Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TYRO3P Gene

Aliases for TYRO3P Gene

  • TYRO3P Protein Tyrosine Kinase Pseudogene 2 3 5

External Ids for TYRO3P Gene

Previous GeneCards Identifiers for TYRO3P Gene

  • GC15U990049
  • GC15M074339
  • GC15M076549

Summaries for TYRO3P Gene

GeneCards Summary for TYRO3P Gene

TYRO3P (TYRO3P Protein Tyrosine Kinase Pseudogene) is a Pseudogene.

Additional gene information for TYRO3P Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TYRO3P Gene

Genomics for TYRO3P Gene

Regulatory Elements for TYRO3P Gene

Enhancers for TYRO3P Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH15H076309 1.4 Ensembl ENCODE 19.5 -51.0 -50970 5.9 PKNOX1 FOXA2 MLX ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZBTB7B YY1 SIN3A ENSG00000260274 MAN2C1 TYRO3P FBXO22 SCAPER ENSG00000261232 DNM1P49 LOC646853 LOC105370902
GH15H075624 1.4 Ensembl ENCODE 10.2 +635.5 635461 3.8 HDGF PKNOX1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 SIN3A MAN2C1 EDC3 ENSG00000260274 SNUPN DNM1P35 FBXO22 COMMD4 PTPN9 TYRO3P
GH15H075901 1.2 ENCODE 10.2 +358.6 358638 3.6 HDGF PKNOX1 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 ZNF207 SIN3A FBXO22 ENSG00000260274 MAN2C1 DNM1P35 NRG4 DNM1P49 LOC105370902 ENSG00000261232 GOLGA6D
GH15H075706 1 Ensembl dbSUPER 10.6 +555.5 555490 0.4 HDGF SUZ12 ZSCAN4 BMI1 BCL11B ZBTB7B ZKSCAN1 TCF12 MTA3 PATZ1 SIN3A SNX33 ENSG00000203392 ENSG00000260274 MAN2C1 FBXO22 TYRO3P DNM1P34 CSPG4
GH15H075274 0.7 Ensembl 11 +987.3 987250 0.9 GTF2F1 HDGF CTCF PKNOX1 GLI4 ELK1 HSF1 SCRT2 ZNF143 SCRT1 ENSG00000260274 SIN3A MAN2C1 CLK3 TYRO3P EDC3 LOC101929333 FBXO22 RN7SL489P GOLGA6D
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TYRO3P on UCSC Golden Path with GeneCards custom track

Genomic Locations for TYRO3P Gene

Genomic Locations for TYRO3P Gene
chr15:76,258,986-76,261,690
(GRCh38/hg38)
Size:
2,705 bases
Orientation:
Minus strand
chr15:76,551,327-76,554,031
(GRCh37/hg19)

Genomic View for TYRO3P Gene

Genes around TYRO3P on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TYRO3P Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TYRO3P Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TYRO3P Gene

Proteins for TYRO3P Gene

Post-translational modifications for TYRO3P Gene

No Post-translational modifications

No data available for DME Specific Peptides for TYRO3P Gene

Domains & Families for TYRO3P Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TYRO3P Gene

Function for TYRO3P Gene

Molecular function for TYRO3P Gene

GENATLAS Biochemistry:
tyrosine kinase 3,pseudogene

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TYRO3P Gene

Localization for TYRO3P Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for TYRO3P Gene

Pathways & Interactions for TYRO3P Gene

SuperPathways for TYRO3P Gene

No Data Available

Interacting Proteins for TYRO3P Gene

Gene Ontology (GO) - Biological Process for TYRO3P Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TYRO3P Gene

Drugs & Compounds for TYRO3P Gene

No Compound Related Data Available

Transcripts for TYRO3P Gene

mRNA/cDNA for TYRO3P Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TYRO3P Gene

No ASD Table

Relevant External Links for TYRO3P Gene

GeneLoc Exon Structure for
TYRO3P
ECgene alternative splicing isoforms for
TYRO3P

Expression for TYRO3P Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TYRO3P Gene

NURSA nuclear receptor signaling pathways regulating expression of TYRO3P Gene:

TYRO3P

SOURCE GeneReport for Unigene cluster for TYRO3P Gene:

Hs.684881
genes like me logo Genes that share expression patterns with TYRO3P: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TYRO3P Gene

Orthologs for TYRO3P Gene

Evolution for TYRO3P Gene

ENSEMBL:
Gene Tree for TYRO3P (if available)
TreeFam:
Gene Tree for TYRO3P (if available)

No data available for Orthologs for TYRO3P Gene

Paralogs for TYRO3P Gene

No data available for Paralogs for TYRO3P Gene

Variants for TYRO3P Gene

Sequence variations from dbSNP and Humsavar for TYRO3P Gene

SNP ID Clin Chr 15 pos Sequence Context AA Info Type
rs1000123072 -- 76,261,499(+) CCTCC(A/C)TGCTG intron-variant, upstream-variant-2KB
rs1000527029 -- 76,259,249(+) GATGT(A/G)TAAGG intron-variant, downstream-variant-500B
rs1000572149 -- 76,261,619(+) GCCGC(-/CAGCAGCAGCCCCAGCTGCTGTGG)CGGCA intron-variant, upstream-variant-2KB
rs1002476985 -- 76,260,342(+) TCTTT(A/C)GGTCT intron-variant, upstream-variant-2KB
rs1002540264 -- 76,261,920(+) AAGAT(A/G)GGTGG intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for TYRO3P Gene

Variant ID Type Subtype PubMed ID
nsv833057 CNV loss 17160897
nsv527608 CNV loss 19592680
nsv1128727 CNV duplication 24896259
nsv1116463 OTHER inversion 24896259
esv2749898 CNV deletion 23290073
esv2749895 CNV deletion 23290073

Relevant External Links for TYRO3P Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TYRO3P

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for TYRO3P Gene

Disorders for TYRO3P Gene

Relevant External Links for TYRO3P

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
TYRO3P

No disorders were found for TYRO3P Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TYRO3P Gene

Publications for TYRO3P Gene

  1. Regional localization of human chromosome 15 loci. (PMID: 7851890) Richard I … Roudaut C (Genomics 1994) 2 3 60
  2. The human TYRO3 gene and pseudogene are located in chromosome 15q14-q25. (PMID: 8262388) Polvi A … Alitalo K (Gene 1993) 3 60

Products for TYRO3P Gene

Sources for TYRO3P Gene

Content
Loading form....