Aliases for VGLL1 Gene

Aliases for VGLL1 Gene

  • Vestigial Like Family Member 1 2 3 5
  • Vgl-1 3 4
  • TDU 3 4
  • Transcription Cofactor Vestigial-Like Protein 1 3
  • Vestigial-Like Family Member 1 2
  • Vestigial Like 1 (Drosophila) 2
  • WUGSC:H_GS188P18.1b 3
  • Vestigial Like 1 3
  • Protein TONDU 4
  • TONDU 3
  • VGL1 3

External Ids for VGLL1 Gene

Previous GeneCards Identifiers for VGLL1 Gene

  • GC0XP133559
  • GC0XP134319
  • GC0XP135339
  • GC0XP135441
  • GC0XP135614
  • GC0XP124884

Summaries for VGLL1 Gene

Entrez Gene Summary for VGLL1 Gene

  • The protein encoded by this gene binds proteins of the TEA domain family of transcription factors (TEFs) through the Vg (vestigial) homology region found in its N-terminus. It may thus function as a specific coactivator for the mammalian TEFs. [provided by RefSeq, Sep 2009]

GeneCards Summary for VGLL1 Gene

VGLL1 (Vestigial Like Family Member 1) is a Protein Coding gene. GO annotations related to this gene include transcription coactivator activity.

UniProtKB/Swiss-Prot for VGLL1 Gene

  • May act as a specific coactivator for the mammalian TEFs.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for VGLL1 Gene

Genomics for VGLL1 Gene

Regulatory Elements for VGLL1 Gene

Enhancers for VGLL1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around VGLL1 on UCSC Golden Path with GeneCards custom track

Genomic Location for VGLL1 Gene

136,532,152 bp from pter
136,556,807 bp from pter
24,656 bases
Plus strand

Genomic View for VGLL1 Gene

Genes around VGLL1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
VGLL1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for VGLL1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for VGLL1 Gene

Proteins for VGLL1 Gene

  • Protein details for VGLL1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transcription cofactor vestigial-like protein 1
    Protein Accession:
    Secondary Accessions:
    • Q5H915

    Protein attributes for VGLL1 Gene

    258 amino acids
    Molecular mass:
    28707 Da
    Quaternary structure:
    • Interacts with TEFs.

neXtProt entry for VGLL1 Gene

Post-translational modifications for VGLL1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for VGLL1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for VGLL1 Gene

Domains & Families for VGLL1 Gene

Gene Families for VGLL1 Gene

Protein Domains for VGLL1 Gene


Graphical View of Domain Structure for InterPro Entry



  • Belongs to the vestigial family.
  • Belongs to the vestigial family.
genes like me logo Genes that share domains with VGLL1: view

Function for VGLL1 Gene

Molecular function for VGLL1 Gene

UniProtKB/Swiss-Prot Function:
May act as a specific coactivator for the mammalian TEFs.

Gene Ontology (GO) - Molecular Function for VGLL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003713 transcription coactivator activity TAS 10518497
GO:0008022 protein C-terminus binding IEA --
genes like me logo Genes that share ontologies with VGLL1: view
genes like me logo Genes that share phenotypes with VGLL1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for VGLL1 Gene

Localization for VGLL1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for VGLL1 Gene

Subcellular locations from

Jensen Localization Image for VGLL1 Gene COMPARTMENTS Subcellular localization image for VGLL1 gene
Compartment Confidence
nucleus 5
cytosol 2
extracellular 1

Gene Ontology (GO) - Cellular Components for VGLL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS 10518497
genes like me logo Genes that share ontologies with VGLL1: view

Pathways & Interactions for VGLL1 Gene

SuperPathways for VGLL1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for VGLL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated NAS 10518497
genes like me logo Genes that share ontologies with VGLL1: view

No data available for Pathways by source and SIGNOR curated interactions for VGLL1 Gene

Drugs & Compounds for VGLL1 Gene

No Compound Related Data Available

Transcripts for VGLL1 Gene

mRNA/cDNA for VGLL1 Gene

Unigene Clusters for VGLL1 Gene

Vestigial like 1 (Drosophila):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for VGLL1 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b · 5c
SP1: -
SP2: - -

Relevant External Links for VGLL1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for VGLL1 Gene

mRNA expression in normal human tissues for VGLL1 Gene

mRNA differential expression in normal tissues according to GTEx for VGLL1 Gene

This gene is overexpressed in Bladder (x26.4), Minor Salivary Gland (x6.1), and Breast - Mammary Tissue (x4.5).

Protein differential expression in normal tissues from HIPED for VGLL1 Gene

This gene is overexpressed in Placenta (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for VGLL1 Gene

Protein tissue co-expression partners for VGLL1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of VGLL1 Gene:


SOURCE GeneReport for Unigene cluster for VGLL1 Gene:

genes like me logo Genes that share expression patterns with VGLL1: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for VGLL1 Gene

Orthologs for VGLL1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for VGLL1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia VGLL1 34
  • 81.27 (n)
  • 67.62 (a)
VGLL1 35
  • 62 (a)
(Canis familiaris)
Mammalia VGLL1 34
  • 79.78 (n)
  • 63.03 (a)
VGLL1 35
  • 59 (a)
(Mus musculus)
Mammalia Vgll1 34
  • 71.93 (n)
  • 53.51 (a)
Vgll1 16
Vgll1 35
  • 39 (a)
(Pan troglodytes)
Mammalia VGLL1 34
  • 98.69 (n)
  • 98.25 (a)
VGLL1 35
  • 98 (a)
(Rattus norvegicus)
Mammalia Vgll1 34
  • 72.08 (n)
  • 55.26 (a)
(Monodelphis domestica)
Mammalia VGLL1 35
  • 40 (a)
(Ornithorhynchus anatinus)
Mammalia VGLL1 35
  • 46 (a)
(Gallus gallus)
Aves VGLL1 34
  • 57.56 (n)
  • 45.88 (a)
VGLL1 35
  • 45 (a)
(Anolis carolinensis)
Reptilia VGLL1 35
  • 56 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia vgll1 34
  • 51.4 (n)
  • 36.87 (a)
Species where no ortholog for VGLL1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for VGLL1 Gene

Gene Tree for VGLL1 (if available)
Gene Tree for VGLL1 (if available)

Paralogs for VGLL1 Gene

(1) SIMAP similar genes for VGLL1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with VGLL1: view

No data available for Paralogs for VGLL1 Gene

Variants for VGLL1 Gene

Sequence variations from dbSNP and Humsavar for VGLL1 Gene

SNP ID Clin Chr 0X pos Sequence Context AA Info Type
rs3027860 - 136,536,196(+) ATTGA(A/C/T)CCCCT reference, missense
rs747670002 -- 136,552,881(+) CACTG(C/T)CTATC intron-variant
rs747781799 -- 136,537,703(+) ACAGG(GTATGCGCCACCACACCCAGCTAATTTAA/T)TTTTT intron-variant
rs747969894 -- 136,530,937(+) TGGTC(C/T)TGGGG upstream-variant-2KB
rs748027486 -- 136,538,669(+) GCAAA(G/T)AGCTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for VGLL1 Gene

Variant ID Type Subtype PubMed ID
dgv2478e212 CNV loss 25503493

Variation tolerance for VGLL1 Gene

Residual Variation Intolerance Score: 75.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.77; 33.41% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for VGLL1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for VGLL1 Gene

Disorders for VGLL1 Gene

Relevant External Links for VGLL1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for VGLL1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for VGLL1 Gene

Publications for VGLL1 Gene

  1. TONDU (TDU), a novel human protein related to the product of vestigial (vg) gene of Drosophila melanogaster interacts with vertebrate TEF factors and substitutes for Vg function in wing formation. (PMID: 10518497) Vaudin P. … Zider A. (Development 1999) 2 3 4 22 65
  2. The DNA sequence of the human X chromosome. (PMID: 15772651) Ross M.T. … Bentley D.R. (Nature 2005) 3 4 65
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 65
  4. VGLL1 expression is associated with a triple-negative basal-like phenotype in breast cancer. (PMID: 24891455) Castilla M.A.8. … Palacios J. (Endocr. Relat. Cancer 2014) 3 65
  5. The transcriptional co-activator TAZ interacts differentially with transcriptional enhancer factor-1 (TEF-1) family members. (PMID: 15628970) Mahoney W.M. … Farrance I.K. (Biochem. J. 2005) 22 65

Products for VGLL1 Gene

Sources for VGLL1 Gene

Loading form....