Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TUBGCP2 Gene

protein-coding   GIFtS: 54
GCID: GC10M135094

tubulin, gamma complex associated protein 2

 Explore 3 diseases affiliated with
TUBGCP2 via our new
 Human Malady Compendium 
Biological research products
for TUBGCP2
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Tubulin, Gamma Complex Associated Protein 21 2     H103p1
GCP21 2 3     HGCP21
SPBC971 2     HGrip1031
Spc97p1 2     HSpc971
Gamma-Ring Complex Protein 103 KDa2 3     Grip1032
Spindle Pole Body Protein Spc97 Homolog2 3     Gamma-Tubulin Complex Component 22
GCP-22 3     

External Ids:    HGNC: 185991   Entrez Gene: 108442   Ensembl: ENSG000001306407   UniProtKB: Q9BSJ23   

Export aliases for TUBGCP2 gene to outside databases

Previous GC identifers: GC10M134007 GC10M134223 GC10M135009 GC10M134566 GC10M134982 GC10M134943 GC10M128639


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: GCP2_HUMAN, Q9BSJ2
Function: Gamma-tubulin complex is necessary for microtubule nucleation at the centrosome

Gene Wiki entry for TUBGCP2


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000010.10  NC_018921.1  NT_008818.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TUBGCP2 gene promoter:
         ER-alpha   RFX1   USF1   AP-2alpha isoform 3   AP-2alpha isoform 2   USF-1   STAT3   AP-2alpha isoform 4   AP-2alpha   AP-2alphaA   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTUBGCP2 promoter sequence
   Search SABiosciences Chromatin IP Primers for TUBGCP2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TUBGCP2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q26.3   Ensembl cytogenetic band:  10q26.3   HGNC cytogenetic band: 10q26.3

TUBGCP2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TUBGCP2 gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10M135094:  view genomic region     (about GC identifiers)

Start:
135,093,135 bp from pter      End:
135,125,841 bp from pter
Size:
32,707 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: GCP2_HUMAN, Q9BSJ2 (See protein sequence)
Recommended Name: Gamma-tubulin complex component 2  
Size: 902 amino acids; 102534 Da
Subunit: Gamma-tubulin complex is composed of gamma-tubulin, TUBGCP2, TUBGCP3, TUBGCP4, TUBGCP5 and TUBGCP6
Subcellular location: Cytoplasm, cytoskeleton, centrosome
Sequence caution: Sequence=BC005011; Type=Frameshift; Positions=513;
Secondary accessions: B4DM18 B7ZKL8 F5H4E0 F5H4L0 O43632 Q5VWX7
Alternative splicing: 3 isoforms:  Q9BSJ2-1   Q9BSJ2-3   Q9BSJ2-4   (No experimental confirmation available. Ref.4 (AAI43248) sequence is in conflict in position: 209:R->G)

Explore the universe of human proteins at neXtProt for TUBGCP2: NX_Q9BSJ2

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9BSJ2

  • TUBGCP2 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (3 alternative transcripts): 
    NP_001243546.1  NP_001243547.1  NP_006650.1  

    ENSEMBL proteins: 
     ENSP00000252936   ENSP00000357550   ENSP00000436438   ENSP00000357551   ENSP00000446093  
     ENSP00000395666  
    Reactome Protein details: Q9BSJ2
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: TUBGCP2
    OriGene Custom Protein Services for TUBGCP2 
    GenScript Custom Purified and Recombinant Proteins Services for TUBGCP2
    Novus Biologicals TUBGCP2 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for TUBGCP2

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000922spindle pole IEA--
    GO:0005634nucleus IDA--
    GO:0005730NOT nucleolus IDA--
    GO:0005813centrosome IDA--
    GO:0005815microtubule organizing center TAS9566967


    TUBGCP2 for ontologies           About GeneDecksing



    TUBGCP2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: TUBGCP2
    OriGene Custom Antibody Services for TUBGCP2 
    GenScript Custom Superior Antibodies Services for TUBGCP2
    Novus Biologicals TUBGCP2 Antibodies
    Search for Antibodies for TUBGCP2 at Abcam  
    Uscn Antibodies for TUBGCP2
    ThermoFisher Antibodies for TUBGCP2

    Assay Products for TUBGCP2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TUBGCP2
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for TUBGCP2


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TUBGCP2 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR007259 Spc97_Spc98

    Graphical View of Domain Structure for InterPro Entry Q9BSJ2

    ProtoNet protein and cluster: Q9BSJ2

    1 Blocks protein family: IPB007259 Spc97/Spc98

    UniProtKB/Swiss-Prot: GCP2_HUMAN, Q9BSJ2
    Similarity: Belongs to the TUBGCP family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: GCP2_HUMAN, Q9BSJ2
    Function: Gamma-tubulin complex is necessary for microtubule nucleation at the centrosome

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: TUBGCP2
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TUBGCP2
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate TUBGCP2
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TUBGCP2 (see all 7)
    OriGene shRNA RFP: TUBGCP2
    OriGene siRNA: TUBGCP2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TUBGCP2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TUBGCP2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: TUBGCP2 (NM_006659)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TUBGCP2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TUBGCP2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TUBGCP2
    Search LifeMap BioReagents cell lines for TUBGCP2

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TUBGCP2

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI16980960


    TUBGCP2 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for TUBGCP2:
     Decreased viability with pacli 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/6 super-pathways (see all 6About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Recruitment of mitotic centrosome proteins and complexes
    Centrosome maturation1.00
    G2/M Transition0.83
    Recruitment of mitotic centrosome proteins and complexes1.00
    Mitotic G2-G2/M phases0.81
    2Cell Cycle
    Cell Cycle1.00
    Cell Cycle, Mitotic0.84
    3Nanog in Mammalian ESC Pluripotency
    14-3-3 Induced Intracellular Signaling0.59
    4Microtubule-dependent trafficking of connexons from Golgi to the plasma membrane
    Recruitment of NuMA to mitotic centrosomes0.50
    5Ubiquitinated Orc1 is degraded by the proteasome
    Parkinson's Disease Pathway0.31

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    3 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for TUBGCP2
        14-3-3 Induced Intracellular Signaling
    Hedgehog Signaling in Mammals
    Parkinson's Disease Pathway

    5/7        Reactome Pathways for TUBGCP2 (see all 7)
        Centrosome maturation
    G2/M Transition
    Cell Cycle
    Recruitment of mitotic centrosome proteins and complexes
    Mitotic G2-G2/M phases



    TUBGCP2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for TUBGCP2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/821 Interacting proteins for TUBGCP2 (Q9BSJ22, 3 ENSP000002529364) via UniProtKB, MINT, STRING, and/or I2D (see all 821)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PCNTO956132, 3, ENSP000003525724MINT-7947479 I2D: score=3 STRING: ENSP00000352572
    SRP68Q9UHB92, 3MINT-7945693 MINT-7947479 I2D: score=2 
    TUBG1P232582, 3, ENSP000002514134MINT-7945693 MINT-7947479 MINT-7263751 I2D: score=3 STRING: ENSP00000251413
    TUBGCP3Q96CW52, 3, ENSP000002619654MINT-7945693 MINT-7947479 I2D: score=3 STRING: ENSP00000261965
    CKAP5Q140082, ENSP000003465664MINT-7945693 MINT-7947479 STRING: ENSP00000346566
    About this table

    Gene Ontology (GO): 5 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000086G2/M transition of mitotic cell cycle TAS--
    GO:0000226microtubule cytoskeleton organization ----
    GO:0000278mitotic cell cycle TAS--
    GO:0006461protein complex assembly TAS9566967
    GO:0007020microtubule nucleation TAS9566967


    TUBGCP2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    TUBGCP2 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TUBGCP2
    1 Novoseek chemical compound relationship for TUBGCP2 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    sucrose 29.6 1 9566967 (1)

    Search CenterWatch for drugs/clinical trials and news about TUBGCP2 / GCP2 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TUBGCP2 gene (3 alternative transcripts): 
    NM_001256617.1  NM_001256618.1  NM_006659.3  

    Unigene Cluster for TUBGCP2:

    Tubulin, gamma complex associated protein 2
    Hs.523370  [show with all ESTs]
    Unigene Representative Sequence: NR_046330
    10 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000252936 ENST00000477923 ENST00000368562(uc001lmf.1) ENST00000482278(uc001lmh.1)
    ENST00000487796 ENST00000470829 ENST00000480198 ENST00000368563(uc001lmg.1 uc010qvc.1 uc010qvd.1 uc009ybk.1)
    ENST00000543663 ENST00000417178

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: TUBGCP2
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TUBGCP2
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate TUBGCP2
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TUBGCP2 (see all 7)
    OriGene shRNA RFP: TUBGCP2
    OriGene siRNA: TUBGCP2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TUBGCP2
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: TUBGCP2 (NM_006659)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TUBGCP2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TUBGCP2 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TUBGCP2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TUBGCP2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TUBGCP2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TUBGCP2

    Additional cDNA sequence: 

    AF042379.1 AK092113.1 AK096087.1 AK223586.1 AK297251.1 AK299564.1 AK314520.1 BC005011.1 
    BC093770.1 BC111957.1 BC143247.1 NR_046330.1 

    24 DOTS entries:

    DT.100650692  DT.451655  DT.99943877  DT.100650690  DT.97759918  DT.95255018  DT.70103866  DT.100650694 
    DT.121285626  DT.438974  DT.97759917  DT.100029369  DT.121285513  DT.40126676  DT.91750445  DT.95254999 
    DT.95255003  DT.121285564  DT.121285600  DT.121285620  DT.95255002  DT.121285606  DT.91680333  DT.97793251 

    24/296 AceView cDNA sequences (see all 296):

    CB130528 BQ285999 BU633246 BM705507 BU187334 BM973814 AW028916 BM966742 
    AI560879 BM679188 BE671778 BQ073402 Z41968 AI264414 BQ883748 AA195691 
    BC052368 AF042379 CA421852 BQ217003 BQ923989 BQ895968 AL602684 AU130496 

    GeneLoc Exon Structure

    5/21 Alternative Splicing Database (ASD) splice patterns (SP) for TUBGCP2 (see all 21)    About this scheme

    ExUns: 1 ^ 2a · 2b · 2c · 2d ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b ^ 6a · 6b · 6c · 6d ^ 7 ^ 8 ^ 9 ^ 10a · 10b · 10c · 10d ^ 11a · 11b ^ 12a ·
    SP1:                    -     -     -     -                                                           -     -     -     -                       -               
    SP2:                                                                                                                                                            
    SP3:                    -     -     -     -                                                                                                                     
    SP4:                    -     -     -     -     -     -                                                                                                         
    SP5:              -     -     -     -     -                                                                                                                     

    ExUns: 12b · 12c ^ 13 ^ 14 ^ 15a · 15b ^ 16a · 16b ^ 17a · 17b ^ 18a · 18b · 18c ^ 19a · 19b ^ 20a · 20b ^ 21a · 21b ^ 22a · 22b ^ 23 ^ 24a · 24b ^ 25a · 25b
    SP1:        -           -     -                                                           -           -     -                                   -               
    SP2:                                                                                      -           -     -                                   -               
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            


    ECgene alternative splicing isoforms for TUBGCP2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TUBGCP2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: GCCAGCGTCA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See TUBGCP2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TUBGCP2

    SOURCE GeneReport for Unigene cluster: Hs.523370

    UniProtKB/Swiss-Prot: GCP2_HUMAN, Q9BSJ2
    Tissue specificity: Ubiquitously expressed

        SABiosciences Custom PCR Arrays for TUBGCP2
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TUBGCP2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TUBGCP2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TUBGCP2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TUBGCP2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TUBGCP2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TUBGCP2 gene from 8/32 species (see all 32)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tubgcp21 , 5 tubulin, gamma complex associated protein 21, 5 86.4(n)1
    91.24(a)1
      7 (84.98 cM)5
    742371  NM_133755.21  NP_598516.21 
     1399959555 
    chicken
    (Gallus gallus)
    Aves TUBGCP21 tubulin, gamma complex associated protein 2 76.25(n)
    85.17(a)
      423673  NM_001006496.1  NP_001006496.1 
    lizard
    (Anolis carolinensis)
    Reptilia TUBGCP26
    --
    75(a)
    1 ↔ 1
    GL344009.1(65423-80941)
    African clawed frog
    (Xenopus laevis)
    Amphibia BM180501.12   -- 78.45(n)    BM180501.1 
    zebrafish
    (Danio rerio)
    Actinopterygii BC054908.12   -- 77.9(n)   386975  BC054908.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Grip841 gamma-tubulin ring protein 84 53.22(n)
    38.5(a)
      32946  NM_167662.1  NP_728264.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons AT5G174101 Spc97 / Spc98 family of spindle pole body (SBP) component 47.53(n)
    41.72(a)
      831607  NM_180507.2  NP_850838.1 
    rice
    (Oryza sativa)
    Liliopsida Os04g05017001 hypothetical protein 47.14(n)
    39.57(a)
      4336312  NM_001059766.1  NP_001053231.1 


    ENSEMBL Gene Tree for TUBGCP2 (if available)
    TreeFam Gene Tree for TUBGCP2 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TUBGCP2 gene
    TUBGCP62  TUBGCP42  TUBGCP32  

    TUBGCP2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/845 NCBI SNPs in TUBGCP2 are shown (see all 845    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs750632701,2
    --128666550(+) AGCCAC/TGGCCG 1 -- us2k10--------
    rs728647981,2
    C,--128666856(+) AACTTG/ATGGAA 1 -- us2k12Minor allele frequency- A:0.06NA 122
    rs745679511,2
    --128667729(+) ACCCCA/GACAAA 1 -- us2k10--------
    rs1167529971,2
    C,F,--128667855(+) AACAAG/AATCCA 1 -- us2k11Minor allele frequency- A:0.04WA 118
    rs124121861,2
    C,H--128668507(+) AAGTAC/GTTGTA 1 -- int10--------
    rs664749511,2
    C--128668608(+) GCGGG-/ACCTGAGGT
    GGTGGGGCGGG
    GCCGG
    1 -- int11Minor allele frequency- ACCTGAGGTGGTGGGGCGGG:0.00NA 2
    rs1428147871,2
    C--128669479(+) GGCGGG/TGGGGG 1 -- int10--------
    rs412833311,2
    --128669842(+) GAAGGA/GAGGCT 1 -- int10--------
    rs122473071,2
    C,F,--128669974(+) CAGTCG/AGCCGT 1 -- int11Minor allele frequency- A:0.04WA 118
    rs123559501,2
    F,--128670268(+) caagcG/Aattct 1 -- int11Minor allele frequency- A:0.03NA 120

    HapMap Linkage Disequilibrium report for TUBGCP2 (135093135 - 135125841 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 18 variations for TUBGCP2
         15/17 CNVs (see all 17): 29878 2896 29877 5270 8673 5272 5273 71194 43307 3829 53744 4724 101099 4721 4722
         1 Indel: 61085

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TUBGCP2
    DNA2.0 Custom Variant and Variant Library Synthesis for TUBGCP2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TUBGCP2 for disorders           About GeneDecksing

    3 diseases for TUBGCP2:    About MalaCards
    cholera    neuroblastoma    parkinson's disease


    Export disorders for TUBGCP2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TUBGCP2 gene, integrated from 9 sources (see all 34):
    (articles sorted by number of sources associating them with TUBGCP2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The mammalian gamma-tubulin complex contains homologues of the yeast spindle pole body components spc97p and spc98p. (PubMed id 9566967)1, 2, 3, 9 Murphy S.M.... Stearns T. (1998)
    2. Immunoaffinity profiling of tyrosine phosphorylation in cancer cells. (PubMed id 15592455)1, 2 Rush J.... Comb M.J. (2005)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    4. An unappreciated role for RNA surveillance. (PubMed id 14759258)1, 2 Hillman R.T.... Brenner S.E. (2004)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    6. Stability of the small gamma-tubulin complex requires HCA66, a protein of the centrosome and the nucleolus. (PubMed id 19299467)1, 9 Fant X....Merdes A. (2009)
    7. GCP5 and GCP6: two new members of the human gamma-tubulin complex. (PubMed id 11694571)1, 9 Murphy S.M.... Stearns T. (2001)
    8. MINOS1 is a conserved component of mitofilin complexe s and required for mitochondrial function and cristae organization. (PubMed id 22114354)1 Alkhaja A.K....Deckers M. (2012)
    9. Initial characterization of the human central proteome. (PubMed id 21269460)2 Burkard T.R.... Colinge J. (2011)
    10. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 10844 HGNC: 18599 AceView: TUBGCP2 Ensembl:ENSG00000130640 euGenes: HUgn10844
    ECgene: TUBGCP2 H-InvDB: TUBGCP2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TUBGCP2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TUBGCP2 gene:
    Search GeneIP for patents involving TUBGCP2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for TUBGCP2   OriGene shRNA RFP for TUBGCP2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TUBGCP2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TUBGCP2  
     OriGene Protein Over-expression Lysate for TUBGCP2   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for TUBGCP2   OriGene 3'-UTR Clone for TUBGCP2  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TUBGCP2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TUBGCP2   OriGene Custom Protein Services for TUBGCP2  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TUBGCP2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TUBGCP2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TUBGCP2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TUBGCP2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TUBGCP2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TUBGCP2
     GenScript Custom Purified and Recombinant Proteins Services for TUBGCP2 GenScript cDNA clones with any tag delivered in your preferred vector for TUBGCP2
     GenScript Custom Assay Services for TUBGCP2 GenScript Custom Superior Antibodies Services for TUBGCP2
     GenScript Custom overexpressing Cell Line Services for TUBGCP2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TUBGCP2 promoter
     Search Chromatin IP Primers for TUBGCP2
     RT2 qPCR Primer Assay in human, mouse, rat TUBGCP2
     GNC Network for TUBGCP2
     SABiosciences PCR Arrays including human, mouse, rat TUBGCP2
     Search Tocris compounds for TUBGCP2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TUBGCP2 antibodies
     TUBGCP2 lysates
     Search for Antibodies for TUBGCP2 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for TUBGCP2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     TUBGCP2 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for TUBGCP2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TUBGCP2
     Browse SwitchGear 3'UTR luciferase reporter plasmids for TUBGCP2
     SwitchGear Promoter luciferase reporter plasmids for TUBGCP2
     ThermoFisher Antibodies for TUBGCP2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TUBGCP2
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TUBGCP2 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4