Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TVP23A Gene

Aliases for TVP23A Gene

  • Trans-Golgi Network Vesicle Protein 23 Homolog A 2 3 5
  • Family With Sequence Similarity 18, Member A 2 3
  • FAM18A 3 4
  • Trans-Golgi Network Vesicle Protein 23 Homolog A (S. Cerevisiae) 2
  • Golgi Apparatus Membrane Protein TVP23 Homolog A 3
  • Protein FAM18A 3
  • YDR084C 3

External Ids for TVP23A Gene

Previous HGNC Symbols for TVP23A Gene

  • FAM18A

Previous GeneCards Identifiers for TVP23A Gene

  • GC16M010864
  • GC16M010873

Summaries for TVP23A Gene

Entrez Gene Summary for TVP23A Gene

  • This gene encodes a membrane protein associated with the Golgi apparatus, which plays a crucial role in intracellular vesicular transport. The encoded protein is likely associated with the late (trans) Golgi compartments, which are involved in the delivery of secretory and membrane proteins to the endosome, lysosome or the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

GeneCards Summary for TVP23A Gene

TVP23A (Trans-Golgi Network Vesicle Protein 23 Homolog A) is a Protein Coding gene. An important paralog of this gene is TVP23B.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TVP23A Gene

Genomics for TVP23A Gene

Regulatory Elements for TVP23A Gene

Enhancers for TVP23A Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around TVP23A on UCSC Golden Path with GeneCards custom track

Promoters for TVP23A Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for TVP23A Gene

10,760,919 bp from pter
10,818,859 bp from pter
57,941 bases
Minus strand

Genomic View for TVP23A Gene

Genes around TVP23A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TVP23A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TVP23A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TVP23A Gene

Proteins for TVP23A Gene

  • Protein details for TVP23A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Golgi apparatus membrane protein TVP23 homolog A
    Protein Accession:
    Secondary Accessions:
    • B2RUV4
    • B7ZW18

    Protein attributes for TVP23A Gene

    213 amino acids
    Molecular mass:
    24111 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for TVP23A Gene


neXtProt entry for TVP23A Gene

Post-translational modifications for TVP23A Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TVP23A Gene

Domains & Families for TVP23A Gene

Protein Domains for TVP23A Gene


Suggested Antigen Peptide Sequences for TVP23A Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TVP23 family.
  • Belongs to the TVP23 family.
genes like me logo Genes that share domains with TVP23A: view

No data available for Gene Families for TVP23A Gene

Function for TVP23A Gene

genes like me logo Genes that share phenotypes with TVP23A: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TVP23A Gene

Localization for TVP23A Gene

Subcellular locations from UniProtKB/Swiss-Prot for TVP23A Gene

Membrane; Multi-pass membrane protein.

Gene Ontology (GO) - Cellular Components for TVP23A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030173 integral component of Golgi membrane IBA --
genes like me logo Genes that share ontologies with TVP23A: view

No data available for Subcellular locations from COMPARTMENTS for TVP23A Gene

Pathways & Interactions for TVP23A Gene

SuperPathways for TVP23A Gene

No Data Available

Gene Ontology (GO) - Biological Process for TVP23A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009306 protein secretion IBA --
GO:0016192 vesicle-mediated transport IBA --
genes like me logo Genes that share ontologies with TVP23A: view

No data available for Pathways by source and SIGNOR curated interactions for TVP23A Gene

Drugs & Compounds for TVP23A Gene

No Compound Related Data Available

Transcripts for TVP23A Gene

mRNA/cDNA for TVP23A Gene

(7) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(11) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for TVP23A Gene

Trans-golgi network vesicle protein 23 homolog A (S. cerevisiae):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for TVP23A Gene

ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3 ^ 4 ^ 5a · 5b · 5c · 5d ^ 6a · 6b ^ 7a · 7b
SP1: - -
SP2: - - - -
SP3: -
SP4: - -

Relevant External Links for TVP23A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TVP23A Gene

mRNA expression in normal human tissues for TVP23A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for TVP23A Gene

This gene is overexpressed in Heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for TVP23A Gene

Protein tissue co-expression partners for TVP23A Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TVP23A Gene:


SOURCE GeneReport for Unigene cluster for TVP23A Gene:

genes like me logo Genes that share expression patterns with TVP23A: view

Primer Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for TVP23A Gene

Orthologs for TVP23A Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TVP23A Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia TVP23A 34
  • 88.89 (n)
  • 91.08 (a)
TVP23A 35
  • 90 (a)
(Canis familiaris)
Mammalia TVP23A 34
  • 87.64 (n)
  • 92.49 (a)
TVP23A 35
  • 92 (a)
(Mus musculus)
Mammalia Tvp23a 34
  • 84.98 (n)
  • 88.26 (a)
Tvp23a 16
Tvp23a 35
  • 85 (a)
(Pan troglodytes)
Mammalia TVP23A 34
  • 99.22 (n)
  • 98.12 (a)
TVP23A 35
  • 98 (a)
(Rattus norvegicus)
Mammalia Tvp23a 34
  • 84.19 (n)
  • 87.32 (a)
(Monodelphis domestica)
Mammalia TVP23A 35
  • 80 (a)
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 72 (a)
-- 35
  • 67 (a)
(Gallus gallus)
Aves FAM18A 34
  • 73.01 (n)
  • 77.07 (a)
TVP23A 35
  • 65 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tvp23a 34
  • 73.12 (n)
  • 77.49 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP012432 34
  • 55.69 (n)
  • 51.76 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG5021 34
  • 57.26 (n)
  • 50.26 (a)
CG5021 35
  • 43 (a)
(Caenorhabditis elegans)
Secernentea C34D4.4 35
  • 26 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AGR153C 34
  • 43.36 (n)
  • 32.87 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0C11869g 34
  • 45 (n)
  • 37.14 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes TVP23 34
  • 44 (n)
  • 38.67 (a)
TVP23 35
  • 31 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT1G09330 34
  • 48.37 (n)
  • 38.41 (a)
(Oryza sativa)
Liliopsida Os01g0331900 34
  • 46.91 (n)
  • 37.72 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU02733 34
  • 53.94 (n)
  • 43.64 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes tvp23 34
  • 47 (n)
  • 39.13 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4306 35
  • 46 (a)
Species where no ortholog for TVP23A was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for TVP23A Gene

Gene Tree for TVP23A (if available)
Gene Tree for TVP23A (if available)

Paralogs for TVP23A Gene

Paralogs for TVP23A Gene

(3) SIMAP similar genes for TVP23A Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with TVP23A: view

Variants for TVP23A Gene

Sequence variations from dbSNP and Humsavar for TVP23A Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs3040297 -- 10,803,286(+) tgtgt(-/GTGT/GTGTGT/GTGTGTGCGTGTGTGTGTGTGTGTGT)cagag intron-variant
rs3893293 -- 10,781,369(+) TGACA(C/G)AGTGA intron-variant
rs8060272 -- 10,777,739(+) GGGCG(C/T)GGTGG intron-variant
rs8060671 -- 10,786,956(+) TAGAC(C/T)TAAAA intron-variant
rs3976778 -- 10,782,122(-) cactt(A/T)gggaa intron-variant

Structural Variations from Database of Genomic Variants (DGV) for TVP23A Gene

Variant ID Type Subtype PubMed ID
esv2204919 CNV deletion 18987734
esv2678178 CNV deletion 23128226
esv2713976 CNV deletion 23290073
esv2763131 CNV loss 21179565
esv3637915 CNV loss 21293372
nsv1040428 CNV gain 25217958
nsv1071264 CNV deletion 25765185
nsv833140 CNV loss 17160897

Variation tolerance for TVP23A Gene

Residual Variation Intolerance Score: 65.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.45; 28.42% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TVP23A Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TVP23A Gene

Disorders for TVP23A Gene

Relevant External Links for TVP23A

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for TVP23A Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TVP23A Gene

Publications for TVP23A Gene

  1. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3 65
  2. Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation. (PMID: 15146197) Brandenberger R. … Stanton L.W. (Nat. Biotechnol. 2004) 3 65
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 4 65
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 4 65
  5. The sequence and analysis of duplication-rich human chromosome 16. (PMID: 15616553) Martin J. … Pennacchio L.A. (Nature 2004) 4 65

Products for TVP23A Gene

Sources for TVP23A Gene

Loading form....