Free for academic non-profit institutions. Other users need a Commercial license

Aliases for USH1G Gene

Aliases for USH1G Gene

  • USH1 Protein Network Component Sans 2 3 5
  • Scaffold Protein Containing Ankyrin Repeats And SAM Domain 3 4
  • Usher Syndrome 1G (Autosomal Recessive) 2 3
  • SANS 3 4
  • Usher Syndrome Type-1G Protein 3
  • ANKS4A 3

External Ids for USH1G Gene

Previous GeneCards Identifiers for USH1G Gene

  • GC17U990308
  • GC17M075971
  • GC17M073376
  • GC17M073509
  • GC17M070423
  • GC17M072912
  • GC17M068322

Summaries for USH1G Gene

Entrez Gene Summary for USH1G Gene

  • This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

GeneCards Summary for USH1G Gene

USH1G (USH1 Protein Network Component Sans) is a Protein Coding gene. Diseases associated with USH1G include Usher Syndrome, Type 1G and Usher Syndrome, Type 1B. GO annotations related to this gene include protein homodimerization activity and spectrin binding. An important paralog of this gene is ANKS4B.

UniProtKB/Swiss-Prot for USH1G Gene

  • Required for normal development and maintenance of cochlear hair cell bundles. Anchoring/scaffolding protein that is a part of the functional network formed by USH1C, USH1G, CDH23 and MYO7A that mediates mechanotransduction in cochlear hair cells. Required for normal hearing.

Gene Wiki entry for USH1G Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for USH1G Gene

Genomics for USH1G Gene

Regulatory Elements for USH1G Gene

Enhancers for USH1G Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17F075351 0.8 VISTA ENCODE 5.8 -429.0 -429024 1.3 CTCF PKNOX1 ZFHX2 ZBTB48 ZNF366 PATZ1 PRDM10 NFE2 ZNF600 MAZ MIR6785 TMEM94 LLGL2 MIF4GD USH1G ENSG00000265987 ENSG00000264853
GH17F075369 1.1 Ensembl ENCODE 5.7 -448.0 -448018 3.0 CTCF PKNOX1 BMI1 RAD21 POLR2A SCRT2 NFE2 ZNF600 SCRT1 RFX1 GRB2 MIR6785 TMEM94 LLGL2 MIF4GD ENSG00000267342 MYO15B USH1G NUP85 ENSG00000264853
GH17F075401 0.2 ENCODE 4.9 -481.2 -481184 5.1 HDGF PKNOX1 ARNT CREB3L1 ARID4B SIN3A DMAP1 ZNF2 SLC30A9 ZNF143 MIF4GD NUP85 LLGL2 USH1G LOC100287042 GRB2 ENSG00000265342
GH17F075307 1.1 FANTOM5 Ensembl ENCODE 4.9 -390.8 -390823 14.2 FEZF1 DMAP1 YY1 SLC30A9 ZNF416 ZNF263 SP3 NFYC TBX21 SSRP1 UNK GRB2 ENSG00000264829 NAT9 CDK3 ENSG00000267342 MRPS7 NUP85 MIF4GD TEN1
GH17F074923 0.2 ENCODE 0.8 -0.4 -418 0.2 ELF3 CBX3 KLF17 ARID4B ZNF48 ZSCAN9 ZNF2 RAD21 ZNF391 CREM USH1G OTOP3
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around USH1G on UCSC Golden Path with GeneCards custom track

Genomic Location for USH1G Gene

74,916,083 bp from pter
74,923,263 bp from pter
7,181 bases
Minus strand

Genomic View for USH1G Gene

Genes around USH1G on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
USH1G Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for USH1G Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for USH1G Gene

Proteins for USH1G Gene

  • Protein details for USH1G Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Usher syndrome type-1G protein
    Protein Accession:
    Secondary Accessions:
    • Q8N251

    Protein attributes for USH1G Gene

    461 amino acids
    Molecular mass:
    51489 Da
    Quaternary structure:
    • Interacts with CDH23 and PCDH15; these interactions may recruit USH1G to the plasma membrane (By similarity). Interacts with USH1C (via the first PDZ domain) and with USH1G. Interacts with PDZD7. Interacts with MYO7A. Part of a complex composed of USH1C, USH1G and MYO7A.

    Three dimensional structures from OCA and Proteopedia for USH1G Gene

neXtProt entry for USH1G Gene

Post-translational modifications for USH1G Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for USH1G Gene

No data available for DME Specific Peptides for USH1G Gene

Domains & Families for USH1G Gene

Protein Domains for USH1G Gene

Suggested Antigen Peptide Sequences for USH1G Gene

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 SAM (sterile alpha motif) domain.
  • Contains 3 ANK repeats.
  • Contains 1 SAM (sterile alpha motif) domain.
  • Contains 3 ANK repeats.
genes like me logo Genes that share domains with USH1G: view

Function for USH1G Gene

Molecular function for USH1G Gene

UniProtKB/Swiss-Prot Function:
Required for normal development and maintenance of cochlear hair cell bundles. Anchoring/scaffolding protein that is a part of the functional network formed by USH1C, USH1G, CDH23 and MYO7A that mediates mechanotransduction in cochlear hair cells. Required for normal hearing.

Gene Ontology (GO) - Molecular Function for USH1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 19028668
GO:0030507 spectrin binding IDA 23704327
GO:0042803 protein homodimerization activity IEA --
genes like me logo Genes that share ontologies with USH1G: view
genes like me logo Genes that share phenotypes with USH1G: view

Human Phenotype Ontology for USH1G Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for USH1G Gene

MGI Knock Outs for USH1G:

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for USH1G Gene

Localization for USH1G Gene

Subcellular locations from UniProtKB/Swiss-Prot for USH1G Gene

Cytoplasm, cytosol. Cytoplasm, cytoskeleton. Cell membrane; Peripheral membrane protein. Note=Detected at the tip of cochlear hair cell stereocilia. Recruited to the cell membrane via interaction with CDH23 or PCDH15 (By similarity). {ECO:0000250}.

Subcellular locations from

Jensen Localization Image for USH1G Gene COMPARTMENTS Subcellular localization image for USH1G gene
Compartment Confidence
cytoskeleton 4
cytosol 4
nucleus 3
plasma membrane 3

Gene Ontology (GO) - Cellular Components for USH1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001917 photoreceptor inner segment IEA --
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol IEA --
GO:0005856 cytoskeleton IEA --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with USH1G: view

Pathways & Interactions for USH1G Gene

SuperPathways for USH1G Gene

No Data Available

Interacting Proteins for USH1G Gene

Gene Ontology (GO) - Biological Process for USH1G Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007605 sensory perception of sound IEA,IMP 11398101
GO:0042472 inner ear morphogenesis IEA --
GO:0045494 photoreceptor cell maintenance IMP 11398101
GO:0050953 sensory perception of light stimulus IMP 11398101
GO:0050957 equilibrioception IMP 12588794
genes like me logo Genes that share ontologies with USH1G: view

No data available for Pathways by source and SIGNOR curated interactions for USH1G Gene

Transcripts for USH1G Gene

mRNA/cDNA for USH1G Gene

(3) REFSEQ mRNAs :
(7) Additional mRNA sequences :
(6) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for USH1G Gene

Usher syndrome 1G (autosomal recessive):
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for USH1G Gene

No ASD Table

Relevant External Links for USH1G Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for USH1G Gene

mRNA expression in normal human tissues for USH1G Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for USH1G Gene

This gene is overexpressed in Esophagus - Mucosa (x20.9), Skin - Sun Exposed (Lower leg) (x6.8), Testis (x4.8), and Skin - Not Sun Exposed (Suprapubic) (x4.3).

Protein differential expression in normal tissues from HIPED for USH1G Gene

This gene is overexpressed in Bone (66.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for USH1G Gene

Protein tissue co-expression partners for USH1G Gene

NURSA nuclear receptor signaling pathways regulating expression of USH1G Gene:


SOURCE GeneReport for Unigene cluster for USH1G Gene:


mRNA Expression by UniProt/SwissProt for USH1G Gene:

Tissue specificity: Expressed in vestibule of the inner ear, eye and small intestine.
genes like me logo Genes that share expression patterns with USH1G: view

Primer Products

Orthologs for USH1G Gene

This gene was present in the common ancestor of animals.

Orthologs for USH1G Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia USH1G 34 35
  • 99.28 (n)
(Canis familiaris)
Mammalia USH1G 34 35
  • 92.41 (n)
(Bos Taurus)
Mammalia USH1G 34 35
  • 91.47 (n)
(Mus musculus)
Mammalia Ush1g 34 16 35
  • 90.82 (n)
(Rattus norvegicus)
Mammalia Ush1g 34
  • 90.46 (n)
(Monodelphis domestica)
Mammalia USH1G 35
  • 88 (a)
(Gallus gallus)
Aves USH1G 34 35
  • 76.2 (n)
(Anolis carolinensis)
Reptilia USH1G 35
  • 75 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ush1g 34
  • 73.32 (n)
(Danio rerio)
Actinopterygii LOC100330314 34
  • 69.51 (n)
USH1G (1 of 2) 35
  • 68 (a)
ush1g 35
  • 60 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007027 34
  • 48.4 (n)
fruit fly
(Drosophila melanogaster)
Insecta Sans 34 35
  • 46.97 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 37 (a)
Species where no ortholog for USH1G was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for USH1G Gene

Gene Tree for USH1G (if available)
Gene Tree for USH1G (if available)

Paralogs for USH1G Gene

Paralogs for USH1G Gene

(4) SIMAP similar genes for USH1G Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with USH1G: view

Variants for USH1G Gene

Sequence variations from dbSNP and Humsavar for USH1G Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs104894651 Usher syndrome 1G (USH1G) [MIM:606943], Pathogenic 74,922,931(-) GTCGC(C/T)GCGTC upstream-variant-2KB, reference, missense, utr-variant-5-prime
rs397517925 Usher syndrome 1G (USH1G) [MIM:606943], Likely pathogenic 74,919,463(-) GGAGG(A/T)CACAG reference, missense
rs104894652 Pathogenic 74,922,961(-) TCTCT(A/G)GGCTG upstream-variant-2KB, reference, stop-gained, utr-variant-5-prime
rs397515345 Pathogenic 74,919,985(-) TCCTC(-/TCGGACGAGGACAGCGTCTC)CCGTG reference, frameshift-variant
rs730880268 Pathogenic 74,920,649(-) TGTGA(-/CA)TCTGG intron-variant, reference, frameshift-variant, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for USH1G Gene

Variant ID Type Subtype PubMed ID
nsv1056788 CNV gain 25217958
nsv457909 CNV gain 19166990
nsv518292 CNV loss 19592680
nsv576026 CNV gain 21841781
nsv833540 CNV loss 17160897
nsv952367 CNV deletion 24416366

Variation tolerance for USH1G Gene

Residual Variation Intolerance Score: 57.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.52; 64.65% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for USH1G Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for USH1G Gene

Disorders for USH1G Gene

MalaCards: The human disease database

(6) MalaCards diseases for USH1G Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
usher syndrome, type 1g
  • usher syndrome type 1g
usher syndrome, type 1b
  • usher syndrome type i
usher syndrome
  • deafness-retinitis pigmentosa syndrome
usher syndrome, type 1c
  • ush1c
usher syndrome, type 1f
  • ush1f
- elite association - COSMIC cancer census association via MalaCards
Search USH1G in MalaCards View complete list of genes associated with diseases


  • Note=The first cases with non-syndromic sensorineural hearing loss based on mutations in USH1G. The hearing loss has an onset during early childhood, is progressive, and has a downsloping audiogram configuration. Ophthalmic and vestibular abnormalities are absent. {ECO:0000269 PubMed:25255398}.
  • Usher syndrome 1G (USH1G) [MIM:606943]: USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa with sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). USH1 is characterized by profound congenital sensorineural deafness, absent vestibular function and prepubertal onset of progressive retinitis pigmentosa leading to blindness. {ECO:0000269 PubMed:12588794, ECO:0000269 PubMed:16283141}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for USH1G

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with USH1G: view

No data available for Genatlas for USH1G Gene

Publications for USH1G Gene

  1. The structure of the harmonin/sans complex reveals an unexpected interaction mode of the two Usher syndrome proteins. (PMID: 20142502) Yan J. … Zhang M. (Proc. Natl. Acad. Sci. U.S.A. 2010) 3 4 22 64
  2. Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome. (PMID: 17896313) Aller E. … MillA!n J. (Ophthalmic Genet. 2007) 3 22 46 64
  3. A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome. (PMID: 16283141) Kalay E. … Kremer H. (J. Mol. Med. 2005) 3 4 22 64
  4. Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. (PMID: 12588794) Weil D. … Petit C. (Hum. Mol. Genet. 2003) 2 3 4 64
  5. Nonsyndromic hearing loss caused by USH1G mutations: widening the USH1G disease spectrum. (PMID: 25255398) Oonk A.M. … Pennings R.J. (Ear Hear. 2014) 3 4 64

Products for USH1G Gene

Sources for USH1G Gene

Loading form....