Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TYRO3P Gene

Aliases for TYRO3P Gene

  • TYRO3P Protein Tyrosine Kinase Pseudogene 2 3 5

External Ids for TYRO3P Gene

Previous GeneCards Identifiers for TYRO3P Gene

  • GC15U990049
  • GC15M074339
  • GC15M076549

Summaries for TYRO3P Gene

GeneCards Summary for TYRO3P Gene

TYRO3P (TYRO3P Protein Tyrosine Kinase Pseudogene) is a Pseudogene.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TYRO3P Gene

Genomics for TYRO3P Gene

Regulatory Elements for TYRO3P Gene

Enhancers for TYRO3P Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH15G076309 1.4 Ensembl ENCODE 10.7 -51.0 -50970 5.9 MLX CREB3L1 AGO1 FEZF1 DMAP1 YY1 ZNF416 ZNF143 ZNF548 ZNF263 ENSG00000260274 FBXO22 SCAPER ETFA DNM1P35 TYRO3P ENSG00000203392 ISL2
GH15G075624 1.4 Ensembl ENCODE 10.5 +635.5 635461 3.8 MLX CREB3L1 DMAP1 YY1 SLC30A9 ZNF143 ZNF263 SP3 NFYC TBX21 ENSG00000260274 SNUPN MAN2C1 FBXO22 EDC3 TYRO3P COMMD4 ENSG00000260235
GH15G075901 1.2 ENCODE 10.5 +358.6 358638 3.6 CREB3L1 AGO1 DMAP1 YY1 SLC30A9 ZNF143 ZNF263 SP3 MEF2D ZNF610 FBXO22 ENSG00000260274 NRG4 DNM1P35 TYRO3P ENSG00000203392 UBE2Q2 RN7SL510P
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TYRO3P on UCSC Golden Path with GeneCards custom track

Genomic Location for TYRO3P Gene

Chromosome:
15
Start:
76,258,986 bp from pter
End:
76,261,690 bp from pter
Size:
2,705 bases
Orientation:
Minus strand

Genomic View for TYRO3P Gene

Genes around TYRO3P on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TYRO3P Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TYRO3P Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TYRO3P Gene

Proteins for TYRO3P Gene

Post-translational modifications for TYRO3P Gene

No Post-translational modifications

No data available for DME Specific Peptides for TYRO3P Gene

Domains & Families for TYRO3P Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TYRO3P Gene

Function for TYRO3P Gene

Molecular function for TYRO3P Gene

GENATLAS Biochemistry:
tyrosine kinase 3,pseudogene

Animal Model Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TYRO3P Gene

Localization for TYRO3P Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for TYRO3P Gene

Pathways & Interactions for TYRO3P Gene

SuperPathways for TYRO3P Gene

No Data Available

Interacting Proteins for TYRO3P Gene

Gene Ontology (GO) - Biological Process for TYRO3P Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TYRO3P Gene

Drugs & Compounds for TYRO3P Gene

No Compound Related Data Available

Transcripts for TYRO3P Gene

mRNA/cDNA for TYRO3P Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for TYRO3P Gene

No ASD Table

Relevant External Links for TYRO3P Gene

GeneLoc Exon Structure for
TYRO3P
ECgene alternative splicing isoforms for
TYRO3P

Expression for TYRO3P Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TYRO3P Gene

NURSA nuclear receptor signaling pathways regulating expression of TYRO3P Gene:

TYRO3P

SOURCE GeneReport for Unigene cluster for TYRO3P Gene:

Hs.684881
genes like me logo Genes that share expression patterns with TYRO3P: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TYRO3P Gene

Orthologs for TYRO3P Gene

Evolution for TYRO3P Gene

ENSEMBL:
Gene Tree for TYRO3P (if available)
TreeFam:
Gene Tree for TYRO3P (if available)

No data available for Orthologs for TYRO3P Gene

Paralogs for TYRO3P Gene

No data available for Paralogs for TYRO3P Gene

Variants for TYRO3P Gene

Sequence variations from dbSNP and Humsavar for TYRO3P Gene

SNP ID Clin Chr 15 pos Sequence Context AA Info Type
rs1000123072 -- 76,261,499(+) CCTCC(A/C)TGCTG intron-variant, upstream-variant-2KB
rs1000527029 -- 76,259,249(+) GATGT(A/G)TAAGG intron-variant, downstream-variant-500B
rs1000572149 -- 76,261,619(+) GCCGC(-/CAGCAGCAGCCCCAGCTGCTGTGG)CGGCA intron-variant, upstream-variant-2KB
rs1002476985 -- 76,260,342(+) TCTTT(A/C)GGTCT intron-variant, upstream-variant-2KB
rs1002540264 -- 76,261,920(+) AAGAT(A/G)GGTGG intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for TYRO3P Gene

Variant ID Type Subtype PubMed ID
esv2749895 CNV deletion 23290073
esv2749898 CNV deletion 23290073
nsv1116463 OTHER inversion 24896259
nsv1128727 CNV duplication 24896259
nsv527608 CNV loss 19592680
nsv833057 CNV loss 17160897

Relevant External Links for TYRO3P Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TYRO3P

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for TYRO3P Gene

Disorders for TYRO3P Gene

Relevant External Links for TYRO3P

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
TYRO3P

No disorders were found for TYRO3P Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TYRO3P Gene

Publications for TYRO3P Gene

  1. Regional localization of human chromosome 15 loci. (PMID: 7851890) Richard I. … Roudaut C. (Genomics 1994) 2 3 64
  2. The human TYRO3 gene and pseudogene are located in chromosome 15q14- q25. (PMID: 8262388) Polvi A. … Alitalo K. (Gene 1993) 3 64

Products for TYRO3P Gene

Sources for TYRO3P Gene

Content
Loading form....