Free for academic non-profit institutions. Other users need a Commercial license

Aliases for UTP14C Gene

Aliases for UTP14C Gene

  • UTP14, Small Subunit Processome Component Homolog C (S. Cerevisiae) 2 3 5
  • KIAA0266 2 3 4
  • UTP14, U3 Small Nucleolar Ribonucleoprotein, Homolog C (Yeast) 2
  • U3 Small Nucleolar RNA-Associated Protein 14 Homolog C 3
  • UTP14, U3 Small Nucleolar Ribonucleoprotein, Homolog C 3
  • 2700066J21Rik 3
  • UTP14B 3

External Ids for UTP14C Gene

Previous HGNC Symbols for UTP14C Gene

  • KIAA0266

Previous GeneCards Identifiers for UTP14C Gene

  • GC13P050385
  • GC13P051402
  • GC13P051496
  • GC13P052586
  • GC13P033387
  • GC13P052599

Summaries for UTP14C Gene

GeneCards Summary for UTP14C Gene

UTP14C (UTP14, Small Subunit Processome Component Homolog C (S. Cerevisiae)) is a Protein Coding gene. Among its related pathways are rRNA processing in the nucleus and cytosol and Gene Expression. An important paralog of this gene is UTP14A.

UniProtKB/Swiss-Prot for UTP14C Gene

  • Essential for spermatogenesis. May be required specifically for ribosome biogenesis and hence protein synthesis during male meiosis (By similarity).

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for UTP14C Gene

Genomics for UTP14C Gene

Regulatory Elements for UTP14C Gene

Enhancers for UTP14C Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH13G052193 1.7 FANTOM5 ENCODE dbSUPER 14.8 +169.9 169908 2.6 MLX ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC TBX21 CKAP2 TPTE2P2 UTP14C ATP7B MRPS31P5 PIR51896
GH13G051618 1.7 Ensembl ENCODE dbSUPER 14.7 -404.7 -404706 2.7 MLX ZFP64 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 SP3 NFYC TBX21 UTP14C MRPS31P5 ATP5F1P1 PIR45932
GH13G051995 1.3 Ensembl ENCODE 12.1 -26.9 -26945 5.0 FOXA2 MLX ARID4B FEZF1 DMAP1 ZNF48 YY1 TCF12 GLIS2 ZNF263 ATP7B NEK3 NEK5 TPTE2P2 UTP14C CCDC70 DHRS12 ENSG00000231856 FABP5P2
GH13G051969 1.1 FANTOM5 ENCODE 12.6 -53.5 -53546 2.8 SOX13 TFAP4 FOXA2 SAP130 ARID4B RAD21 ZNF644 TEAD3 TRIM24 CREM NEK3 UTP14C ALG11 NEK5 CKAP2 FABP5P2 ATP7B
GH13G051977 0.9 ENCODE 11.5 -45.7 -45650 2.6 HDAC1 TBP FOXA2 CBX3 ATF1 ARID4B RAD21 RARA YY1 ZNF143 NEK3 ALG11 UTP14C ATP7B NEK5 FABP5P2
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around UTP14C on UCSC Golden Path with GeneCards custom track

Genomic Location for UTP14C Gene

Chromosome:
13
Start:
52,024,691 bp from pter
End:
52,033,600 bp from pter
Size:
8,910 bases
Orientation:
Plus strand

Genomic View for UTP14C Gene

Genes around UTP14C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
UTP14C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for UTP14C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for UTP14C Gene

Proteins for UTP14C Gene

  • Protein details for UTP14C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q5TAP6-UT14C_HUMAN
    Recommended name:
    U3 small nucleolar RNA-associated protein 14 homolog C
    Protein Accession:
    Q5TAP6
    Secondary Accessions:
    • Q5FWG3
    • Q92555

    Protein attributes for UTP14C Gene

    Size:
    766 amino acids
    Molecular mass:
    87188 Da
    Quaternary structure:
    No Data Available
    Miscellaneous:
    • Encoded by an autosomal retrotransposed copy of the X-linked gene UTP14A. Evolution of autosomal retrogenes from X-linked progenitors compensates for X-chromosome silencing during male meiosis.
    SequenceCaution:
    • Sequence=BAA13396.2; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for UTP14C Gene

Post-translational modifications for UTP14C Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for UTP14C Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for UTP14C Gene

Domains & Families for UTP14C Gene

Protein Domains for UTP14C Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for UTP14C Gene

Graphical View of Domain Structure for InterPro Entry

Q5TAP6

UniProtKB/Swiss-Prot:

UT14C_HUMAN :
  • Belongs to the UTP14 family.
Family:
  • Belongs to the UTP14 family.
genes like me logo Genes that share domains with UTP14C: view

No data available for Gene Families for UTP14C Gene

Function for UTP14C Gene

Molecular function for UTP14C Gene

UniProtKB/Swiss-Prot Function:
Essential for spermatogenesis. May be required specifically for ribosome biogenesis and hence protein synthesis during male meiosis (By similarity).
genes like me logo Genes that share phenotypes with UTP14C: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for UTP14C Gene

Localization for UTP14C Gene

Subcellular locations from UniProtKB/Swiss-Prot for UTP14C Gene

Nucleus, nucleolus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for UTP14C gene
Compartment Confidence
nucleus 4
cytosol 4

Gene Ontology (GO) - Cellular Components for UTP14C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005730 nucleolus IDA,IEA --
GO:0005829 cytosol IDA --
GO:0032040 small-subunit processome IBA --
genes like me logo Genes that share ontologies with UTP14C: view

Pathways & Interactions for UTP14C Gene

genes like me logo Genes that share pathways with UTP14C: view

Gene Ontology (GO) - Biological Process for UTP14C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006364 rRNA processing IEA --
GO:0007275 multicellular organism development IEA --
GO:0007283 spermatogenesis IEA --
GO:0030154 cell differentiation IEA --
GO:0030490 maturation of SSU-rRNA IBA --
genes like me logo Genes that share ontologies with UTP14C: view

No data available for SIGNOR curated interactions for UTP14C Gene

Drugs & Compounds for UTP14C Gene

No Compound Related Data Available

Transcripts for UTP14C Gene

mRNA/cDNA for UTP14C Gene

(1) REFSEQ mRNAs :
(187) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for UTP14C Gene

No ASD Table

Relevant External Links for UTP14C Gene

GeneLoc Exon Structure for
UTP14C
ECgene alternative splicing isoforms for
UTP14C

Expression for UTP14C Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for UTP14C Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for UTP14C Gene

This gene is overexpressed in Plasma (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for UTP14C Gene



Protein tissue co-expression partners for UTP14C Gene

NURSA nuclear receptor signaling pathways regulating expression of UTP14C Gene:

UTP14C

mRNA Expression by UniProt/SwissProt for UTP14C Gene:

Q5TAP6-UT14C_HUMAN
Tissue specificity: Expressed in testis.

Evidence on tissue expression from TISSUES for UTP14C Gene

  • Bone marrow(4.1)
  • Nervous system(2)
genes like me logo Genes that share expression patterns with UTP14C: view

Primer Products

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for UTP14C Gene

Orthologs for UTP14C Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for UTP14C Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia UTP14C 34
  • 99.3 (n)
dog
(Canis familiaris)
Mammalia UTP14A 35
  • 79 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia LOC102551819 34
  • 77.66 (n)
mouse
(Mus musculus)
Mammalia Utp14b 34 16 35
  • 77.01 (n)
Utp14a 35
  • 75 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia UTP14A 35 35
  • 76 (a)
ManyToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 57 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 52 (a)
OneToMany
chicken
(Gallus gallus)
Aves UTP14A 34
  • 57.62 (n)
-- 35
  • 49 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 45 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia utp14a 34
  • 61.01 (n)
zebrafish
(Danio rerio)
Actinopterygii si:dkey-251i10.3 34
  • 56.89 (n)
UTP14A 35
  • 44 (a)
OneToMany
Dr.16592 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2505 34
fruit fly
(Drosophila melanogaster)
Insecta CG12301 35
  • 25 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea F27C1.6 35
  • 26 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes UTP14 35
  • 21 (a)
OneToMany
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.7000 34
Species where no ortholog for UTP14C was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for UTP14C Gene

ENSEMBL:
Gene Tree for UTP14C (if available)
TreeFam:
Gene Tree for UTP14C (if available)

Paralogs for UTP14C Gene

Paralogs for UTP14C Gene

(1) SIMAP similar genes for UTP14C Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with UTP14C: view

Variants for UTP14C Gene

Sequence variations from dbSNP and Humsavar for UTP14C Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type
rs387907180 Pathogenic 52,024,353(+) GCTCT(-/CTGTAGTGAAGAATCAAAAT)ATTGG intron-variant, upstream-variant-2KB, reference, frameshift-variant
rs387907181 Pathogenic 52,024,566(+) TGTTT(A/C)TCCAC intron-variant, upstream-variant-2KB, reference, missense
rs387907182 Pathogenic 52,024,872(+) TGAAT(C/T)AAAGA intron-variant, reference, missense, utr-variant-5-prime
rs387907183 Pathogenic 52,024,922(+) GGAAC(A/G)AGCAT intron-variant, reference, missense, utr-variant-5-prime
rs387907184 Pathogenic 52,024,683(+) ATTGC(A/C)GATCA intron-variant, upstream-variant-2KB, reference, missense

Structural Variations from Database of Genomic Variants (DGV) for UTP14C Gene

Variant ID Type Subtype PubMed ID
dgv1652n100 CNV loss 25217958
esv3383575 CNV duplication 20981092
esv3892343 CNV gain 25118596

Variation tolerance for UTP14C Gene

Residual Variation Intolerance Score: 84.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.55; 64.94% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for UTP14C Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
UTP14C

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for UTP14C Gene

Disorders for UTP14C Gene

Relevant External Links for UTP14C

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
UTP14C

No disorders were found for UTP14C Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for UTP14C Gene

Publications for UTP14C Gene

  1. UTP14c is a recently acquired retrogene associated with spermatogenesis and fertility in man. (PMID: 16354793) Rohozinski J. … Bishop C.E. (Biol. Reprod. 2006) 2 3 22 64
  2. Prediction of the coding sequences of unidentified human genes. VI. The coding sequences of 80 new genes (KIAA0201-KIAA0280) deduced by analysis of cDNA clones from cell line KG-1 and brain. (PMID: 9039502) Nagase T. … Nomura N. (DNA Res. 1996) 2 3 4 64
  3. The DNA sequence and analysis of human chromosome 13. (PMID: 15057823) Dunham A. … Ross M.T. (Nature 2004) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. The mouse juvenile spermatogonial depletion (jsd) phenotype is due to a mutation in the X-derived retrogene, mUtp14b. (PMID: 15289605) Rohozinski J. … Bishop C.E. (Proc. Natl. Acad. Sci. U.S.A. 2004) 3 4 64

Products for UTP14C Gene

Sources for UTP14C Gene

Content
Loading form....